other:
Reverse Transcription:
Article Title: Functional genetics reveals a role for the proteasome in regulating centromere assembly
Article Snippet: Cells were washed three times with PBS-T and incubated with conjugated secondary antibodies (CENP-A screen: α-mouse AF488 Jackson ImmunoResearch; 715-545-150; CENP-T/ACA screen: α-rabbit AF750, Invitrogen A21039, α-human Cy2; Jackson ImmunoResearch; 709-225-149, α-chicken AF647; Invitrogen; A21449) diluted 1:500 and 0.4 U/μL RiboLock RNase inhibitor in 2.5% BSA in PBS for 45 minutes at room temperature in the dark. .. The reverse transcription reaction was set up as follows: 1X RevertAid RT buffer (Thermo Fisher Scientific; EP0452), 250 μM dNTPs (New England Biolabs; N0447L), 1 μM each biotinylated reverse transcription primer (oKC1015 /5Biosg/GTTGATAACGGACTAGCCTTATTTC), 200 μg/mL recombinant albumin (rAlbumin) (New England Biolabs; B9200S), 0.8 U/μL RiboLock RNase inhibitor, and 4.8 U/μL RevertAid H minus Reverse Transcriptase (Thermo Fisher Scientific EP0452). ..
Article Title: Direct RNA sequencing-based multi-omics profiling reveals transcriptional and post-transcriptional remodeling in mice with diet-induced atherosclerosis
Article Snippet: Briefly, 9 μL poly(A)+ RNA was combined with 3 μL NEBNext Quick Ligation Reaction Buffer (New England Biolabs, cat. #B6058, United States), 1 μL RT Adapter (Oxford Nanopore Technologies, cat. #SQK-RNA004, United Kingdom), and 2 μL T4 DNA Ligase (New England Biolabs, cat. #M0202, United States), followed by incubation at 25 °C for 10 min to ligate RNA adapters. .. For reverse transcription, 8 μL of 5 × first-strand buffer (New England Biolabs, cat. #M0681, United States), 2 μL of 10 mM Deoxynucleotide (dNTP) Solution Mix (New England Biolabs, cat. #N0447, United States), 9 μL of nuclease-free water, 4 μL of 0.1 M dithiothreitol, and 2 μL Induro Reverse Transcriptase (New England Biolabs, cat. #M0681, United States) were added, followed by incubation at 50 °C for 50 min and at 70 °C for 10 min. .. The reverse-transcribed RNA was purified using 1.8 × Agencourt RNAClean XP beads (Beckman, cat. #A63987, United States).
Ligation:
Polymerase Chain Reaction:Article Title: Pooled CRISPRi screening reveals fungal-specific drug target candidates.
Article Snippet: The rising rate of drug-resistant fungal infections and the emergence of intrinsically resistant pathogens pose growing clinical challenges.. Because fungi are closely related to mammals, developing antifungals without toxic off-target effects is difficult.. Targeted gene repression can model drug-mediated inhibition and reveal gene dosage sensitivity, but traditional approaches in the fungal pathogen Candida albicans are labour intensive and low throughput.
Recombinant:Article Title: Functional genetics reveals a role for the proteasome in regulating centromere assembly
Article Snippet: Cells were washed three times with PBS-T and incubated with conjugated secondary antibodies (CENP-A screen: α-mouse AF488 Jackson ImmunoResearch; 715-545-150; CENP-T/ACA screen: α-rabbit AF750, Invitrogen A21039, α-human Cy2; Jackson ImmunoResearch; 709-225-149, α-chicken AF647; Invitrogen; A21449) diluted 1:500 and 0.4 U/μL RiboLock RNase inhibitor in 2.5% BSA in PBS for 45 minutes at room temperature in the dark. .. The reverse transcription reaction was set up as follows: 1X RevertAid RT buffer (Thermo Fisher Scientific; EP0452), 250 μM dNTPs (New England Biolabs; N0447L), 1 μM each biotinylated reverse transcription primer (oKC1015 /5Biosg/GTTGATAACGGACTAGCCTTATTTC), 200 μg/mL recombinant albumin (rAlbumin) (New England Biolabs; B9200S), 0.8 U/μL RiboLock RNase inhibitor, and 4.8 U/μL RevertAid H minus Reverse Transcriptase (Thermo Fisher Scientific EP0452). ..
Article Title: Protocol for rolling circle amplification-based nanopore sequencing of eccDNA from cell and plasma samples.
Article Snippet: .. Biological samples Pooled human plasma sample used for cfDNA extraction This paper N/A Chemicals, peptides, and recombinant proteins FastDigest MssI enzyme Thermo Cat# FD1344 Exonuclease V NEB Cat# M0345 Adenosine 5′-Triphosphate (ATP) (10 mM) NEB Cat# P0756 Nuclease-free water (NFW) Solarbio Cat# R1600 DNA extraction solution (phenol-chloroformisoamyl alcohol, 25:24:1) Solabio Cat# P1012 Glycogen Roche Cat# 10901393001 3 M sodium acetate Solabio Cat# A1070 TE Buffer Solarbio Cat# T1120 Phi29 MAX DNA Polymerase Vazyme Cat# EP0091 dNTPs (10 mM) NEB Cat# N0447 Recombinant Albumin (20mg/mL) NEB Cat# B9200 Pyrophosphatase, Inorganic Thermo Cat# EF0221 T7 Endonuclease I NEB Cat# M0302 T4 Ligase NEB Cat# E6056 Critical commercial assays 23 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711 E.Z.N.A. Plasmid DNA Mini Kit I Omega Cat# D6943 Plasma Cell-Free DNA Extraction Kit APOSTLE Cat# A17622CN Qubit 13 dsDNA HS Assay Kits Thermo Fisher Scientific Cat# Q33231 SPRI beads Beckman Cat# B23317 NEBNext FFPE DNA Repair Mix NEB Cat# E7360 Ultra II End-prep enzyme mix NEB Cat# E7546 NEB Blunt/TA Ligase Master Mix NEB Cat# M0367 Native Barcoding Kit 24 V14 ONT Cat# SQK-NBD114.24 Flow Cell Wash Kit ONT Cat# EXP-WSH004 Deposited data Raw nanopore sequencing data for eccDNA profiling of Li et al.1 This paper PRJCA052047 Raw nanopore sequencing data for eccDNA profiling of four Huh7 cell samples and one pooled human plasma sample This paper PRJCA069021 Experimental models: Cell lines Human: HepG2 Wuhan Procell Biotechnology Co., Ltd. Cat# CL-0103 Human: Huh7 Shanghai Xunyi Biotechnology Co., Ltd. Cat# MXC58 Oligonucleotides Exo-random primer (500 μM) Thermo Cat# SO181 Primer ND1 Forward: CCCTAAAACCCGCCACATCT Reverse: GAGCGATGGTGAGAGCTAAGGT This paper N/A Primer H-GAPDH Forward: CTGGGCTACACTGAGCACC Reverse: AAGTGGTCGTTGAGGGCAATG This paper N/A Primer MIR621-A Forward: GGATCATATTCCACGCTGACTAT Reverse: AGTCCCATTTCTATTTTACTTCG This paper N/A Primer MIR621-B Forward: AATTCACTGACCAACCAACCAA Reverse: TTTGGTCAGTGAATACATACATATGGC This paper N/A (Continued on next page) STAR Protocols 7, 104865, December 18, 2026 3 STEP-BY-STEP METHOD DETAILS Isolate crude circular DNA Timing: 3 h In this step, we describe the crude extraction of circular DNA from tumor cell lines and circular cfDNA from plasma samples. ..
Incubation:Article Title: Direct RNA sequencing-based multi-omics profiling reveals transcriptional and post-transcriptional remodeling in mice with diet-induced atherosclerosis
Article Snippet: Briefly, 9 μL poly(A)+ RNA was combined with 3 μL NEBNext Quick Ligation Reaction Buffer (New England Biolabs, cat. #B6058, United States), 1 μL RT Adapter (Oxford Nanopore Technologies, cat. #SQK-RNA004, United Kingdom), and 2 μL T4 DNA Ligase (New England Biolabs, cat. #M0202, United States), followed by incubation at 25 °C for 10 min to ligate RNA adapters. .. For reverse transcription, 8 μL of 5 × first-strand buffer (New England Biolabs, cat. #M0681, United States), 2 μL of 10 mM Deoxynucleotide (dNTP) Solution Mix (New England Biolabs, cat. #N0447, United States), 9 μL of nuclease-free water, 4 μL of 0.1 M dithiothreitol, and 2 μL Induro Reverse Transcriptase (New England Biolabs, cat. #M0681, United States) were added, followed by incubation at 50 °C for 50 min and at 70 °C for 10 min. .. The reverse-transcribed RNA was purified using 1.8 × Agencourt RNAClean XP beads (Beckman, cat. #A63987, United States).
Clinical Proteomics:Article Title: Protocol for rolling circle amplification-based nanopore sequencing of eccDNA from cell and plasma samples.
Article Snippet: .. Biological samples Pooled human plasma sample used for cfDNA extraction This paper N/A Chemicals, peptides, and recombinant proteins FastDigest MssI enzyme Thermo Cat# FD1344 Exonuclease V NEB Cat# M0345 Adenosine 5′-Triphosphate (ATP) (10 mM) NEB Cat# P0756 Nuclease-free water (NFW) Solarbio Cat# R1600 DNA extraction solution (phenol-chloroformisoamyl alcohol, 25:24:1) Solabio Cat# P1012 Glycogen Roche Cat# 10901393001 3 M sodium acetate Solabio Cat# A1070 TE Buffer Solarbio Cat# T1120 Phi29 MAX DNA Polymerase Vazyme Cat# EP0091 dNTPs (10 mM) NEB Cat# N0447 Recombinant Albumin (20mg/mL) NEB Cat# B9200 Pyrophosphatase, Inorganic Thermo Cat# EF0221 T7 Endonuclease I NEB Cat# M0302 T4 Ligase NEB Cat# E6056 Critical commercial assays 23 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711 E.Z.N.A. Plasmid DNA Mini Kit I Omega Cat# D6943 Plasma Cell-Free DNA Extraction Kit APOSTLE Cat# A17622CN Qubit 13 dsDNA HS Assay Kits Thermo Fisher Scientific Cat# Q33231 SPRI beads Beckman Cat# B23317 NEBNext FFPE DNA Repair Mix NEB Cat# E7360 Ultra II End-prep enzyme mix NEB Cat# E7546 NEB Blunt/TA Ligase Master Mix NEB Cat# M0367 Native Barcoding Kit 24 V14 ONT Cat# SQK-NBD114.24 Flow Cell Wash Kit ONT Cat# EXP-WSH004 Deposited data Raw nanopore sequencing data for eccDNA profiling of Li et al.1 This paper PRJCA052047 Raw nanopore sequencing data for eccDNA profiling of four Huh7 cell samples and one pooled human plasma sample This paper PRJCA069021 Experimental models: Cell lines Human: HepG2 Wuhan Procell Biotechnology Co., Ltd. Cat# CL-0103 Human: Huh7 Shanghai Xunyi Biotechnology Co., Ltd. Cat# MXC58 Oligonucleotides Exo-random primer (500 μM) Thermo Cat# SO181 Primer ND1 Forward: CCCTAAAACCCGCCACATCT Reverse: GAGCGATGGTGAGAGCTAAGGT This paper N/A Primer H-GAPDH Forward: CTGGGCTACACTGAGCACC Reverse: AAGTGGTCGTTGAGGGCAATG This paper N/A Primer MIR621-A Forward: GGATCATATTCCACGCTGACTAT Reverse: AGTCCCATTTCTATTTTACTTCG This paper N/A Primer MIR621-B Forward: AATTCACTGACCAACCAACCAA Reverse: TTTGGTCAGTGAATACATACATATGGC This paper N/A (Continued on next page) STAR Protocols 7, 104865, December 18, 2026 3 STEP-BY-STEP METHOD DETAILS Isolate crude circular DNA Timing: 3 h In this step, we describe the crude extraction of circular DNA from tumor cell lines and circular cfDNA from plasma samples. ..
Extraction:Article Title: Protocol for rolling circle amplification-based nanopore sequencing of eccDNA from cell and plasma samples.
Article Snippet: .. Biological samples Pooled human plasma sample used for cfDNA extraction This paper N/A Chemicals, peptides, and recombinant proteins FastDigest MssI enzyme Thermo Cat# FD1344 Exonuclease V NEB Cat# M0345 Adenosine 5′-Triphosphate (ATP) (10 mM) NEB Cat# P0756 Nuclease-free water (NFW) Solarbio Cat# R1600 DNA extraction solution (phenol-chloroformisoamyl alcohol, 25:24:1) Solabio Cat# P1012 Glycogen Roche Cat# 10901393001 3 M sodium acetate Solabio Cat# A1070 TE Buffer Solarbio Cat# T1120 Phi29 MAX DNA Polymerase Vazyme Cat# EP0091 dNTPs (10 mM) NEB Cat# N0447 Recombinant Albumin (20mg/mL) NEB Cat# B9200 Pyrophosphatase, Inorganic Thermo Cat# EF0221 T7 Endonuclease I NEB Cat# M0302 T4 Ligase NEB Cat# E6056 Critical commercial assays 23 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711 E.Z.N.A. Plasmid DNA Mini Kit I Omega Cat# D6943 Plasma Cell-Free DNA Extraction Kit APOSTLE Cat# A17622CN Qubit 13 dsDNA HS Assay Kits Thermo Fisher Scientific Cat# Q33231 SPRI beads Beckman Cat# B23317 NEBNext FFPE DNA Repair Mix NEB Cat# E7360 Ultra II End-prep enzyme mix NEB Cat# E7546 NEB Blunt/TA Ligase Master Mix NEB Cat# M0367 Native Barcoding Kit 24 V14 ONT Cat# SQK-NBD114.24 Flow Cell Wash Kit ONT Cat# EXP-WSH004 Deposited data Raw nanopore sequencing data for eccDNA profiling of Li et al.1 This paper PRJCA052047 Raw nanopore sequencing data for eccDNA profiling of four Huh7 cell samples and one pooled human plasma sample This paper PRJCA069021 Experimental models: Cell lines Human: HepG2 Wuhan Procell Biotechnology Co., Ltd. Cat# CL-0103 Human: Huh7 Shanghai Xunyi Biotechnology Co., Ltd. Cat# MXC58 Oligonucleotides Exo-random primer (500 μM) Thermo Cat# SO181 Primer ND1 Forward: CCCTAAAACCCGCCACATCT Reverse: GAGCGATGGTGAGAGCTAAGGT This paper N/A Primer H-GAPDH Forward: CTGGGCTACACTGAGCACC Reverse: AAGTGGTCGTTGAGGGCAATG This paper N/A Primer MIR621-A Forward: GGATCATATTCCACGCTGACTAT Reverse: AGTCCCATTTCTATTTTACTTCG This paper N/A Primer MIR621-B Forward: AATTCACTGACCAACCAACCAA Reverse: TTTGGTCAGTGAATACATACATATGGC This paper N/A (Continued on next page) STAR Protocols 7, 104865, December 18, 2026 3 STEP-BY-STEP METHOD DETAILS Isolate crude circular DNA Timing: 3 h In this step, we describe the crude extraction of circular DNA from tumor cell lines and circular cfDNA from plasma samples. ..
DNA Extraction:Article Title: Protocol for rolling circle amplification-based nanopore sequencing of eccDNA from cell and plasma samples.
Article Snippet: .. Biological samples Pooled human plasma sample used for cfDNA extraction This paper N/A Chemicals, peptides, and recombinant proteins FastDigest MssI enzyme Thermo Cat# FD1344 Exonuclease V NEB Cat# M0345 Adenosine 5′-Triphosphate (ATP) (10 mM) NEB Cat# P0756 Nuclease-free water (NFW) Solarbio Cat# R1600 DNA extraction solution (phenol-chloroformisoamyl alcohol, 25:24:1) Solabio Cat# P1012 Glycogen Roche Cat# 10901393001 3 M sodium acetate Solabio Cat# A1070 TE Buffer Solarbio Cat# T1120 Phi29 MAX DNA Polymerase Vazyme Cat# EP0091 dNTPs (10 mM) NEB Cat# N0447 Recombinant Albumin (20mg/mL) NEB Cat# B9200 Pyrophosphatase, Inorganic Thermo Cat# EF0221 T7 Endonuclease I NEB Cat# M0302 T4 Ligase NEB Cat# E6056 Critical commercial assays 23 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711 E.Z.N.A. Plasmid DNA Mini Kit I Omega Cat# D6943 Plasma Cell-Free DNA Extraction Kit APOSTLE Cat# A17622CN Qubit 13 dsDNA HS Assay Kits Thermo Fisher Scientific Cat# Q33231 SPRI beads Beckman Cat# B23317 NEBNext FFPE DNA Repair Mix NEB Cat# E7360 Ultra II End-prep enzyme mix NEB Cat# E7546 NEB Blunt/TA Ligase Master Mix NEB Cat# M0367 Native Barcoding Kit 24 V14 ONT Cat# SQK-NBD114.24 Flow Cell Wash Kit ONT Cat# EXP-WSH004 Deposited data Raw nanopore sequencing data for eccDNA profiling of Li et al.1 This paper PRJCA052047 Raw nanopore sequencing data for eccDNA profiling of four Huh7 cell samples and one pooled human plasma sample This paper PRJCA069021 Experimental models: Cell lines Human: HepG2 Wuhan Procell Biotechnology Co., Ltd. Cat# CL-0103 Human: Huh7 Shanghai Xunyi Biotechnology Co., Ltd. Cat# MXC58 Oligonucleotides Exo-random primer (500 μM) Thermo Cat# SO181 Primer ND1 Forward: CCCTAAAACCCGCCACATCT Reverse: GAGCGATGGTGAGAGCTAAGGT This paper N/A Primer H-GAPDH Forward: CTGGGCTACACTGAGCACC Reverse: AAGTGGTCGTTGAGGGCAATG This paper N/A Primer MIR621-A Forward: GGATCATATTCCACGCTGACTAT Reverse: AGTCCCATTTCTATTTTACTTCG This paper N/A Primer MIR621-B Forward: AATTCACTGACCAACCAACCAA Reverse: TTTGGTCAGTGAATACATACATATGGC This paper N/A (Continued on next page) STAR Protocols 7, 104865, December 18, 2026 3 STEP-BY-STEP METHOD DETAILS Isolate crude circular DNA Timing: 3 h In this step, we describe the crude extraction of circular DNA from tumor cell lines and circular cfDNA from plasma samples. ..
Real-time Polymerase Chain Reaction:Article Title: Protocol for rolling circle amplification-based nanopore sequencing of eccDNA from cell and plasma samples.
Article Snippet: .. Biological samples Pooled human plasma sample used for cfDNA extraction This paper N/A Chemicals, peptides, and recombinant proteins FastDigest MssI enzyme Thermo Cat# FD1344 Exonuclease V NEB Cat# M0345 Adenosine 5′-Triphosphate (ATP) (10 mM) NEB Cat# P0756 Nuclease-free water (NFW) Solarbio Cat# R1600 DNA extraction solution (phenol-chloroformisoamyl alcohol, 25:24:1) Solabio Cat# P1012 Glycogen Roche Cat# 10901393001 3 M sodium acetate Solabio Cat# A1070 TE Buffer Solarbio Cat# T1120 Phi29 MAX DNA Polymerase Vazyme Cat# EP0091 dNTPs (10 mM) NEB Cat# N0447 Recombinant Albumin (20mg/mL) NEB Cat# B9200 Pyrophosphatase, Inorganic Thermo Cat# EF0221 T7 Endonuclease I NEB Cat# M0302 T4 Ligase NEB Cat# E6056 Critical commercial assays 23 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711 E.Z.N.A. Plasmid DNA Mini Kit I Omega Cat# D6943 Plasma Cell-Free DNA Extraction Kit APOSTLE Cat# A17622CN Qubit 13 dsDNA HS Assay Kits Thermo Fisher Scientific Cat# Q33231 SPRI beads Beckman Cat# B23317 NEBNext FFPE DNA Repair Mix NEB Cat# E7360 Ultra II End-prep enzyme mix NEB Cat# E7546 NEB Blunt/TA Ligase Master Mix NEB Cat# M0367 Native Barcoding Kit 24 V14 ONT Cat# SQK-NBD114.24 Flow Cell Wash Kit ONT Cat# EXP-WSH004 Deposited data Raw nanopore sequencing data for eccDNA profiling of Li et al.1 This paper PRJCA052047 Raw nanopore sequencing data for eccDNA profiling of four Huh7 cell samples and one pooled human plasma sample This paper PRJCA069021 Experimental models: Cell lines Human: HepG2 Wuhan Procell Biotechnology Co., Ltd. Cat# CL-0103 Human: Huh7 Shanghai Xunyi Biotechnology Co., Ltd. Cat# MXC58 Oligonucleotides Exo-random primer (500 μM) Thermo Cat# SO181 Primer ND1 Forward: CCCTAAAACCCGCCACATCT Reverse: GAGCGATGGTGAGAGCTAAGGT This paper N/A Primer H-GAPDH Forward: CTGGGCTACACTGAGCACC Reverse: AAGTGGTCGTTGAGGGCAATG This paper N/A Primer MIR621-A Forward: GGATCATATTCCACGCTGACTAT Reverse: AGTCCCATTTCTATTTTACTTCG This paper N/A Primer MIR621-B Forward: AATTCACTGACCAACCAACCAA Reverse: TTTGGTCAGTGAATACATACATATGGC This paper N/A (Continued on next page) STAR Protocols 7, 104865, December 18, 2026 3 STEP-BY-STEP METHOD DETAILS Isolate crude circular DNA Timing: 3 h In this step, we describe the crude extraction of circular DNA from tumor cell lines and circular cfDNA from plasma samples. ..
Plasmid Preparation:Article Title: Protocol for rolling circle amplification-based nanopore sequencing of eccDNA from cell and plasma samples.
Article Snippet: .. Biological samples Pooled human plasma sample used for cfDNA extraction This paper N/A Chemicals, peptides, and recombinant proteins FastDigest MssI enzyme Thermo Cat# FD1344 Exonuclease V NEB Cat# M0345 Adenosine 5′-Triphosphate (ATP) (10 mM) NEB Cat# P0756 Nuclease-free water (NFW) Solarbio Cat# R1600 DNA extraction solution (phenol-chloroformisoamyl alcohol, 25:24:1) Solabio Cat# P1012 Glycogen Roche Cat# 10901393001 3 M sodium acetate Solabio Cat# A1070 TE Buffer Solarbio Cat# T1120 Phi29 MAX DNA Polymerase Vazyme Cat# EP0091 dNTPs (10 mM) NEB Cat# N0447 Recombinant Albumin (20mg/mL) NEB Cat# B9200 Pyrophosphatase, Inorganic Thermo Cat# EF0221 T7 Endonuclease I NEB Cat# M0302 T4 Ligase NEB Cat# E6056 Critical commercial assays 23 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711 E.Z.N.A. Plasmid DNA Mini Kit I Omega Cat# D6943 Plasma Cell-Free DNA Extraction Kit APOSTLE Cat# A17622CN Qubit 13 dsDNA HS Assay Kits Thermo Fisher Scientific Cat# Q33231 SPRI beads Beckman Cat# B23317 NEBNext FFPE DNA Repair Mix NEB Cat# E7360 Ultra II End-prep enzyme mix NEB Cat# E7546 NEB Blunt/TA Ligase Master Mix NEB Cat# M0367 Native Barcoding Kit 24 V14 ONT Cat# SQK-NBD114.24 Flow Cell Wash Kit ONT Cat# EXP-WSH004 Deposited data Raw nanopore sequencing data for eccDNA profiling of Li et al.1 This paper PRJCA052047 Raw nanopore sequencing data for eccDNA profiling of four Huh7 cell samples and one pooled human plasma sample This paper PRJCA069021 Experimental models: Cell lines Human: HepG2 Wuhan Procell Biotechnology Co., Ltd. Cat# CL-0103 Human: Huh7 Shanghai Xunyi Biotechnology Co., Ltd. Cat# MXC58 Oligonucleotides Exo-random primer (500 μM) Thermo Cat# SO181 Primer ND1 Forward: CCCTAAAACCCGCCACATCT Reverse: GAGCGATGGTGAGAGCTAAGGT This paper N/A Primer H-GAPDH Forward: CTGGGCTACACTGAGCACC Reverse: AAGTGGTCGTTGAGGGCAATG This paper N/A Primer MIR621-A Forward: GGATCATATTCCACGCTGACTAT Reverse: AGTCCCATTTCTATTTTACTTCG This paper N/A Primer MIR621-B Forward: AATTCACTGACCAACCAACCAA Reverse: TTTGGTCAGTGAATACATACATATGGC This paper N/A (Continued on next page) STAR Protocols 7, 104865, December 18, 2026 3 STEP-BY-STEP METHOD DETAILS Isolate crude circular DNA Timing: 3 h In this step, we describe the crude extraction of circular DNA from tumor cell lines and circular cfDNA from plasma samples. ..
Qubit:Article Title: Protocol for rolling circle amplification-based nanopore sequencing of eccDNA from cell and plasma samples.
Article Snippet: .. Biological samples Pooled human plasma sample used for cfDNA extraction This paper N/A Chemicals, peptides, and recombinant proteins FastDigest MssI enzyme Thermo Cat# FD1344 Exonuclease V NEB Cat# M0345 Adenosine 5′-Triphosphate (ATP) (10 mM) NEB Cat# P0756 Nuclease-free water (NFW) Solarbio Cat# R1600 DNA extraction solution (phenol-chloroformisoamyl alcohol, 25:24:1) Solabio Cat# P1012 Glycogen Roche Cat# 10901393001 3 M sodium acetate Solabio Cat# A1070 TE Buffer Solarbio Cat# T1120 Phi29 MAX DNA Polymerase Vazyme Cat# EP0091 dNTPs (10 mM) NEB Cat# N0447 Recombinant Albumin (20mg/mL) NEB Cat# B9200 Pyrophosphatase, Inorganic Thermo Cat# EF0221 T7 Endonuclease I NEB Cat# M0302 T4 Ligase NEB Cat# E6056 Critical commercial assays 23 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711 E.Z.N.A. Plasmid DNA Mini Kit I Omega Cat# D6943 Plasma Cell-Free DNA Extraction Kit APOSTLE Cat# A17622CN Qubit 13 dsDNA HS Assay Kits Thermo Fisher Scientific Cat# Q33231 SPRI beads Beckman Cat# B23317 NEBNext FFPE DNA Repair Mix NEB Cat# E7360 Ultra II End-prep enzyme mix NEB Cat# E7546 NEB Blunt/TA Ligase Master Mix NEB Cat# M0367 Native Barcoding Kit 24 V14 ONT Cat# SQK-NBD114.24 Flow Cell Wash Kit ONT Cat# EXP-WSH004 Deposited data Raw nanopore sequencing data for eccDNA profiling of Li et al.1 This paper PRJCA052047 Raw nanopore sequencing data for eccDNA profiling of four Huh7 cell samples and one pooled human plasma sample This paper PRJCA069021 Experimental models: Cell lines Human: HepG2 Wuhan Procell Biotechnology Co., Ltd. Cat# CL-0103 Human: Huh7 Shanghai Xunyi Biotechnology Co., Ltd. Cat# MXC58 Oligonucleotides Exo-random primer (500 μM) Thermo Cat# SO181 Primer ND1 Forward: CCCTAAAACCCGCCACATCT Reverse: GAGCGATGGTGAGAGCTAAGGT This paper N/A Primer H-GAPDH Forward: CTGGGCTACACTGAGCACC Reverse: AAGTGGTCGTTGAGGGCAATG This paper N/A Primer MIR621-A Forward: GGATCATATTCCACGCTGACTAT Reverse: AGTCCCATTTCTATTTTACTTCG This paper N/A Primer MIR621-B Forward: AATTCACTGACCAACCAACCAA Reverse: TTTGGTCAGTGAATACATACATATGGC This paper N/A (Continued on next page) STAR Protocols 7, 104865, December 18, 2026 3 STEP-BY-STEP METHOD DETAILS Isolate crude circular DNA Timing: 3 h In this step, we describe the crude extraction of circular DNA from tumor cell lines and circular cfDNA from plasma samples. ..
Formalin-fixed Paraffin-Embedded:Article Title: Protocol for rolling circle amplification-based nanopore sequencing of eccDNA from cell and plasma samples.
Article Snippet: .. Biological samples Pooled human plasma sample used for cfDNA extraction This paper N/A Chemicals, peptides, and recombinant proteins FastDigest MssI enzyme Thermo Cat# FD1344 Exonuclease V NEB Cat# M0345 Adenosine 5′-Triphosphate (ATP) (10 mM) NEB Cat# P0756 Nuclease-free water (NFW) Solarbio Cat# R1600 DNA extraction solution (phenol-chloroformisoamyl alcohol, 25:24:1) Solabio Cat# P1012 Glycogen Roche Cat# 10901393001 3 M sodium acetate Solabio Cat# A1070 TE Buffer Solarbio Cat# T1120 Phi29 MAX DNA Polymerase Vazyme Cat# EP0091 dNTPs (10 mM) NEB Cat# N0447 Recombinant Albumin (20mg/mL) NEB Cat# B9200 Pyrophosphatase, Inorganic Thermo Cat# EF0221 T7 Endonuclease I NEB Cat# M0302 T4 Ligase NEB Cat# E6056 Critical commercial assays 23 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711 E.Z.N.A. Plasmid DNA Mini Kit I Omega Cat# D6943 Plasma Cell-Free DNA Extraction Kit APOSTLE Cat# A17622CN Qubit 13 dsDNA HS Assay Kits Thermo Fisher Scientific Cat# Q33231 SPRI beads Beckman Cat# B23317 NEBNext FFPE DNA Repair Mix NEB Cat# E7360 Ultra II End-prep enzyme mix NEB Cat# E7546 NEB Blunt/TA Ligase Master Mix NEB Cat# M0367 Native Barcoding Kit 24 V14 ONT Cat# SQK-NBD114.24 Flow Cell Wash Kit ONT Cat# EXP-WSH004 Deposited data Raw nanopore sequencing data for eccDNA profiling of Li et al.1 This paper PRJCA052047 Raw nanopore sequencing data for eccDNA profiling of four Huh7 cell samples and one pooled human plasma sample This paper PRJCA069021 Experimental models: Cell lines Human: HepG2 Wuhan Procell Biotechnology Co., Ltd. Cat# CL-0103 Human: Huh7 Shanghai Xunyi Biotechnology Co., Ltd. Cat# MXC58 Oligonucleotides Exo-random primer (500 μM) Thermo Cat# SO181 Primer ND1 Forward: CCCTAAAACCCGCCACATCT Reverse: GAGCGATGGTGAGAGCTAAGGT This paper N/A Primer H-GAPDH Forward: CTGGGCTACACTGAGCACC Reverse: AAGTGGTCGTTGAGGGCAATG This paper N/A Primer MIR621-A Forward: GGATCATATTCCACGCTGACTAT Reverse: AGTCCCATTTCTATTTTACTTCG This paper N/A Primer MIR621-B Forward: AATTCACTGACCAACCAACCAA Reverse: TTTGGTCAGTGAATACATACATATGGC This paper N/A (Continued on next page) STAR Protocols 7, 104865, December 18, 2026 3 STEP-BY-STEP METHOD DETAILS Isolate crude circular DNA Timing: 3 h In this step, we describe the crude extraction of circular DNA from tumor cell lines and circular cfDNA from plasma samples. ..
Flow Cytometry:Article Title: Protocol for rolling circle amplification-based nanopore sequencing of eccDNA from cell and plasma samples.
Article Snippet: .. Biological samples Pooled human plasma sample used for cfDNA extraction This paper N/A Chemicals, peptides, and recombinant proteins FastDigest MssI enzyme Thermo Cat# FD1344 Exonuclease V NEB Cat# M0345 Adenosine 5′-Triphosphate (ATP) (10 mM) NEB Cat# P0756 Nuclease-free water (NFW) Solarbio Cat# R1600 DNA extraction solution (phenol-chloroformisoamyl alcohol, 25:24:1) Solabio Cat# P1012 Glycogen Roche Cat# 10901393001 3 M sodium acetate Solabio Cat# A1070 TE Buffer Solarbio Cat# T1120 Phi29 MAX DNA Polymerase Vazyme Cat# EP0091 dNTPs (10 mM) NEB Cat# N0447 Recombinant Albumin (20mg/mL) NEB Cat# B9200 Pyrophosphatase, Inorganic Thermo Cat# EF0221 T7 Endonuclease I NEB Cat# M0302 T4 Ligase NEB Cat# E6056 Critical commercial assays 23 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711 E.Z.N.A. Plasmid DNA Mini Kit I Omega Cat# D6943 Plasma Cell-Free DNA Extraction Kit APOSTLE Cat# A17622CN Qubit 13 dsDNA HS Assay Kits Thermo Fisher Scientific Cat# Q33231 SPRI beads Beckman Cat# B23317 NEBNext FFPE DNA Repair Mix NEB Cat# E7360 Ultra II End-prep enzyme mix NEB Cat# E7546 NEB Blunt/TA Ligase Master Mix NEB Cat# M0367 Native Barcoding Kit 24 V14 ONT Cat# SQK-NBD114.24 Flow Cell Wash Kit ONT Cat# EXP-WSH004 Deposited data Raw nanopore sequencing data for eccDNA profiling of Li et al.1 This paper PRJCA052047 Raw nanopore sequencing data for eccDNA profiling of four Huh7 cell samples and one pooled human plasma sample This paper PRJCA069021 Experimental models: Cell lines Human: HepG2 Wuhan Procell Biotechnology Co., Ltd. Cat# CL-0103 Human: Huh7 Shanghai Xunyi Biotechnology Co., Ltd. Cat# MXC58 Oligonucleotides Exo-random primer (500 μM) Thermo Cat# SO181 Primer ND1 Forward: CCCTAAAACCCGCCACATCT Reverse: GAGCGATGGTGAGAGCTAAGGT This paper N/A Primer H-GAPDH Forward: CTGGGCTACACTGAGCACC Reverse: AAGTGGTCGTTGAGGGCAATG This paper N/A Primer MIR621-A Forward: GGATCATATTCCACGCTGACTAT Reverse: AGTCCCATTTCTATTTTACTTCG This paper N/A Primer MIR621-B Forward: AATTCACTGACCAACCAACCAA Reverse: TTTGGTCAGTGAATACATACATATGGC This paper N/A (Continued on next page) STAR Protocols 7, 104865, December 18, 2026 3 STEP-BY-STEP METHOD DETAILS Isolate crude circular DNA Timing: 3 h In this step, we describe the crude extraction of circular DNA from tumor cell lines and circular cfDNA from plasma samples. ..
Nanopore Sequencing:Article Title: Protocol for rolling circle amplification-based nanopore sequencing of eccDNA from cell and plasma samples.
Article Snippet: .. Biological samples Pooled human plasma sample used for cfDNA extraction This paper N/A Chemicals, peptides, and recombinant proteins FastDigest MssI enzyme Thermo Cat# FD1344 Exonuclease V NEB Cat# M0345 Adenosine 5′-Triphosphate (ATP) (10 mM) NEB Cat# P0756 Nuclease-free water (NFW) Solarbio Cat# R1600 DNA extraction solution (phenol-chloroformisoamyl alcohol, 25:24:1) Solabio Cat# P1012 Glycogen Roche Cat# 10901393001 3 M sodium acetate Solabio Cat# A1070 TE Buffer Solarbio Cat# T1120 Phi29 MAX DNA Polymerase Vazyme Cat# EP0091 dNTPs (10 mM) NEB Cat# N0447 Recombinant Albumin (20mg/mL) NEB Cat# B9200 Pyrophosphatase, Inorganic Thermo Cat# EF0221 T7 Endonuclease I NEB Cat# M0302 T4 Ligase NEB Cat# E6056 Critical commercial assays 23 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711 E.Z.N.A. Plasmid DNA Mini Kit I Omega Cat# D6943 Plasma Cell-Free DNA Extraction Kit APOSTLE Cat# A17622CN Qubit 13 dsDNA HS Assay Kits Thermo Fisher Scientific Cat# Q33231 SPRI beads Beckman Cat# B23317 NEBNext FFPE DNA Repair Mix NEB Cat# E7360 Ultra II End-prep enzyme mix NEB Cat# E7546 NEB Blunt/TA Ligase Master Mix NEB Cat# M0367 Native Barcoding Kit 24 V14 ONT Cat# SQK-NBD114.24 Flow Cell Wash Kit ONT Cat# EXP-WSH004 Deposited data Raw nanopore sequencing data for eccDNA profiling of Li et al.1 This paper PRJCA052047 Raw nanopore sequencing data for eccDNA profiling of four Huh7 cell samples and one pooled human plasma sample This paper PRJCA069021 Experimental models: Cell lines Human: HepG2 Wuhan Procell Biotechnology Co., Ltd. Cat# CL-0103 Human: Huh7 Shanghai Xunyi Biotechnology Co., Ltd. Cat# MXC58 Oligonucleotides Exo-random primer (500 μM) Thermo Cat# SO181 Primer ND1 Forward: CCCTAAAACCCGCCACATCT Reverse: GAGCGATGGTGAGAGCTAAGGT This paper N/A Primer H-GAPDH Forward: CTGGGCTACACTGAGCACC Reverse: AAGTGGTCGTTGAGGGCAATG This paper N/A Primer MIR621-A Forward: GGATCATATTCCACGCTGACTAT Reverse: AGTCCCATTTCTATTTTACTTCG This paper N/A Primer MIR621-B Forward: AATTCACTGACCAACCAACCAA Reverse: TTTGGTCAGTGAATACATACATATGGC This paper N/A (Continued on next page) STAR Protocols 7, 104865, December 18, 2026 3 STEP-BY-STEP METHOD DETAILS Isolate crude circular DNA Timing: 3 h In this step, we describe the crude extraction of circular DNA from tumor cell lines and circular cfDNA from plasma samples. ..
Profiling:Article Title: Protocol for rolling circle amplification-based nanopore sequencing of eccDNA from cell and plasma samples.
Article Snippet: .. Biological samples Pooled human plasma sample used for cfDNA extraction This paper N/A Chemicals, peptides, and recombinant proteins FastDigest MssI enzyme Thermo Cat# FD1344 Exonuclease V NEB Cat# M0345 Adenosine 5′-Triphosphate (ATP) (10 mM) NEB Cat# P0756 Nuclease-free water (NFW) Solarbio Cat# R1600 DNA extraction solution (phenol-chloroformisoamyl alcohol, 25:24:1) Solabio Cat# P1012 Glycogen Roche Cat# 10901393001 3 M sodium acetate Solabio Cat# A1070 TE Buffer Solarbio Cat# T1120 Phi29 MAX DNA Polymerase Vazyme Cat# EP0091 dNTPs (10 mM) NEB Cat# N0447 Recombinant Albumin (20mg/mL) NEB Cat# B9200 Pyrophosphatase, Inorganic Thermo Cat# EF0221 T7 Endonuclease I NEB Cat# M0302 T4 Ligase NEB Cat# E6056 Critical commercial assays 23 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711 E.Z.N.A. Plasmid DNA Mini Kit I Omega Cat# D6943 Plasma Cell-Free DNA Extraction Kit APOSTLE Cat# A17622CN Qubit 13 dsDNA HS Assay Kits Thermo Fisher Scientific Cat# Q33231 SPRI beads Beckman Cat# B23317 NEBNext FFPE DNA Repair Mix NEB Cat# E7360 Ultra II End-prep enzyme mix NEB Cat# E7546 NEB Blunt/TA Ligase Master Mix NEB Cat# M0367 Native Barcoding Kit 24 V14 ONT Cat# SQK-NBD114.24 Flow Cell Wash Kit ONT Cat# EXP-WSH004 Deposited data Raw nanopore sequencing data for eccDNA profiling of Li et al.1 This paper PRJCA052047 Raw nanopore sequencing data for eccDNA profiling of four Huh7 cell samples and one pooled human plasma sample This paper PRJCA069021 Experimental models: Cell lines Human: HepG2 Wuhan Procell Biotechnology Co., Ltd. Cat# CL-0103 Human: Huh7 Shanghai Xunyi Biotechnology Co., Ltd. Cat# MXC58 Oligonucleotides Exo-random primer (500 μM) Thermo Cat# SO181 Primer ND1 Forward: CCCTAAAACCCGCCACATCT Reverse: GAGCGATGGTGAGAGCTAAGGT This paper N/A Primer H-GAPDH Forward: CTGGGCTACACTGAGCACC Reverse: AAGTGGTCGTTGAGGGCAATG This paper N/A Primer MIR621-A Forward: GGATCATATTCCACGCTGACTAT Reverse: AGTCCCATTTCTATTTTACTTCG This paper N/A Primer MIR621-B Forward: AATTCACTGACCAACCAACCAA Reverse: TTTGGTCAGTGAATACATACATATGGC This paper N/A (Continued on next page) STAR Protocols 7, 104865, December 18, 2026 3 STEP-BY-STEP METHOD DETAILS Isolate crude circular DNA Timing: 3 h In this step, we describe the crude extraction of circular DNA from tumor cell lines and circular cfDNA from plasma samples. ..
|
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 