dia data processing (Biognosys)
86
Structured Review
Biognosys
dia data processing
Dia Data Processing, supplied by Biognosys, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dia+data+processing/analysis+data+dia/pm42134552-125-0-14
Average 86 stars, based on 1 article reviews
Dia Data Processing, supplied by Biognosys, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dia+data+processing/analysis+data+dia/pm42134552-125-0-14
Average 86 stars, based on 1 article reviews
dia data processing - by Bioz Stars,
2026-09
86/100 stars
Images
Related Articles
Generated:Article Title: Genome-wide reconstruction of the intrinsic apoptosis pathway in Haemonchus contortus. Article Snippet: .. Proteomes were generated by Data-independent acquisition:Article Title: Genome-wide reconstruction of the intrinsic apoptosis pathway in Haemonchus contortus. Article Snippet: .. Proteomes were generated by Article Title: Dual EZH1/2 inhibition enhances DNMT inhibitor efficacy in colon cancer through targeting H3K27me1 Article Snippet: .. Article Title: In situ proximity labeling reveals the proteome and signaling landscape of presynaptic boutons. Article Snippet: .. Article Title: Deciphering O‑GlcNAc-Dependent Signaling Via Integrated Proteomics and Phosphoproteomics Article Snippet: .. Article Title: 2'-O-Methylation maintains ribosome structural and translation integrity. Article Snippet: .. Article Title: Fetal-like reversion in the regenerating intestine is regulated by mesenchymal asporin. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Clusterin (R) GGCTTCCTCTAAACTGTTGAGC N/A For other qPCR primers, see the Method section and for genotyping primers, see Table S2 N/A Software and algorithms FastQC (0.11.8), Quality control for sequencing reads https://www.bioinformatics.babraham. ac.uk/projects/fastqc/; RRID:SCR_014583 STAR (2.5.3a), Alignment of RNA-seq reads Dobin et al.53 https://github.com/alexdobin/STAR QoRTs (1.3.0), Post-mapping QC and gene quantification Hartley and Mullikin54 https://github.com/hartleys/QoRTs/releases R (3.6.2), Statistical computing R-Project https://www.r-project.org/ DESeq2 (1.24.0), Differential expression analysis Love et al.55 Bioconductor limma (3.40.2) camera, Gene set enrichment (rank-based test) Ritchie et al.56 Bioconductor msigdbr (7.0.1), MSigDB gene set annotations Liberzon et al.57 https://cran.r-project.org/web/ packages/msigdbr/index.html Seurat (V4), Single-cell RNA-seq analysis Hao et al.58 https://satijalab.org/seurat/ GraphPad Prism Graphpad https://www.graphpad.com/ CaseViewer 3DHISTECH https://www.3dhistech.com/ MaxQuant (1.6.10.43), Peptide and protein identification MaxQuant https://www.maxquant.org/ Spectronaut (v10), Mass Spectrometry:Article Title: Genome-wide reconstruction of the intrinsic apoptosis pathway in Haemonchus contortus. Article Snippet: .. Proteomes were generated by Phospho-proteomics:Article Title: Deciphering O‑GlcNAc-Dependent Signaling Via Integrated Proteomics and Phosphoproteomics Article Snippet: .. Data-dependent acquisition:Article Title: Comparative Proteomics Of Hepatocytes And Hepatic Cell Lines Using Swath-MS Reveals Significant Variations In Proteins Involved In Energy, Lipid, And Xenobiotic Metabolism. Article Snippet: Introduction: Human hepatic carcinoma cell lines are widely used in vitro to study lipid and xenobiotic metabolism, as well as glucose regulation in both normal and diseased states.. However, their validity is often questioned due to variability in protein expression compared to primary human hepatocytes (cHH).. This study aimed to quantify protein abundance in various hepatic cell lines versus cHH and human liver tissue homogenate (HLT) using a data-independent acquisition-based total protein approach (DIA-TPA). other:Article Title: Polyamines sustain epithelial regeneration in aged intestines by modulating protein homeostasis Article Snippet: For the library creation, the DDA and DIA raw files were searched with Real-time Polymerase Chain Reaction:Article Title: Fetal-like reversion in the regenerating intestine is regulated by mesenchymal asporin. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Clusterin (R) GGCTTCCTCTAAACTGTTGAGC N/A For other qPCR primers, see the Method section and for genotyping primers, see Table S2 N/A Software and algorithms FastQC (0.11.8), Quality control for sequencing reads https://www.bioinformatics.babraham. ac.uk/projects/fastqc/; RRID:SCR_014583 STAR (2.5.3a), Alignment of RNA-seq reads Dobin et al.53 https://github.com/alexdobin/STAR QoRTs (1.3.0), Post-mapping QC and gene quantification Hartley and Mullikin54 https://github.com/hartleys/QoRTs/releases R (3.6.2), Statistical computing R-Project https://www.r-project.org/ DESeq2 (1.24.0), Differential expression analysis Love et al.55 Bioconductor limma (3.40.2) camera, Gene set enrichment (rank-based test) Ritchie et al.56 Bioconductor msigdbr (7.0.1), MSigDB gene set annotations Liberzon et al.57 https://cran.r-project.org/web/ packages/msigdbr/index.html Seurat (V4), Single-cell RNA-seq analysis Hao et al.58 https://satijalab.org/seurat/ GraphPad Prism Graphpad https://www.graphpad.com/ CaseViewer 3DHISTECH https://www.3dhistech.com/ MaxQuant (1.6.10.43), Peptide and protein identification MaxQuant https://www.maxquant.org/ Spectronaut (v10), Software:Article Title: Fetal-like reversion in the regenerating intestine is regulated by mesenchymal asporin. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Clusterin (R) GGCTTCCTCTAAACTGTTGAGC N/A For other qPCR primers, see the Method section and for genotyping primers, see Table S2 N/A Software and algorithms FastQC (0.11.8), Quality control for sequencing reads https://www.bioinformatics.babraham. ac.uk/projects/fastqc/; RRID:SCR_014583 STAR (2.5.3a), Alignment of RNA-seq reads Dobin et al.53 https://github.com/alexdobin/STAR QoRTs (1.3.0), Post-mapping QC and gene quantification Hartley and Mullikin54 https://github.com/hartleys/QoRTs/releases R (3.6.2), Statistical computing R-Project https://www.r-project.org/ DESeq2 (1.24.0), Differential expression analysis Love et al.55 Bioconductor limma (3.40.2) camera, Gene set enrichment (rank-based test) Ritchie et al.56 Bioconductor msigdbr (7.0.1), MSigDB gene set annotations Liberzon et al.57 https://cran.r-project.org/web/ packages/msigdbr/index.html Seurat (V4), Single-cell RNA-seq analysis Hao et al.58 https://satijalab.org/seurat/ GraphPad Prism Graphpad https://www.graphpad.com/ CaseViewer 3DHISTECH https://www.3dhistech.com/ MaxQuant (1.6.10.43), Peptide and protein identification MaxQuant https://www.maxquant.org/ Spectronaut (v10), Control:Article Title: Fetal-like reversion in the regenerating intestine is regulated by mesenchymal asporin. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Clusterin (R) GGCTTCCTCTAAACTGTTGAGC N/A For other qPCR primers, see the Method section and for genotyping primers, see Table S2 N/A Software and algorithms FastQC (0.11.8), Quality control for sequencing reads https://www.bioinformatics.babraham. ac.uk/projects/fastqc/; RRID:SCR_014583 STAR (2.5.3a), Alignment of RNA-seq reads Dobin et al.53 https://github.com/alexdobin/STAR QoRTs (1.3.0), Post-mapping QC and gene quantification Hartley and Mullikin54 https://github.com/hartleys/QoRTs/releases R (3.6.2), Statistical computing R-Project https://www.r-project.org/ DESeq2 (1.24.0), Differential expression analysis Love et al.55 Bioconductor limma (3.40.2) camera, Gene set enrichment (rank-based test) Ritchie et al.56 Bioconductor msigdbr (7.0.1), MSigDB gene set annotations Liberzon et al.57 https://cran.r-project.org/web/ packages/msigdbr/index.html Seurat (V4), Single-cell RNA-seq analysis Hao et al.58 https://satijalab.org/seurat/ GraphPad Prism Graphpad https://www.graphpad.com/ CaseViewer 3DHISTECH https://www.3dhistech.com/ MaxQuant (1.6.10.43), Peptide and protein identification MaxQuant https://www.maxquant.org/ Spectronaut (v10), Sequencing:Article Title: Fetal-like reversion in the regenerating intestine is regulated by mesenchymal asporin. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Clusterin (R) GGCTTCCTCTAAACTGTTGAGC N/A For other qPCR primers, see the Method section and for genotyping primers, see Table S2 N/A Software and algorithms FastQC (0.11.8), Quality control for sequencing reads https://www.bioinformatics.babraham. ac.uk/projects/fastqc/; RRID:SCR_014583 STAR (2.5.3a), Alignment of RNA-seq reads Dobin et al.53 https://github.com/alexdobin/STAR QoRTs (1.3.0), Post-mapping QC and gene quantification Hartley and Mullikin54 https://github.com/hartleys/QoRTs/releases R (3.6.2), Statistical computing R-Project https://www.r-project.org/ DESeq2 (1.24.0), Differential expression analysis Love et al.55 Bioconductor limma (3.40.2) camera, Gene set enrichment (rank-based test) Ritchie et al.56 Bioconductor msigdbr (7.0.1), MSigDB gene set annotations Liberzon et al.57 https://cran.r-project.org/web/ packages/msigdbr/index.html Seurat (V4), Single-cell RNA-seq analysis Hao et al.58 https://satijalab.org/seurat/ GraphPad Prism Graphpad https://www.graphpad.com/ CaseViewer 3DHISTECH https://www.3dhistech.com/ MaxQuant (1.6.10.43), Peptide and protein identification MaxQuant https://www.maxquant.org/ Spectronaut (v10), RNA Sequencing:Article Title: Fetal-like reversion in the regenerating intestine is regulated by mesenchymal asporin. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Clusterin (R) GGCTTCCTCTAAACTGTTGAGC N/A For other qPCR primers, see the Method section and for genotyping primers, see Table S2 N/A Software and algorithms FastQC (0.11.8), Quality control for sequencing reads https://www.bioinformatics.babraham. ac.uk/projects/fastqc/; RRID:SCR_014583 STAR (2.5.3a), Alignment of RNA-seq reads Dobin et al.53 https://github.com/alexdobin/STAR QoRTs (1.3.0), Post-mapping QC and gene quantification Hartley and Mullikin54 https://github.com/hartleys/QoRTs/releases R (3.6.2), Statistical computing R-Project https://www.r-project.org/ DESeq2 (1.24.0), Differential expression analysis Love et al.55 Bioconductor limma (3.40.2) camera, Gene set enrichment (rank-based test) Ritchie et al.56 Bioconductor msigdbr (7.0.1), MSigDB gene set annotations Liberzon et al.57 https://cran.r-project.org/web/ packages/msigdbr/index.html Seurat (V4), Single-cell RNA-seq analysis Hao et al.58 https://satijalab.org/seurat/ GraphPad Prism Graphpad https://www.graphpad.com/ CaseViewer 3DHISTECH https://www.3dhistech.com/ MaxQuant (1.6.10.43), Peptide and protein identification MaxQuant https://www.maxquant.org/ Spectronaut (v10), Quantitative Proteomics:Article Title: Fetal-like reversion in the regenerating intestine is regulated by mesenchymal asporin. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Clusterin (R) GGCTTCCTCTAAACTGTTGAGC N/A For other qPCR primers, see the Method section and for genotyping primers, see Table S2 N/A Software and algorithms FastQC (0.11.8), Quality control for sequencing reads https://www.bioinformatics.babraham. ac.uk/projects/fastqc/; RRID:SCR_014583 STAR (2.5.3a), Alignment of RNA-seq reads Dobin et al.53 https://github.com/alexdobin/STAR QoRTs (1.3.0), Post-mapping QC and gene quantification Hartley and Mullikin54 https://github.com/hartleys/QoRTs/releases R (3.6.2), Statistical computing R-Project https://www.r-project.org/ DESeq2 (1.24.0), Differential expression analysis Love et al.55 Bioconductor limma (3.40.2) camera, Gene set enrichment (rank-based test) Ritchie et al.56 Bioconductor msigdbr (7.0.1), MSigDB gene set annotations Liberzon et al.57 https://cran.r-project.org/web/ packages/msigdbr/index.html Seurat (V4), Single-cell RNA-seq analysis Hao et al.58 https://satijalab.org/seurat/ GraphPad Prism Graphpad https://www.graphpad.com/ CaseViewer 3DHISTECH https://www.3dhistech.com/ MaxQuant (1.6.10.43), Peptide and protein identification MaxQuant https://www.maxquant.org/ Spectronaut (v10), Single Cell:Article Title: Fetal-like reversion in the regenerating intestine is regulated by mesenchymal asporin. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Clusterin (R) GGCTTCCTCTAAACTGTTGAGC N/A For other qPCR primers, see the Method section and for genotyping primers, see Table S2 N/A Software and algorithms FastQC (0.11.8), Quality control for sequencing reads https://www.bioinformatics.babraham. ac.uk/projects/fastqc/; RRID:SCR_014583 STAR (2.5.3a), Alignment of RNA-seq reads Dobin et al.53 https://github.com/alexdobin/STAR QoRTs (1.3.0), Post-mapping QC and gene quantification Hartley and Mullikin54 https://github.com/hartleys/QoRTs/releases R (3.6.2), Statistical computing R-Project https://www.r-project.org/ DESeq2 (1.24.0), Differential expression analysis Love et al.55 Bioconductor limma (3.40.2) camera, Gene set enrichment (rank-based test) Ritchie et al.56 Bioconductor msigdbr (7.0.1), MSigDB gene set annotations Liberzon et al.57 https://cran.r-project.org/web/ packages/msigdbr/index.html Seurat (V4), Single-cell RNA-seq analysis Hao et al.58 https://satijalab.org/seurat/ GraphPad Prism Graphpad https://www.graphpad.com/ CaseViewer 3DHISTECH https://www.3dhistech.com/ MaxQuant (1.6.10.43), Peptide and protein identification MaxQuant https://www.maxquant.org/ Spectronaut (v10), |