cuvette (Nepa Gene Co Ltd)
Nepa Gene Co Ltd is a verified supplier 
Nepa Gene Co Ltd manufactures this product 
99
Structured Review
Nepa Gene Co Ltd
cuvette
Cuvette, supplied by Nepa Gene Co Ltd, used in various techniques. Bioz Stars score: 99/100, based on 2302 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cuvette/NEPA21/pm42847431-58-7-9
Average 99 stars, based on 2302 article reviews
Cuvette, supplied by Nepa Gene Co Ltd, used in various techniques. Bioz Stars score: 99/100, based on 2302 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cuvette/NEPA21/pm42847431-58-7-9
Average 99 stars, based on 2302 article reviews
cuvette - by Bioz Stars,
2026-10
99/100 stars
Images
Related Articles
Electroporation:Article Title: Chlamydomonas γ-tubulin mutations reveal a critical role for γ-TuRC in maintaining the stability of centriolar microtubules. Article Snippet: .. These plasmids were introduced into the wild-type, Article Title: Patient-derived teratomas as a humanized platform for dystrophin restoration by ex vivo cell therapy and in vivo base editing. Article Snippet: Y27632 (10 μM; PeproTech #1293823) was used for 1 day after the attachment if needed. .. According to the standardized protocol for electroporation of human pluripotent stem cells28, gene delivery with the Article Title: Discovery of Avian TCRVβ2 + T Cells Recognizing the Endogenous Ganglioside via a chCD1.1‐Dependent Pathway Article Snippet: .. shRNAs targeting selected genes were designed using siRNA Wizard software, cloned into psiRNA‐EGFP‐Zeo vectors (InvivoGen), and transfected into splenocytes 24 h before CpG‐ODN stimulation by electroporation using a Article Title: A PATHOGENIC NFKB2 VARIANT CAUSES COMBINED IMMUNODEFICIENCY WITH THYMIC AND PERIPHERAL LYMPHOID DEFECTS IN RATS Article Snippet: .. Electroporation was performed using the Platinum:Article Title: Phosphorylation-dependent control of transcription factor activity regulates temporal patterning of cortical cell fate specification. Article Snippet: .. The plasmids were electroporated into the dorsal ventricular zone with six pulses of 30V, 50ms each at 1 s interval delivered through platinum electrodes using round electrodes CUY650P5 and Incubation:Article Title: DND1–NANOS3 shapes the PGC transcriptome via a heptanucleotide sequence in mRNA 3′-UTRs Article Snippet: A single-strand oligonucleotide donor was purchased from IDT (CTGTCATCTGGACTTTTCTTAATTTCCTACGTATAACTTAATTAACATGTAAATATTATTCCAT GCC A C T C TAAATATAATTCTGTATATGTGCAGATGTCACTGTGGTGGCTGTTAATTACTATAACACAAGTG; the five underlined nucleotides in bold are mutated). .. The sgRNA was first incubated with Cas9 protein (IDT) to form Cas9-sgRNA RNP complex, which was then co-electroporated with the oligo template into zygotes collected from C57BL/6 mice using a Software:Article Title: Discovery of Avian TCRVβ2 + T Cells Recognizing the Endogenous Ganglioside via a chCD1.1‐Dependent Pathway Article Snippet: .. shRNAs targeting selected genes were designed using siRNA Wizard software, cloned into psiRNA‐EGFP‐Zeo vectors (InvivoGen), and transfected into splenocytes 24 h before CpG‐ODN stimulation by electroporation using a Clone Assay:Article Title: Discovery of Avian TCRVβ2 + T Cells Recognizing the Endogenous Ganglioside via a chCD1.1‐Dependent Pathway Article Snippet: .. shRNAs targeting selected genes were designed using siRNA Wizard software, cloned into psiRNA‐EGFP‐Zeo vectors (InvivoGen), and transfected into splenocytes 24 h before CpG‐ODN stimulation by electroporation using a Transfection:Article Title: Discovery of Avian TCRVβ2 + T Cells Recognizing the Endogenous Ganglioside via a chCD1.1‐Dependent Pathway Article Snippet: .. shRNAs targeting selected genes were designed using siRNA Wizard software, cloned into psiRNA‐EGFP‐Zeo vectors (InvivoGen), and transfected into splenocytes 24 h before CpG‐ODN stimulation by electroporation using a |