control plasmid encoding renilla luciferase (phrl-tk-luc (Promega)
90
Structured Review
Promega
control plasmid encoding renilla luciferase (phrl-tk-luc
Control Plasmid Encoding Renilla Luciferase (Phrl Tk Luc, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+plasmid+phrl-tk/pgl3+basic/pmc08683079-240-34-37
Average 90 stars, based on 1 article reviews
Control Plasmid Encoding Renilla Luciferase (Phrl Tk Luc, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+plasmid+phrl-tk/pgl3+basic/pmc08683079-240-34-37
Average 90 stars, based on 1 article reviews
control plasmid encoding renilla luciferase (phrl-tk-luc - by Bioz Stars,
2026-11
90/100 stars
Images
1) Product Images from "S-acylation by ZDHHC20 targets ORAI1 channels to lipid rafts for efficient Ca 2+ signaling by Jurkat T cell receptors at the immune synapse"
Article Title: S-acylation by ZDHHC20 targets ORAI1 channels to lipid rafts for efficient Ca 2+ signaling by Jurkat T cell receptors at the immune synapse
Journal: eLife
doi: 10.7554/eLife.72051
Figure Legend Snippet: ( A ) Averaged fura-2 responses, their peak amplitude (middle graph bar) and slope (right graph bar) evoked by Ca 2+ re-addition in Tg treated (1 µM, 8 min) Jurkat cells lines generated by CRISPR with control or ORAI1-targeted guiding sequences and stably re-expressing either WT or C143A ORAI1-YFP. Data are mean ± SEM of 210 (Control), 242 (KO), 189 (WT), and 203 (C143A) cells from three independent experiments ( B ) Western blot showing the amount of biotinylated GFP immunoreactivity in the PM in Jurkat CRISPR ORAI1 cells reconstituted with WT or C143A ORAI1-YFP. Representative of 2 independent experiments. ( C ) Individual (thin lines) and averaged (thick line) fura-2 recordings of Jurkat CRISPR ORAI1 cells reconstituted with WT or C143A ORAI1-YFP, exposed to CD3/CD28-coated beads in Ca 2+ containing solution (left). Averaged peak and integrated responses evoked by CD3/CD28 beads in individual cells during the recording period (right). Data are from 52 cells (WT) and 72 cells (C143A) from three independent experiments. ( D ) Relative changes in NFATC-Luciferase vs. housekeeping- Renilla luminescence evoked in 4 h by Tg (1 µM) and PMA (100 nM) in the indicated cell lines. Data are mean ± SEM of 8–12 biological replicates from three independent experiments. ( E ) Endogenous NFATC1 translocation evoked in 4 hr by Tg (1 µM) in the indicated cell lines, measured by immunofluorescence. Data are mean ± SEM of the nuclear to cytosol NFATC1 intensity ratio of 58–161 cells from four independent experiments. ( F ) Time-course of NFATC1 translocation evoked by plates coated with CD3 (OKT3 1 µg/ml). Data are mean ± SEM of 86–161 cells from five independent experiments. ( G ) IL-2 production evoked by untreated (NT) or surface coated CD3 (OKT3 1 µg/ml). Left, Representative density dot plots of Jurkat cells stained for IL-2. Graph bars represent the mean ± SEM of three independent experiments. One-way ANOVA Dunnett’s multiple comparisons test ( A ), Sidak multiple comparisons test ( D and E ), two-tailed unpaired Student’s t -test (C and G).
Techniques Used: Generated, CRISPR, Stable Transfection, Expressing, Western Blot, Luciferase, Translocation Assay, Immunofluorescence, Staining, Two Tailed Test
Figure Legend Snippet: ( A ) Conditions used to study synapse formation between Raji and Jurkat T cells. Raji are pulsed with SEE prior to co-culture with Jurkat cells, IS formation evaluated in living (25 min) and fixed cells (1 H) and Jurkat activation at 24 hr. ( B ) Relative changes in NFAT-Luciferase vs. housekeeping- Renilla luminescence evoked by coculture of the indicated cell lines for 24 hr with naïve or SEE (1 µg/ml) pulsed Raji. Data are mean ± SEM of 15–20 biological replicates in cells from four independent experiments. ( C ) Representative images of ORAI1-deficient Jurkat T cells reconstituted with WT or mutant ORAI1-YFP co-cultured with pulsed RAJI cells stained with CellMask deep red. (Scale bar = 10 µm). ( D ) ORAI distribution in IS vs. opposite pole in IS forming between SEE-pulsed Raji and ORAI1-deficient Jurkat T cells reconstituted with WT (29 IS) or mutant (26 IS) ORAI1. Chi-square p value: 0.0014, two-sided Fisher’s exact test. ( E ) Quantification of ORAI1 enrichment in time-lapse images from C. IS accumulation was measured using kymographs of 20 pixels wide lines spanning the IS-distal cap axis, drawn on stable (not moving) IS forming in WT (12) and C143A (8) cells from three independent experiments. Graph bar shows mean ± SEM area under the curve of the kinetic enrichment graphs. ( F ) Representative confocal images of IS forming between SEE-pulsed Raji labeled with CellMask (Magenta, APC white labelling) and ORAI1-deficient Jurkat T cells reconstituted with WT or mutant ORAI1-YFP (Green), labelled with Phalloidin (Blue) and anti-TCR-PE (Red). Scale bar = 10 µm. Arrows indicate IS formation and asterisks accumulation of ORAI1 in the opposite pole. ( G ) IS enrichment for ORAI1-YFP, Phalloidin and TCR fluorescence in Jurkat T cells reconstituted with WT or C143A ORAI1-YFP. Fluorescence levels at the IS and opposite pole were extracted from 10 pixel wide line profiles. Graph bars shows mean ± SEM in WT (n = 25 IS) and C143A (n = 20 IS). Two-tailed unpaired Student’s t -test ( B, E and G ); Chi square ( D ). ( H ) Proposed model: S-acylation by PAT20 targets ORAI1 to lipid rafts, enabling the coordinated recruitment of ORAI1 and TCR to the immune synapse for efficient signalling.
Techniques Used: Co-Culture Assay, Activation Assay, Luciferase, Mutagenesis, Cell Culture, Staining, Labeling, Fluorescence, Two Tailed Test
Related Articles
Luciferase:Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg Activity Assay:Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg Plasmid Preparation:Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg Control:Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg other:Article Title: Article Snippet: The plasmids for enhancer activity analysis were generated from Article Title: Egr-1 promotes the proliferation and migration of vascular smooth muscle cells by transcriptionally activating Egr-2 in arteriovenous fistulas Article Snippet: Rat EGR1 promoter (~1.3 Kb; PCR-amplified from rat VSMCs) cloned into Article Title: Folie 1 Article Snippet: Vendor Bulk anti-TGFB1,2,3 In Vivo 1D11.1 Human, Mouse, Bovine, Chicken Mouse IgG1 10μg/gBW AB_292143 6 Ichorbio Mouse IgG1 Isotype Control HKSP - Mouse IgG1 10μg/gBW AB_292138 2 Ichorbio Anti-mouse CD8 in vivo YTS169 Mouse Rat IgG2b 12,5μg/g BW AB_292144 5 Ichorbio Anti-mouse CD4 in vivo GK1.5 Mouse Rat IgG2b 12,5μg/g BW AB_292144 4 Ichorbio Rat IgG2b Isotype Control in vivo 1-2 - Rat IgG2b 12,5μg/g BW AB_292137 8 Ichorbio Supplementary Table S3: Primers used for RT-qPCR Target gene Direction Sequence (5’3’) GC [%] Length TM hu-TGF-β1 Fwd ATTCCTGGCGATACCTCAGC 55 20 59,4 hu-TGF-β1 Rev CGGTAGTGAACCCGTTGATG 55 20 59,4 hu-GAPDH Fwd GTCAGTGGTGGACCTGACCT 60 20 61,4 hu-GAPDH Rev TGAGCTTGACAAAGTGGTCG 50 20 57,3 Supplementary Table S4: Expression vectors Name Backbone Insert (cDNA) Selection marker RRID/parentage pMIG pMSCV empty IRES-GFP RRID:Addgene_ 9044 pMIG-CALRWT pMSCV Human CALRWT IRES-GFP Provided by Ann Mullally pMIG-CALRins5 pMSCV Human CALRins5 IRES-GFP Provided by Ann Mullally 9 pMIG-CALRdel52 pMSCV Human CALRdel52 IRES-GFP Provided by Ann Mullally pMSCV-MPL pMSCV Human MPL PKG- hygromycin resistance gene Provided by Ann Mullally pMIG-JAK2WT pMSCV Human JAK2WT IRES-GFP Provided by Justus Duyster pMIG-JAK2V617F pMSCV Human JAK2V617F IRES-GFP Provided by Justus Duyster pMSCV-EpoR pMSCV Human EPOR neomycin resistance gene In-house pMIG-STAT3WT pMX Human STAT3WT IRES-GFP In-house pMIGSTAT3V640F pMX Human STAT3V640F IRES-GFP In-house pGL4.73[ hRluc/SV40] pGL4 SV40 early enhancer, Article Title: Article Snippet: RIG-I ubiquitination assays Purification of GST-RIG-I 2CARD from mammalian cells was done as previously described (8, 11). pEBGRIG-I 2CARD (4 μg) and pcDNA4 carrying indicated gene or pCAGGS-NS1 (Influenza A virus, 10 μg) (7) and Article Title: Article Snippet: The constructed pGL3-ELO11 reporter plasmid was cotransfected 211 with the pac-dsxM or pac-dsxF expression plasmid by Article Title: Article Snippet: A total of 24 h after gene KD in 6-well culture plates, 2 μg TOPFlash and 0.5 μg pRL (Promega, E2261) plasmids were transfected into Article Title: Article Snippet: A total of 2 μg of DKK1 promoter and 0.5 μg of pRL (Promega, E2261) plasmids were transfected into |