5x annealing buffer (Synthego Inc)
86
Structured Review
Synthego Inc
5x annealing buffer
5x Annealing Buffer, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/annealing+buffer/buffer/pm41715271-95-0-3
Average 86 stars, based on 1 article reviews
5x Annealing Buffer, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/annealing+buffer/buffer/pm41715271-95-0-3
Average 86 stars, based on 1 article reviews
5x annealing buffer - by Bioz Stars,
2026-10
86/100 stars
Images
Related Articles
Incubation:Article Title: A Novel Dual-Guide CRISPR-Cas13 Strategy Improves Specificity for Single-Nucleotide Variant Detection Article Snippet: The detection mix (19 μL per well) was assembled in the following order: RNase-free water, HEPES buffer (pH 6.8, final concentration 20 mM; Sigma), guide RNA (45 nM; either a synthetic sgRNA from Integrated DNA Technologies, or a dual-guide complex). .. The dual-guide complex was previously formed by annealing 10 μL of dcrRNA (10 μM, IDT) with 10 μL of dtracrRNA (10 μM, IDT) in the presence of 5 μL of annealing Article Title: Mutations outside the MR1 antigen binding groove differentially inhibit presentation of exogenous antigens. Article Snippet: 6e5 cells were electroporated with ribonucleoprotein (RNP) complexes prepared from SpCas9 2NLS Nuclease and either non-targeting control scrambled sgRNA No 1) or three sgRNAs targeting B2M (all EditCo, formerly: Synthego, sequences: CGGAGCGAGAGAGCACAGCG, GGCCGAGAUGUCUCGCUCCG, ACUCACGCUGGAUAGCCUCC) using a Neon NxT Electroporation system (Invitrogen) according to the manufacturer’s instructions. .. In short, SpCas9 and sgRNA were mixed in Article Title: Mutations outside the MR1 antigen binding groove differentially inhibit presentation of exogenous antigens Article Snippet: 6e5 cells were electroporated with ribonucleoprotein complexes prepared from SpCas9 2NLS nuclease and either nontargeting control scrambled sgRNA No 1 or three sgRNAs targeting B2M (all EditCo, formerly : Synthego, sequences: CGGAGCGAGAGAGCACAGCG, GGCCGAGAUGUCUCGCUCCG, ACUCACGCUGGAUAGCCUCC) using a Neon N x T Electroporation system (Invitrogen) according to the manufacturer’s instructions. .. In short, SpCas9 and sgRNA were mixed in Polymerase Chain Reaction:Article Title: Mutations outside the MR1 antigen binding groove differentially inhibit presentation of exogenous antigens. Article Snippet: 6e5 cells were electroporated with ribonucleoprotein (RNP) complexes prepared from SpCas9 2NLS Nuclease and either non-targeting control scrambled sgRNA No 1) or three sgRNAs targeting B2M (all EditCo, formerly: Synthego, sequences: CGGAGCGAGAGAGCACAGCG, GGCCGAGAUGUCUCGCUCCG, ACUCACGCUGGAUAGCCUCC) using a Neon NxT Electroporation system (Invitrogen) according to the manufacturer’s instructions. .. In short, SpCas9 and sgRNA were mixed in Article Title: Mutations outside the MR1 antigen binding groove differentially inhibit presentation of exogenous antigens Article Snippet: 6e5 cells were electroporated with ribonucleoprotein complexes prepared from SpCas9 2NLS nuclease and either nontargeting control scrambled sgRNA No 1 or three sgRNAs targeting B2M (all EditCo, formerly : Synthego, sequences: CGGAGCGAGAGAGCACAGCG, GGCCGAGAUGUCUCGCUCCG, ACUCACGCUGGAUAGCCUCC) using a Neon N x T Electroporation system (Invitrogen) according to the manufacturer’s instructions. .. In short, SpCas9 and sgRNA were mixed in Amplification:Article Title: Mutations outside the MR1 antigen binding groove differentially inhibit presentation of exogenous antigens. Article Snippet: 6e5 cells were electroporated with ribonucleoprotein (RNP) complexes prepared from SpCas9 2NLS Nuclease and either non-targeting control scrambled sgRNA No 1) or three sgRNAs targeting B2M (all EditCo, formerly: Synthego, sequences: CGGAGCGAGAGAGCACAGCG, GGCCGAGAUGUCUCGCUCCG, ACUCACGCUGGAUAGCCUCC) using a Neon NxT Electroporation system (Invitrogen) according to the manufacturer’s instructions. .. In short, SpCas9 and sgRNA were mixed in Article Title: Mutations outside the MR1 antigen binding groove differentially inhibit presentation of exogenous antigens Article Snippet: 6e5 cells were electroporated with ribonucleoprotein complexes prepared from SpCas9 2NLS nuclease and either nontargeting control scrambled sgRNA No 1 or three sgRNAs targeting B2M (all EditCo, formerly : Synthego, sequences: CGGAGCGAGAGAGCACAGCG, GGCCGAGAUGUCUCGCUCCG, ACUCACGCUGGAUAGCCUCC) using a Neon N x T Electroporation system (Invitrogen) according to the manufacturer’s instructions. .. In short, SpCas9 and sgRNA were mixed in Microinjection:Article Title: Electroporation of sheep zygotes as an alternative to microinjection for the generation of CRISPR/Cas genome edited models. Article Snippet: Zygote microinjection is considered the most suitable technique to introduce CRISPR/Cas9 reagents for efficient genome editing in livestock.. In this study, zygote electroporation was evaluated as an alternative to microinjection for CRISPR/Cas9-mediated genome editing in sheep.. Four experiments were conducted on 3548 cumulusoocyte complexes. Concentration Assay:Article Title: Electroporation of sheep zygotes as an alternative to microinjection for the generation of CRISPR/Cas genome edited models. Article Snippet: Zygote microinjection is considered the most suitable technique to introduce CRISPR/Cas9 reagents for efficient genome editing in livestock.. In this study, zygote electroporation was evaluated as an alternative to microinjection for CRISPR/Cas9-mediated genome editing in sheep.. Four experiments were conducted on 3548 cumulusoocyte complexes. other:Article Title: Single-molecule DNA flow-stretch assays for high-throughput DNA-protein interaction studies. Article Snippet: Electroporation:Article Title: Electroporation of sheep zygotes as an alternative to microinjection for the generation of CRISPR/Cas genome edited models. Article Snippet: Zygote microinjection is considered the most suitable technique to introduce CRISPR/Cas9 reagents for efficient genome editing in livestock.. In this study, zygote electroporation was evaluated as an alternative to microinjection for CRISPR/Cas9-mediated genome editing in sheep.. Four experiments were conducted on 3548 cumulusoocyte complexes. |