paper n a pcmv6 ac rfp origene ps100034 software (OriGene)
OriGene is a verified supplier 
OriGene manufactures this product 
94
Structured Review
OriGene
paper n a pcmv6 ac rfp origene ps100034 software
Paper N A Pcmv6 Ac Rfp Origene Ps100034 Software, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Vector+Software/pCMV6-AC-RFP+Mammalian+Expression+Vector/pm42228570-355-74-77
Average 94 stars, based on 17 article reviews
Paper N A Pcmv6 Ac Rfp Origene Ps100034 Software, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Vector+Software/pCMV6-AC-RFP+Mammalian+Expression+Vector/pm42228570-355-74-77
Average 94 stars, based on 17 article reviews
paper n a pcmv6 ac rfp origene ps100034 software - by Bioz Stars,
2026-09
94/100 stars
Images
Related Articles
Expressing:Article Title: Annexin A7 mediates lysosome repair independently of ESCRT-III. Article Snippet: Next, membranes were incubated for 30 min with matching secondary HRP-conjugated antibodies (Supplementary Table S1) and the immunoreactivity was detected using a luminescent image reader (Fujifilm, LAS-4000) following incubation with ClarityTM Western enhanced chemiluminescent substrate (BioRad, 1705061). .. Expression plasmids with ANXA2 with a monomeric RFP C-terminal tag and ANXA5 with a turbo RFP C-terminal tag have been constructed by subcloning cDNA sequences of human ANXA2 (OriGene RG205081) or ANXA5 (OriGene RG205619) into the respective mammalian vectors, pCMV6-AC-mRFP (OriGene PS100041) or Article Title: Annexin A7 mediates lysosome repair independently of ESCRT-III Article Snippet: Next, membranes were incubated for 30 min with matching secondary HRP-conjugated antibodies ( ) and the immunoreactivity was detected using a luminescent image reader (Fujifilm, LAS-4000) following incubation with ClarityTM Western enhanced chemiluminescent substrate (BioRad, 1705061). .. Expression plasmids with ANXA2 with a monomeric RFP C-terminal tag and ANXA5 with a turbo RFP C-terminal tag have been constructed by subcloning cDNA sequences of human ANXA2 (OriGene RG205081) or ANXA5 (OriGene RG205619) into the respective mammalian vectors, pCMV6-AC-mRFP (OriGene PS100041) or Construct:Article Title: Annexin A7 mediates lysosome repair independently of ESCRT-III. Article Snippet: Next, membranes were incubated for 30 min with matching secondary HRP-conjugated antibodies (Supplementary Table S1) and the immunoreactivity was detected using a luminescent image reader (Fujifilm, LAS-4000) following incubation with ClarityTM Western enhanced chemiluminescent substrate (BioRad, 1705061). .. Expression plasmids with ANXA2 with a monomeric RFP C-terminal tag and ANXA5 with a turbo RFP C-terminal tag have been constructed by subcloning cDNA sequences of human ANXA2 (OriGene RG205081) or ANXA5 (OriGene RG205619) into the respective mammalian vectors, pCMV6-AC-mRFP (OriGene PS100041) or Article Title: Annexin A7 mediates lysosome repair independently of ESCRT-III Article Snippet: Next, membranes were incubated for 30 min with matching secondary HRP-conjugated antibodies ( ) and the immunoreactivity was detected using a luminescent image reader (Fujifilm, LAS-4000) following incubation with ClarityTM Western enhanced chemiluminescent substrate (BioRad, 1705061). .. Expression plasmids with ANXA2 with a monomeric RFP C-terminal tag and ANXA5 with a turbo RFP C-terminal tag have been constructed by subcloning cDNA sequences of human ANXA2 (OriGene RG205081) or ANXA5 (OriGene RG205619) into the respective mammalian vectors, pCMV6-AC-mRFP (OriGene PS100041) or Subcloning:Article Title: Annexin A7 mediates lysosome repair independently of ESCRT-III. Article Snippet: Next, membranes were incubated for 30 min with matching secondary HRP-conjugated antibodies (Supplementary Table S1) and the immunoreactivity was detected using a luminescent image reader (Fujifilm, LAS-4000) following incubation with ClarityTM Western enhanced chemiluminescent substrate (BioRad, 1705061). .. Expression plasmids with ANXA2 with a monomeric RFP C-terminal tag and ANXA5 with a turbo RFP C-terminal tag have been constructed by subcloning cDNA sequences of human ANXA2 (OriGene RG205081) or ANXA5 (OriGene RG205619) into the respective mammalian vectors, pCMV6-AC-mRFP (OriGene PS100041) or Article Title: Annexin A7 mediates lysosome repair independently of ESCRT-III Article Snippet: Next, membranes were incubated for 30 min with matching secondary HRP-conjugated antibodies ( ) and the immunoreactivity was detected using a luminescent image reader (Fujifilm, LAS-4000) following incubation with ClarityTM Western enhanced chemiluminescent substrate (BioRad, 1705061). .. Expression plasmids with ANXA2 with a monomeric RFP C-terminal tag and ANXA5 with a turbo RFP C-terminal tag have been constructed by subcloning cDNA sequences of human ANXA2 (OriGene RG205081) or ANXA5 (OriGene RG205619) into the respective mammalian vectors, pCMV6-AC-mRFP (OriGene PS100041) or Generated:Article Title: Restructuring of the plasma membrane upon damage by LC3-associated macropinocytosis Article Snippet: Membrane integrity was measured with PI (0.2 μg/ml) and Hoechst 33342 (Sigma Aldrich; 5.7 μg/ml) using a Celigo cytometer (Brooks Life Science Systems) according to the manual and analyzed for total and dead cells using Celigo software version 2.1. .. ANXA4-tRFP had been generated by cloning ANXA4 (Origene, #RG203229) into the Cloning:Article Title: Restructuring of the plasma membrane upon damage by LC3-associated macropinocytosis Article Snippet: Membrane integrity was measured with PI (0.2 μg/ml) and Hoechst 33342 (Sigma Aldrich; 5.7 μg/ml) using a Celigo cytometer (Brooks Life Science Systems) according to the manual and analyzed for total and dead cells using Celigo software version 2.1. .. ANXA4-tRFP had been generated by cloning ANXA4 (Origene, #RG203229) into the CRISPR:Article Title: Activity-regulated circSamm50 modulates mitochondrial dynamics and spine structural plasticity. Article Snippet: Four hours after plating, media was replaced with feeding media consisting of Neurobasal media supplemented with Glutamax, Penstrep, and 2% B27 (Invitrogen), and half of the media was replaced every 4 days until the time of experiments at 37◦C with 5% CO2. .. REAGENT or RESOURCE SOURCE IDENTIFIER Samm50 circ_F IDT TCATGAAGCCCGGGAAAAAC Samm50 circ_R IDT CAACTTCCACAAACTCGGCT Foxk2-1157_F IDT CTCCTCCTAACCCTGAACCACA Foxk2-1157_R IDT TCTCTCTTCTCGCTGGATAGGG Foxk2-1357_F IDT ATGTGGTACCCATGCCTACAG Foxk2-1357_R IDT TGCTTCTCTCTCTTCTCGCTG See Table S1-Primers for miRNA primers, CRISPR gRNA, linear RNA primers and insert sequences N/A Recombinant DNA pCMV6-AC-GFP Origene PS100010 pGL3 Basic Luciferase vector Promega E1751 pXR001-mCD4: EF1a-RfxCas13d-P2A-mCD4T2A-EGFP Addgene 228359 Samm50-WT-pGL3 This paper N/A Samm50-MUT-pGL3 This paper N/A circSamm50-WT- pGL3 This paper N/A circSamm50-MUT-pGL3 This paper N/A RCaMP1.07 This Recombinant:Article Title: Activity-regulated circSamm50 modulates mitochondrial dynamics and spine structural plasticity. Article Snippet: Four hours after plating, media was replaced with feeding media consisting of Neurobasal media supplemented with Glutamax, Penstrep, and 2% B27 (Invitrogen), and half of the media was replaced every 4 days until the time of experiments at 37◦C with 5% CO2. .. REAGENT or RESOURCE SOURCE IDENTIFIER Samm50 circ_F IDT TCATGAAGCCCGGGAAAAAC Samm50 circ_R IDT CAACTTCCACAAACTCGGCT Foxk2-1157_F IDT CTCCTCCTAACCCTGAACCACA Foxk2-1157_R IDT TCTCTCTTCTCGCTGGATAGGG Foxk2-1357_F IDT ATGTGGTACCCATGCCTACAG Foxk2-1357_R IDT TGCTTCTCTCTCTTCTCGCTG See Table S1-Primers for miRNA primers, CRISPR gRNA, linear RNA primers and insert sequences N/A Recombinant DNA pCMV6-AC-GFP Origene PS100010 pGL3 Basic Luciferase vector Promega E1751 pXR001-mCD4: EF1a-RfxCas13d-P2A-mCD4T2A-EGFP Addgene 228359 Samm50-WT-pGL3 This paper N/A Samm50-MUT-pGL3 This paper N/A circSamm50-WT- pGL3 This paper N/A circSamm50-MUT-pGL3 This paper N/A RCaMP1.07 This Luciferase:Article Title: Activity-regulated circSamm50 modulates mitochondrial dynamics and spine structural plasticity. Article Snippet: Four hours after plating, media was replaced with feeding media consisting of Neurobasal media supplemented with Glutamax, Penstrep, and 2% B27 (Invitrogen), and half of the media was replaced every 4 days until the time of experiments at 37◦C with 5% CO2. .. REAGENT or RESOURCE SOURCE IDENTIFIER Samm50 circ_F IDT TCATGAAGCCCGGGAAAAAC Samm50 circ_R IDT CAACTTCCACAAACTCGGCT Foxk2-1157_F IDT CTCCTCCTAACCCTGAACCACA Foxk2-1157_R IDT TCTCTCTTCTCGCTGGATAGGG Foxk2-1357_F IDT ATGTGGTACCCATGCCTACAG Foxk2-1357_R IDT TGCTTCTCTCTCTTCTCGCTG See Table S1-Primers for miRNA primers, CRISPR gRNA, linear RNA primers and insert sequences N/A Recombinant DNA pCMV6-AC-GFP Origene PS100010 pGL3 Basic Luciferase vector Promega E1751 pXR001-mCD4: EF1a-RfxCas13d-P2A-mCD4T2A-EGFP Addgene 228359 Samm50-WT-pGL3 This paper N/A Samm50-MUT-pGL3 This paper N/A circSamm50-WT- pGL3 This paper N/A circSamm50-MUT-pGL3 This paper N/A RCaMP1.07 This Plasmid Preparation:Article Title: Activity-regulated circSamm50 modulates mitochondrial dynamics and spine structural plasticity. Article Snippet: Four hours after plating, media was replaced with feeding media consisting of Neurobasal media supplemented with Glutamax, Penstrep, and 2% B27 (Invitrogen), and half of the media was replaced every 4 days until the time of experiments at 37◦C with 5% CO2. .. REAGENT or RESOURCE SOURCE IDENTIFIER Samm50 circ_F IDT TCATGAAGCCCGGGAAAAAC Samm50 circ_R IDT CAACTTCCACAAACTCGGCT Foxk2-1157_F IDT CTCCTCCTAACCCTGAACCACA Foxk2-1157_R IDT TCTCTCTTCTCGCTGGATAGGG Foxk2-1357_F IDT ATGTGGTACCCATGCCTACAG Foxk2-1357_R IDT TGCTTCTCTCTCTTCTCGCTG See Table S1-Primers for miRNA primers, CRISPR gRNA, linear RNA primers and insert sequences N/A Recombinant DNA pCMV6-AC-GFP Origene PS100010 pGL3 Basic Luciferase vector Promega E1751 pXR001-mCD4: EF1a-RfxCas13d-P2A-mCD4T2A-EGFP Addgene 228359 Samm50-WT-pGL3 This paper N/A Samm50-MUT-pGL3 This paper N/A circSamm50-WT- pGL3 This paper N/A circSamm50-MUT-pGL3 This paper N/A RCaMP1.07 This Software:Article Title: Activity-regulated circSamm50 modulates mitochondrial dynamics and spine structural plasticity. Article Snippet: Four hours after plating, media was replaced with feeding media consisting of Neurobasal media supplemented with Glutamax, Penstrep, and 2% B27 (Invitrogen), and half of the media was replaced every 4 days until the time of experiments at 37◦C with 5% CO2. .. REAGENT or RESOURCE SOURCE IDENTIFIER Samm50 circ_F IDT TCATGAAGCCCGGGAAAAAC Samm50 circ_R IDT CAACTTCCACAAACTCGGCT Foxk2-1157_F IDT CTCCTCCTAACCCTGAACCACA Foxk2-1157_R IDT TCTCTCTTCTCGCTGGATAGGG Foxk2-1357_F IDT ATGTGGTACCCATGCCTACAG Foxk2-1357_R IDT TGCTTCTCTCTCTTCTCGCTG See Table S1-Primers for miRNA primers, CRISPR gRNA, linear RNA primers and insert sequences N/A Recombinant DNA pCMV6-AC-GFP Origene PS100010 pGL3 Basic Luciferase vector Promega E1751 pXR001-mCD4: EF1a-RfxCas13d-P2A-mCD4T2A-EGFP Addgene 228359 Samm50-WT-pGL3 This paper N/A Samm50-MUT-pGL3 This paper N/A circSamm50-WT- pGL3 This paper N/A circSamm50-MUT-pGL3 This paper N/A RCaMP1.07 This Clone Assay:Article Title: eIF2B localisation and its regulation during the integrated stress response is cell type specific Article Snippet: pCMV6-AC-tGFP plasmid vector encoding EIF2B5 (#RG202322) and EIF2S1 (#RG200368) was purchased from OriGene (Rockville, Maryland, USA). .. The coding open reading frame of EIF2B5 from the pCMV6-AC-tGFP vector was cloned into an empty pCMV6-AC-mGFP (#PS100040, OriGene) and |