Review




Structured Review

Genotypic Technology Pvt Ltd microarray
Microarray, supplied by Genotypic Technology Pvt Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/microarray/pmc01924604-354-0-7
Average 90 stars, based on 1 article reviews
microarray - by Bioz Stars, 2026-09
90/100 stars

Images

Related Articles

other:

Article Title: Dopamine receptor D2 regulates genes involved in germ cell movement and sperm motility in rat testes†.
Article Snippet: The function of dopamine receptor D2 (D2R) is well associated with sperm motility; however, the physiological role of D2R present on testicular cells remains elusive.. The aim of the present study is to delineate the function of testicular D2R.. Serum dopamine levels were found to decrease with age, whereas testicular D2R expression increased.

Article Title: Free spermidine evokes superoxide radicals that manifest toxicity
Article Snippet: The microarray was done from Genotypic Technology, Bangalore.

Article Title: Mycobacterium tuberculosis PknK Substrate Profiling Reveals Essential Transcription Terminator Protein Rho and Two-Component Response Regulators PrrA and MtrA as Novel Targets for Phosphorylation
Article Snippet: Microarrays were performed by Genotypic Technology Pvt Ltd, (Bangalore, India).

Article Title: Hypoxic Preconditioning Induces Neuronal Differentiation of Infrapatellar Fat Pad Stem Cells through Epigenetic Alteration.
Article Snippet: Hypoxia is considered a key factor in cellular differentiation and proliferation, particularly during embryonic development; the process of early neurogenesis also occurs under hypoxic conditions.. Apart from these developmental processes, hypoxia preconditioning or mild hypoxic sensitization develops resistance against ischemic stroke in deteriorating tissues.. We therefore hypothesized that neurons resulting from hypoxiaregulated neuronal differentiation could be the best choice for treating brain ischemia, which contributes to neurodegeneration.

Article Title: Ifu5, a WW domain-containing protein interacts with Efg1 to achieve coordination of normoxic and hypoxic functions to influence pathogenicity traits in Candida albicans.
Article Snippet: Yeast Molecular Genetics Laboratory, School of Life Sciences, Jawaharlal Nehru University, New Delhi, India Medical Mycology Laboratory, Department of Biosciences, Jamia Millia Islamia University, New Delhi, India Department Biologie, Molekulare Mykologie, Heinrich‐Heine‐Universität, Düsseldorf, Germany The Aberdeen Fungal Group, MRC Centre for Medical Mycology, School of Medicine, Medical Sciences & Nutrition, Institute of Medical Sciences, University of Aberdeen, Aberdeen, UK Departamento de Microbiología y Parasitología‐IRYCIS, Facultad de Farmacia, Universidad Complutense de Madrid, Madrid, Spain

Microarray:

Article Title: The ubiquitin-like protein Hub1/UBL-5 functions in pre-mRNA splicing in Caenorhabditis elegans.
Article Snippet: Edited by Nicola K. Gray The ubiquitin-like protein Hub1/UBL-5 associates with proteins noncovalently.. Hub1 promotes alternative splicing and splicing of precursor mRNAs with weak introns in yeast and mammalian cells; however, its splicing function has remained elusive in multicellular organisms.. Here, we demonstrate the splicing function of Hub1/UBL-5 in the free-living nematode Caenorhabditis elegans.

Article Title: Assessing the Link between Diabetic Metabolic Dysregulation and Breast Cancer Progression.
Article Snippet: .. Acknowledgments: We acknowledge Genotypic Technology Private Limited Bangalore for the microarray processing and data analysis reported in this publication. ..

Article Title: Amyloid fibril-based thixotropic hydrogels for modeling of tumor spheroids in vitro.
Article Snippet: Biomaterials mimicking extracellular matrices (ECM) for three-dimensional (3D) cultures have gained immense interest in tumor modeling and in vitro organ development.. Here, we introduce a new class of amyloid fibrilbased peptide hydrogels as a versatile biomimetic ECM scaffold for 3D cell culture and homogenous tumor spheroid modeling.. We show that these amyloid fibril-based hydrogels are thixotropic and allow cancer cell adhesion, proliferation, and migration.



Similar Products

99
New England Biolabs nebnext ultra tm ii rna library prep kit genotypic technologies
Nebnext Ultra Tm Ii Rna Library Prep Kit Genotypic Technologies, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/NEBNext+Ultra+II+RNA+Library+Prep+Kit/bio_rxiv__64898__2026__04__06__709730-107-17-17
Average 99 stars, based on 1 article reviews
nebnext ultra tm ii rna library prep kit genotypic technologies - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

86
Sequenom massarray snp genotyping technology
Massarray Snp Genotyping Technology, supplied by Sequenom, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/massarray+platform/pmc12593843-228-2-1
Average 86 stars, based on 1 article reviews
massarray snp genotyping technology - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Amersham Life Sciences Inc technologies discovery genotyping
Technologies Discovery Genotyping, supplied by Amersham Life Sciences Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/discovery+genotyping+technologies/sec_filing____40545_slash_000119312503069884_slash_d425-1085-12-16
Average 86 stars, based on 1 article reviews
technologies discovery genotyping - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

96
Cell Signaling Technology Inc plant genotypes seed stocks authentication plants phospho eif4e rabbit cell signaling technology
Plant Genotypes Seed Stocks Authentication Plants Phospho Eif4e Rabbit Cell Signaling Technology, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/Phospho-eIF4E+(Ser209)+Antibody/pmc11914046__41467_2025_57615_MOESM2_ESM-52-1-9
Average 96 stars, based on 1 article reviews
plant genotypes seed stocks authentication plants phospho eif4e rabbit cell signaling technology - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

90
Thermo Fisher high-throughput snp genotyping with microarray technology
High Throughput Snp Genotyping With Microarray Technology, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/pmc11675768-136-6-0
Average 90 stars, based on 1 article reviews
high-throughput snp genotyping with microarray technology - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

99
Qiagen taqman snp genotyping assay life technologies n a rneasy kit qiagen
Taqman Snp Genotyping Assay Life Technologies N A Rneasy Kit Qiagen, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/RNeasy+Mini+Kit/pm39255062-728-170-179
Average 99 stars, based on 1 article reviews
taqman snp genotyping assay life technologies n a rneasy kit qiagen - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

86
Danaher Inc rhamp snp genotyping technology
Rhamp Snp Genotyping Technology, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/pm38332006-106-39-43
Average 86 stars, based on 1 article reviews
rhamp snp genotyping technology - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Danaher Inc genotyping primers adar reverse gccacttctccctgactcctg integrated dna technology
Genotyping Primers Adar Reverse Gccacttctccctgactcctg Integrated Dna Technology, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/pm38128529-262-33-38
Average 86 stars, based on 1 article reviews
genotyping primers adar reverse gccacttctccctgactcctg integrated dna technology - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

Image Search Results