Review




Structured Review

Sequenom massarray snp genotyping technology
Massarray Snp Genotyping Technology, supplied by Sequenom, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/massarray+platform/pmc12593843-228-2-1
Average 86 stars, based on 1 article reviews
massarray snp genotyping technology - by Bioz Stars, 2026-09
86/100 stars

Images

Related Articles

other:

Article Title: BR-FDP-SKIN: Brazilian forensic DNA Skin phenotyping based on machine learning models
Article Snippet: ction NA Phenotyping (FDP) enables the prediction of different Externally Visible Characteristics (EVCs), air, and eye color, directly from genetic material (1).. The inference of these traits using a limited set of tide Polymorphisms (SNPs) is extremely valuable in forensic investigations, aiding in the identification dividuals at crime scenes or among victims of mass disasters (2; 3; 4).. Multiple studies have mapped ted with hair, eye, and skin color (2; 5; 6; 7; 8; 9; 10; 11; 12; 13; 14; 15; 16).

Article Title: Identification of a Novel Genetic Variant responsible for Familial Atrial Fibrillation.
Article Snippet: This is a PDF of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability.. This version will undergo additional copyediting, typesetting and review before it is published in its final form.. As such, this version is no longer the Accepted Manuscript, but it is not yet the definitive Version of Record; we are providing this early version to give early visibility of the article.

Article Title: Analysis of MIR155HG gene polymorphisms and ulcerative colitis susceptibility in the Chinese Han Population
Article Snippet: Four single nucleotide polymorphisms (SNPs) of MIR155HG (rs1893650, rs2282471, rs2829803, and rs2829806) were genotyped using the Sequenom MassARRAY platform.

Variant Assay:

Article Title:
Article Snippet: .. OHSU: Oregon Health & Science University; MassARRAY: Sequenom MassARRAY iPLEX platform; 1KGP: 1000 Genomes Project. a 22 patient DNA samples; b 40 CCL samples and 22 patient DNA samples; c 40 CCL samples; d 40 CCL samples and 6 patient DNA samples analyzed for a single variant in RYR1 ; e 6 patient DNA samples analyzed for 34 variants in RYR1 . ..

DNA Purification:

Article Title: Integrating genetic and lifestyle determinants in a risk prediction model for esophageal squamous cell carcinoma in Taiwan.
Article Snippet: .. Genomic DNA was extracted from peripheral blood using the Puregene DNA Purification Kit (Gentra Systems, Minneapolis, MN, USA) and the resulting DNA was dispensed into 96-well plates (ABgene Limited, Epsom, UK). and samples Samples with concentrations ≥2.5 ng/μl were genotyped using the Sequenom MassARRAY system (with call rate > 95%). ..

Next-Generation Sequencing:

Article Title:
Article Snippet: .. Accuracy studies were performed by comparing the genotypes of the variants determined by the OA-PGx panel with at least one of 2 reference genotyping methods, next-generation sequencing (NGS), and/or Sequenom MassARRAY iPLEX platform (MassARRAY). ..

Modification:

Article Title: Midlife insulin resistance and brain beta-amyloid accumulation as predictors of change in late-life cognitive function - A 20-year follow-up study.
Article Snippet: .. APOE genotype was defined with the MassARRAY System (Sequenom, San Diego, CA, USA) with a modified protocol (Jänis et al., 2004). ..



Similar Products

99
New England Biolabs nebnext ultra tm ii rna library prep kit genotypic technologies
Nebnext Ultra Tm Ii Rna Library Prep Kit Genotypic Technologies, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/NEBNext+Ultra+II+RNA+Library+Prep+Kit/bio_rxiv__64898__2026__04__06__709730-107-17-17
Average 99 stars, based on 1 article reviews
nebnext ultra tm ii rna library prep kit genotypic technologies - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

86
Sequenom massarray snp genotyping technology
Massarray Snp Genotyping Technology, supplied by Sequenom, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/massarray+platform/pmc12593843-228-2-1
Average 86 stars, based on 1 article reviews
massarray snp genotyping technology - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Amersham Life Sciences Inc technologies discovery genotyping
Technologies Discovery Genotyping, supplied by Amersham Life Sciences Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/discovery+genotyping+technologies/sec_filing____40545_slash_000119312503069884_slash_d425-1085-12-16
Average 86 stars, based on 1 article reviews
technologies discovery genotyping - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

96
Cell Signaling Technology Inc plant genotypes seed stocks authentication plants phospho eif4e rabbit cell signaling technology
Plant Genotypes Seed Stocks Authentication Plants Phospho Eif4e Rabbit Cell Signaling Technology, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/Phospho-eIF4E+(Ser209)+Antibody/pmc11914046__41467_2025_57615_MOESM2_ESM-52-1-9
Average 96 stars, based on 1 article reviews
plant genotypes seed stocks authentication plants phospho eif4e rabbit cell signaling technology - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

90
Thermo Fisher high-throughput snp genotyping with microarray technology
High Throughput Snp Genotyping With Microarray Technology, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/pmc11675768-136-6-0
Average 90 stars, based on 1 article reviews
high-throughput snp genotyping with microarray technology - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

99
Qiagen taqman snp genotyping assay life technologies n a rneasy kit qiagen
Taqman Snp Genotyping Assay Life Technologies N A Rneasy Kit Qiagen, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/RNeasy+Mini+Kit/pm39255062-728-170-179
Average 99 stars, based on 1 article reviews
taqman snp genotyping assay life technologies n a rneasy kit qiagen - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

86
Danaher Inc rhamp snp genotyping technology
Rhamp Snp Genotyping Technology, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/pm38332006-106-39-43
Average 86 stars, based on 1 article reviews
rhamp snp genotyping technology - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Danaher Inc genotyping primers adar reverse gccacttctccctgactcctg integrated dna technology
Genotyping Primers Adar Reverse Gccacttctccctgactcctg Integrated Dna Technology, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/pm38128529-262-33-38
Average 86 stars, based on 1 article reviews
genotyping primers adar reverse gccacttctccctgactcctg integrated dna technology - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

Image Search Results