Review




Structured Review

Genotypic Technology Pvt Ltd microarray analyses
Microarray Analyses, supplied by Genotypic Technology Pvt Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/microarray+analysis/pm33329496-150-4-12
Average 90 stars, based on 1 article reviews
microarray analyses - by Bioz Stars, 2026-09
90/100 stars

Images

Related Articles

Microarray:

Article Title: Transcriptional Plasticity and Cell Wall Characterization in High-Methanol-Producing Transgenic Tobacco Plants
Article Snippet: The quality of the RNA was checked using Bioanalyzer (Agilent 2100); samples with an RNA Integrity Number of more than 8.0 were used for further experiment. .. Microarray analysis was outsourced to Genotypic technology Pvt. .. Ltd., Bangalore, India, and was performed using Agilent Platform with the Agilent tobacco whole genome microarray having 44,000 probe sets as per their standard protocol.

Article Title: MTO1-RESPONDING DOWN 1 (MRD1) is a transcriptional target of OZF1 for promoting salicylic acid-mediated defense in Arabidopsis.
Article Snippet: Key message OZF1 promotes the transcription of MRD1, which is essential for SA-mediated defense against virulent and avirulent bacterial pathogens in Arabidopsis.. Abstract Salicylic acid (SA) is critical for defense against biotrophic pathogens.. A trans-activator protein NPR1 plays significant roles in SA-signaling.

Article Title: The Rho-Dependent Transcription Termination Is Involved in Broad-Spectrum Antibiotic Susceptibility in Escherichia coli .
Article Snippet: .. RNA isolation and subsequent microarray analyses of these strains were performed by Genotypic Technology, Bangalore, India. ..

Article Title: Novel miRNA expression in the delta opioid signaling pathway mediated cell survivability in an in vitro model of ER stress.
Article Snippet: word count: 147 Number of references: 60 No of Figures/Tables: 5/3 Supplementary Tables: 2 ACCEPTED MANUSCRIPT

Article Title: Functional Omics Identifies Serine Hydrolases That Mobilize Storage Lipids during Rice Seed Germination
Article Snippet: .. The authors are grateful to C-CAMP for use of their Mass Spectrometry Facility and to Genotypic Technology for microarray analysis. .. 1 This work was supported by the Department of Science and Technology, Ministry of Science and Technology under the DST-INSPIRE Faculty Scheme (grant no. IFA14–LSPA28), and by the Council of Scientific and Industrial Research-University Grants Commission (Junior Research Fellowship to A.K.D.).

Article Title: Phenotypic and microarray analysis reveals salinity stress-induced oxidative tolerance in transgenic rice expressing a DEAD-box RNA helicase, OsDB10.
Article Snippet: Helicases are the motor proteins not only involved in the process of mRNA metabolism but also played a significant role in providing abiotic stresses tolerance.. In this study, a DEAD-box RNA helicase OsDB10 was cloned and functionally characterized.. The transcript levels of OsDB10 were increased both in shoot and root upon salt, heat, cold, and ABA application and was more prominent in shoot compared to root.

Article Title: Differential expression of transport and signalling genes in leaves and panicle regulates the development of pollen-free anthers in TGMS red rice
Article Snippet: Thermosensitive genic male sterile (TGMS) plants are male sterile above a critical sterility temperature (CST) and become male fertile below CST during a critical thermosensitive stage.. It is essential to analyse the gene expression pattern under fertilityand sterility-inducing conditions to understand the mechanisms of male sterility since it is regulated by a single recessive nuclear gene sensitive to environment during a specific stage of panicle development.. Hence, this study aims at understanding the molecular mechanism associated with pollen sterility in TGMS system.

Mutagenesis:

Article Title: MTO1-RESPONDING DOWN 1 (MRD1) is a transcriptional target of OZF1 for promoting salicylic acid-mediated defense in Arabidopsis.
Article Snippet: Key message OZF1 promotes the transcription of MRD1, which is essential for SA-mediated defense against virulent and avirulent bacterial pathogens in Arabidopsis.. Abstract Salicylic acid (SA) is critical for defense against biotrophic pathogens.. A trans-activator protein NPR1 plays significant roles in SA-signaling.

Isolation:

Article Title: The Rho-Dependent Transcription Termination Is Involved in Broad-Spectrum Antibiotic Susceptibility in Escherichia coli .
Article Snippet: .. RNA isolation and subsequent microarray analyses of these strains were performed by Genotypic Technology, Bangalore, India. ..

Mass Spectrometry:

Article Title: Functional Omics Identifies Serine Hydrolases That Mobilize Storage Lipids during Rice Seed Germination
Article Snippet: .. The authors are grateful to C-CAMP for use of their Mass Spectrometry Facility and to Genotypic Technology for microarray analysis. .. 1 This work was supported by the Department of Science and Technology, Ministry of Science and Technology under the DST-INSPIRE Faculty Scheme (grant no. IFA14–LSPA28), and by the Council of Scientific and Industrial Research-University Grants Commission (Junior Research Fellowship to A.K.D.).

Transgenic Assay:

Article Title: Phenotypic and microarray analysis reveals salinity stress-induced oxidative tolerance in transgenic rice expressing a DEAD-box RNA helicase, OsDB10.
Article Snippet: Helicases are the motor proteins not only involved in the process of mRNA metabolism but also played a significant role in providing abiotic stresses tolerance.. In this study, a DEAD-box RNA helicase OsDB10 was cloned and functionally characterized.. The transcript levels of OsDB10 were increased both in shoot and root upon salt, heat, cold, and ABA application and was more prominent in shoot compared to root.

Gene Expression:

Article Title: Differential expression of transport and signalling genes in leaves and panicle regulates the development of pollen-free anthers in TGMS red rice
Article Snippet: Thermosensitive genic male sterile (TGMS) plants are male sterile above a critical sterility temperature (CST) and become male fertile below CST during a critical thermosensitive stage.. It is essential to analyse the gene expression pattern under fertilityand sterility-inducing conditions to understand the mechanisms of male sterility since it is regulated by a single recessive nuclear gene sensitive to environment during a specific stage of panicle development.. Hence, this study aims at understanding the molecular mechanism associated with pollen sterility in TGMS system.

other:

Article Title: Histone variant dictates fate biasing of neural crest cells to melanocyte lineage.
Article Snippet: In the neural crest lineage, progressive fate-restriction and stem cell assignment are critical for both development and regeneration.. While the fate-commitment events have distinct transcriptional footprints, fate-biasing is often transitory and metastable, and is thought to be moulded by epigenetic programs.. Hence molecular basis of specification is difficult to define.



Similar Products

99
New England Biolabs nebnext ultra tm ii rna library prep kit genotypic technologies
Nebnext Ultra Tm Ii Rna Library Prep Kit Genotypic Technologies, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/NEBNext+Ultra+II+RNA+Library+Prep+Kit/bio_rxiv__64898__2026__04__06__709730-107-17-17
Average 99 stars, based on 1 article reviews
nebnext ultra tm ii rna library prep kit genotypic technologies - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

86
Sequenom massarray snp genotyping technology
Massarray Snp Genotyping Technology, supplied by Sequenom, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/massarray+platform/pmc12593843-228-2-1
Average 86 stars, based on 1 article reviews
massarray snp genotyping technology - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Amersham Life Sciences Inc technologies discovery genotyping
Technologies Discovery Genotyping, supplied by Amersham Life Sciences Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/discovery+genotyping+technologies/sec_filing____40545_slash_000119312503069884_slash_d425-1085-12-16
Average 86 stars, based on 1 article reviews
technologies discovery genotyping - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

96
Cell Signaling Technology Inc plant genotypes seed stocks authentication plants phospho eif4e rabbit cell signaling technology
Plant Genotypes Seed Stocks Authentication Plants Phospho Eif4e Rabbit Cell Signaling Technology, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/Phospho-eIF4E+(Ser209)+Antibody/pmc11914046__41467_2025_57615_MOESM2_ESM-52-1-9
Average 96 stars, based on 1 article reviews
plant genotypes seed stocks authentication plants phospho eif4e rabbit cell signaling technology - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

90
Thermo Fisher high-throughput snp genotyping with microarray technology
High Throughput Snp Genotyping With Microarray Technology, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/pmc11675768-136-6-0
Average 90 stars, based on 1 article reviews
high-throughput snp genotyping with microarray technology - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

99
Qiagen taqman snp genotyping assay life technologies n a rneasy kit qiagen
Taqman Snp Genotyping Assay Life Technologies N A Rneasy Kit Qiagen, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/RNeasy+Mini+Kit/pm39255062-728-170-179
Average 99 stars, based on 1 article reviews
taqman snp genotyping assay life technologies n a rneasy kit qiagen - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

86
Danaher Inc rhamp snp genotyping technology
Rhamp Snp Genotyping Technology, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/pm38332006-106-39-43
Average 86 stars, based on 1 article reviews
rhamp snp genotyping technology - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Danaher Inc genotyping primers adar reverse gccacttctccctgactcctg integrated dna technology
Genotyping Primers Adar Reverse Gccacttctccctgactcctg Integrated Dna Technology, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/pm38128529-262-33-38
Average 86 stars, based on 1 article reviews
genotyping primers adar reverse gccacttctccctgactcctg integrated dna technology - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

Image Search Results