7200 sequence detection system (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
90
Structured Review
Thermo Fisher
7200 sequence detection system
7200 Sequence Detection System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/7200+sequencer/pm30833152-80-30-34
Average 90 stars, based on 1 article reviews
7200 Sequence Detection System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/7200+sequencer/pm30833152-80-30-34
Average 90 stars, based on 1 article reviews
7200 sequence detection system - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Polymerase Chain Reaction:Article Title: Influence of VEGF-A gene variation and protein levels in breast cancer susceptibility and severity. Article Snippet: .. The PCR amplification cycles (for all 4 polymorphisms) were 50 C for 2 min and 95 C for 10 min, followed by 40 cycles of 95 C for 15 sec and 62 C for 1 min. Levels of FAM and TET fluorescence were determined and allelic discrimination was carried out using the Article Title: Endostatin gene variation and protein levels in breast cancer susceptibility and severity Article Snippet: .. The PCR amplification cycle was 50°C for 2 min and 95°C for 10 min, followed by 40 cycles of 95°C for 15 seconds and 62°C for 1 min. Levels of FAM and TET fluorescence were determined and allelic discrimination was carried out using the Article Title: Amiloride Relaxes Rat Corpus Cavernosum Relaxation In Vitro and Increases Intracavernous Pressure In Vivo. Article Snippet: J Sex Med Introduction: The antihypertensive effects of thiazide diuretics such as hydrochlorothiazide are commonly associated with erectile dysfunction.. The association of hydrochlorothiazide/amiloride is not associated with erectile dysfunction.. The hypothesis is that amiloride has beneficial effect in penile erection and, therefore, counterbalances the hydrochlorothiazide-induced disruptive effect. Article Title: A novel experimental model of erectile dysfunction in rats with heart failure using volume overload Article Snippet: .. All samples were assayed in a 12 μL volume containing 3 μl of 10 ng cDNA, 6 μl SYBR Green Master Mix Polymerase Chain Reaction and 3 μl of specific primers in a MicroAmp Optical 96-well reaction plate using the Article Title: Dipeptidyl Peptidase 2 apoptosis assay determines the B-cell activation stage and predicts prognosis in chronic lymphocytic leukemia Article Snippet: Purified cells were immediately lysed, and RNA was extracted using RNeasy Mini Kit (Qiagen, Valencia, CA). .. Complementary DNA (cDNA) was synthesized from 1 μg of RNA with the use of SuperScript RT Kit (Invitrogen, Carlsbad, CA). cDNA was used for quantitative real-time reverse-transcription PCR (qRT-PCR), using a human TaqMan MGB probe (#MGB4316034) and RT-PCR reagents (#4304971) (Applied Biosystems, Foster City, CA), run and analyzed on ABI Amplification:Article Title: Influence of VEGF-A gene variation and protein levels in breast cancer susceptibility and severity. Article Snippet: .. The PCR amplification cycles (for all 4 polymorphisms) were 50 C for 2 min and 95 C for 10 min, followed by 40 cycles of 95 C for 15 sec and 62 C for 1 min. Levels of FAM and TET fluorescence were determined and allelic discrimination was carried out using the Article Title: Endostatin gene variation and protein levels in breast cancer susceptibility and severity Article Snippet: .. The PCR amplification cycle was 50°C for 2 min and 95°C for 10 min, followed by 40 cycles of 95°C for 15 seconds and 62°C for 1 min. Levels of FAM and TET fluorescence were determined and allelic discrimination was carried out using the Fluorescence:Article Title: Influence of VEGF-A gene variation and protein levels in breast cancer susceptibility and severity. Article Snippet: .. The PCR amplification cycles (for all 4 polymorphisms) were 50 C for 2 min and 95 C for 10 min, followed by 40 cycles of 95 C for 15 sec and 62 C for 1 min. Levels of FAM and TET fluorescence were determined and allelic discrimination was carried out using the Article Title: Endostatin gene variation and protein levels in breast cancer susceptibility and severity Article Snippet: .. The PCR amplification cycle was 50°C for 2 min and 95°C for 10 min, followed by 40 cycles of 95°C for 15 seconds and 62°C for 1 min. Levels of FAM and TET fluorescence were determined and allelic discrimination was carried out using the Article Title: Interleukin gene polymorphisms and breast cancer: a case control study and systematic literature review Article Snippet: .. Levels of FAM and TET fluorescence were determined and allelic discrimination was carried out using the Sequencing:Article Title: Influence of VEGF-A gene variation and protein levels in breast cancer susceptibility and severity. Article Snippet: .. The PCR amplification cycles (for all 4 polymorphisms) were 50 C for 2 min and 95 C for 10 min, followed by 40 cycles of 95 C for 15 sec and 62 C for 1 min. Levels of FAM and TET fluorescence were determined and allelic discrimination was carried out using the Article Title: Endostatin gene variation and protein levels in breast cancer susceptibility and severity Article Snippet: .. The PCR amplification cycle was 50°C for 2 min and 95°C for 10 min, followed by 40 cycles of 95°C for 15 seconds and 62°C for 1 min. Levels of FAM and TET fluorescence were determined and allelic discrimination was carried out using the Article Title: Interleukin gene polymorphisms and breast cancer: a case control study and systematic literature review Article Snippet: .. Levels of FAM and TET fluorescence were determined and allelic discrimination was carried out using the Article Title: Amiloride Relaxes Rat Corpus Cavernosum Relaxation In Vitro and Increases Intracavernous Pressure In Vivo. Article Snippet: J Sex Med Introduction: The antihypertensive effects of thiazide diuretics such as hydrochlorothiazide are commonly associated with erectile dysfunction.. The association of hydrochlorothiazide/amiloride is not associated with erectile dysfunction.. The hypothesis is that amiloride has beneficial effect in penile erection and, therefore, counterbalances the hydrochlorothiazide-induced disruptive effect. Article Title: A novel experimental model of erectile dysfunction in rats with heart failure using volume overload Article Snippet: .. All samples were assayed in a 12 μL volume containing 3 μl of 10 ng cDNA, 6 μl SYBR Green Master Mix Polymerase Chain Reaction and 3 μl of specific primers in a MicroAmp Optical 96-well reaction plate using the Article Title: Permanent Oviduct Posteriorization after Neonatal Exposure to the Phytoestrogen Genistein Article Snippet: .. RT-PCR was performed on 20 ng cDNA using SYBR ® Green–based detection on an ABI Article Title: T H 17 Differentiation is the Default Program for DPP2-deficient T cell Differentiation Article Snippet: The two male mice with highest GFP expression were chosen to mate with transgenic mice that express Cre in tissue-restricted manner. lck-Cre mice (C57BL/6, cat#004197) 25 were purchased from Taconic Farms, Inc. (Hudson, NY). .. Flow Cytometry Lymphocytes from thymus, spleen and LN were stained with αCD4-APC and αCD8-PEcy5 (BD Biosciences) in PBS for 15min at room temperature followed by FACS calibur (BD Biosciences) analysis to determine the percentage of T cell populations in these tissues. qRT-PCR qRT-PCR were performed on total RNA isolated from cells (RNeasy mini kit, Qiagen) using mouse Dpp2 (primer pair: GGAGGCCCTGCTTGTCTTT and CACCGAACGGAAGCGATTTC; TaqMan MGB probe: 6-FAM-CTGAGCACCGGTACTATG-NFQMGB) and RT-PCR reagents (#4304971) (Applied Biosystems), were run and analyzed on ABI Article Title: Dipeptidyl Peptidase 2 apoptosis assay determines the B-cell activation stage and predicts prognosis in chronic lymphocytic leukemia Article Snippet: Purified cells were immediately lysed, and RNA was extracted using RNeasy Mini Kit (Qiagen, Valencia, CA). .. Complementary DNA (cDNA) was synthesized from 1 μg of RNA with the use of SuperScript RT Kit (Invitrogen, Carlsbad, CA). cDNA was used for quantitative real-time reverse-transcription PCR (qRT-PCR), using a human TaqMan MGB probe (#MGB4316034) and RT-PCR reagents (#4304971) (Applied Biosystems, Foster City, CA), run and analyzed on ABI SYBR Green Assay:Article Title: Amiloride Relaxes Rat Corpus Cavernosum Relaxation In Vitro and Increases Intracavernous Pressure In Vivo. Article Snippet: J Sex Med Introduction: The antihypertensive effects of thiazide diuretics such as hydrochlorothiazide are commonly associated with erectile dysfunction.. The association of hydrochlorothiazide/amiloride is not associated with erectile dysfunction.. The hypothesis is that amiloride has beneficial effect in penile erection and, therefore, counterbalances the hydrochlorothiazide-induced disruptive effect. Article Title: A novel experimental model of erectile dysfunction in rats with heart failure using volume overload Article Snippet: .. All samples were assayed in a 12 μL volume containing 3 μl of 10 ng cDNA, 6 μl SYBR Green Master Mix Polymerase Chain Reaction and 3 μl of specific primers in a MicroAmp Optical 96-well reaction plate using the Reverse Transcription Polymerase Chain Reaction:Article Title: Permanent Oviduct Posteriorization after Neonatal Exposure to the Phytoestrogen Genistein Article Snippet: .. RT-PCR was performed on 20 ng cDNA using SYBR ® Green–based detection on an ABI Article Title: T H 17 Differentiation is the Default Program for DPP2-deficient T cell Differentiation Article Snippet: The two male mice with highest GFP expression were chosen to mate with transgenic mice that express Cre in tissue-restricted manner. lck-Cre mice (C57BL/6, cat#004197) 25 were purchased from Taconic Farms, Inc. (Hudson, NY). .. Flow Cytometry Lymphocytes from thymus, spleen and LN were stained with αCD4-APC and αCD8-PEcy5 (BD Biosciences) in PBS for 15min at room temperature followed by FACS calibur (BD Biosciences) analysis to determine the percentage of T cell populations in these tissues. qRT-PCR qRT-PCR were performed on total RNA isolated from cells (RNeasy mini kit, Qiagen) using mouse Dpp2 (primer pair: GGAGGCCCTGCTTGTCTTT and CACCGAACGGAAGCGATTTC; TaqMan MGB probe: 6-FAM-CTGAGCACCGGTACTATG-NFQMGB) and RT-PCR reagents (#4304971) (Applied Biosystems), were run and analyzed on ABI Article Title: Dipeptidyl Peptidase 2 apoptosis assay determines the B-cell activation stage and predicts prognosis in chronic lymphocytic leukemia Article Snippet: Purified cells were immediately lysed, and RNA was extracted using RNeasy Mini Kit (Qiagen, Valencia, CA). .. Complementary DNA (cDNA) was synthesized from 1 μg of RNA with the use of SuperScript RT Kit (Invitrogen, Carlsbad, CA). cDNA was used for quantitative real-time reverse-transcription PCR (qRT-PCR), using a human TaqMan MGB probe (#MGB4316034) and RT-PCR reagents (#4304971) (Applied Biosystems, Foster City, CA), run and analyzed on ABI Flow Cytometry:Article Title: T H 17 Differentiation is the Default Program for DPP2-deficient T cell Differentiation Article Snippet: The two male mice with highest GFP expression were chosen to mate with transgenic mice that express Cre in tissue-restricted manner. lck-Cre mice (C57BL/6, cat#004197) 25 were purchased from Taconic Farms, Inc. (Hudson, NY). .. Flow Cytometry Lymphocytes from thymus, spleen and LN were stained with αCD4-APC and αCD8-PEcy5 (BD Biosciences) in PBS for 15min at room temperature followed by FACS calibur (BD Biosciences) analysis to determine the percentage of T cell populations in these tissues. qRT-PCR qRT-PCR were performed on total RNA isolated from cells (RNeasy mini kit, Qiagen) using mouse Dpp2 (primer pair: GGAGGCCCTGCTTGTCTTT and CACCGAACGGAAGCGATTTC; TaqMan MGB probe: 6-FAM-CTGAGCACCGGTACTATG-NFQMGB) and RT-PCR reagents (#4304971) (Applied Biosystems), were run and analyzed on ABI Staining:Article Title: T H 17 Differentiation is the Default Program for DPP2-deficient T cell Differentiation Article Snippet: The two male mice with highest GFP expression were chosen to mate with transgenic mice that express Cre in tissue-restricted manner. lck-Cre mice (C57BL/6, cat#004197) 25 were purchased from Taconic Farms, Inc. (Hudson, NY). .. Flow Cytometry Lymphocytes from thymus, spleen and LN were stained with αCD4-APC and αCD8-PEcy5 (BD Biosciences) in PBS for 15min at room temperature followed by FACS calibur (BD Biosciences) analysis to determine the percentage of T cell populations in these tissues. qRT-PCR qRT-PCR were performed on total RNA isolated from cells (RNeasy mini kit, Qiagen) using mouse Dpp2 (primer pair: GGAGGCCCTGCTTGTCTTT and CACCGAACGGAAGCGATTTC; TaqMan MGB probe: 6-FAM-CTGAGCACCGGTACTATG-NFQMGB) and RT-PCR reagents (#4304971) (Applied Biosystems), were run and analyzed on ABI FACS:Article Title: T H 17 Differentiation is the Default Program for DPP2-deficient T cell Differentiation Article Snippet: The two male mice with highest GFP expression were chosen to mate with transgenic mice that express Cre in tissue-restricted manner. lck-Cre mice (C57BL/6, cat#004197) 25 were purchased from Taconic Farms, Inc. (Hudson, NY). .. Flow Cytometry Lymphocytes from thymus, spleen and LN were stained with αCD4-APC and αCD8-PEcy5 (BD Biosciences) in PBS for 15min at room temperature followed by FACS calibur (BD Biosciences) analysis to determine the percentage of T cell populations in these tissues. qRT-PCR qRT-PCR were performed on total RNA isolated from cells (RNeasy mini kit, Qiagen) using mouse Dpp2 (primer pair: GGAGGCCCTGCTTGTCTTT and CACCGAACGGAAGCGATTTC; TaqMan MGB probe: 6-FAM-CTGAGCACCGGTACTATG-NFQMGB) and RT-PCR reagents (#4304971) (Applied Biosystems), were run and analyzed on ABI Quantitative RT-PCR:Article Title: T H 17 Differentiation is the Default Program for DPP2-deficient T cell Differentiation Article Snippet: The two male mice with highest GFP expression were chosen to mate with transgenic mice that express Cre in tissue-restricted manner. lck-Cre mice (C57BL/6, cat#004197) 25 were purchased from Taconic Farms, Inc. (Hudson, NY). .. Flow Cytometry Lymphocytes from thymus, spleen and LN were stained with αCD4-APC and αCD8-PEcy5 (BD Biosciences) in PBS for 15min at room temperature followed by FACS calibur (BD Biosciences) analysis to determine the percentage of T cell populations in these tissues. qRT-PCR qRT-PCR were performed on total RNA isolated from cells (RNeasy mini kit, Qiagen) using mouse Dpp2 (primer pair: GGAGGCCCTGCTTGTCTTT and CACCGAACGGAAGCGATTTC; TaqMan MGB probe: 6-FAM-CTGAGCACCGGTACTATG-NFQMGB) and RT-PCR reagents (#4304971) (Applied Biosystems), were run and analyzed on ABI Isolation:Article Title: T H 17 Differentiation is the Default Program for DPP2-deficient T cell Differentiation Article Snippet: The two male mice with highest GFP expression were chosen to mate with transgenic mice that express Cre in tissue-restricted manner. lck-Cre mice (C57BL/6, cat#004197) 25 were purchased from Taconic Farms, Inc. (Hudson, NY). .. Flow Cytometry Lymphocytes from thymus, spleen and LN were stained with αCD4-APC and αCD8-PEcy5 (BD Biosciences) in PBS for 15min at room temperature followed by FACS calibur (BD Biosciences) analysis to determine the percentage of T cell populations in these tissues. qRT-PCR qRT-PCR were performed on total RNA isolated from cells (RNeasy mini kit, Qiagen) using mouse Dpp2 (primer pair: GGAGGCCCTGCTTGTCTTT and CACCGAACGGAAGCGATTTC; TaqMan MGB probe: 6-FAM-CTGAGCACCGGTACTATG-NFQMGB) and RT-PCR reagents (#4304971) (Applied Biosystems), were run and analyzed on ABI Synthesized:Article Title: Dipeptidyl Peptidase 2 apoptosis assay determines the B-cell activation stage and predicts prognosis in chronic lymphocytic leukemia Article Snippet: Purified cells were immediately lysed, and RNA was extracted using RNeasy Mini Kit (Qiagen, Valencia, CA). .. Complementary DNA (cDNA) was synthesized from 1 μg of RNA with the use of SuperScript RT Kit (Invitrogen, Carlsbad, CA). cDNA was used for quantitative real-time reverse-transcription PCR (qRT-PCR), using a human TaqMan MGB probe (#MGB4316034) and RT-PCR reagents (#4304971) (Applied Biosystems, Foster City, CA), run and analyzed on ABI Reverse Transcription:Article Title: Dipeptidyl Peptidase 2 apoptosis assay determines the B-cell activation stage and predicts prognosis in chronic lymphocytic leukemia Article Snippet: Purified cells were immediately lysed, and RNA was extracted using RNeasy Mini Kit (Qiagen, Valencia, CA). .. Complementary DNA (cDNA) was synthesized from 1 μg of RNA with the use of SuperScript RT Kit (Invitrogen, Carlsbad, CA). cDNA was used for quantitative real-time reverse-transcription PCR (qRT-PCR), using a human TaqMan MGB probe (#MGB4316034) and RT-PCR reagents (#4304971) (Applied Biosystems, Foster City, CA), run and analyzed on ABI |