hybridization buffer (50% deionized formamide, 5 sspe, 1 denhardt’s solution, 0.1% sds and 2 mg of heat-denatured salmon sperm dna) (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
90
Structured Review
Thermo Fisher
hybridization buffer (50% deionized formamide, 5 sspe, 1 denhardt’s solution, 0.1% sds and 2 mg of heat-denatured salmon sperm dna)
Hybridization Buffer (50% Deionized Formamide, 5 Sspe, 1 Denhardt’s Solution, 0.1% Sds And 2 Mg Of Heat Denatured Salmon Sperm Dna), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/2+sspe+buffer/pm15469884-75-18-15
Average 90 stars, based on 1 article reviews
Hybridization Buffer (50% Deionized Formamide, 5 Sspe, 1 Denhardt’s Solution, 0.1% Sds And 2 Mg Of Heat Denatured Salmon Sperm Dna), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/2+sspe+buffer/pm15469884-75-18-15
Average 90 stars, based on 1 article reviews
hybridization buffer (50% deionized formamide, 5 sspe, 1 denhardt’s solution, 0.1% sds and 2 mg of heat-denatured salmon sperm dna) - by Bioz Stars,
2026-11
90/100 stars
Images
Related Articles
Hybridization:Article Title: Critical factors for precise and efficient RNA cleavage by RNase Y in Staphylococcus aureus Article Snippet: For B . subtilis RNA: 5μg total RNA were separated on 1% agarose gel transferred by capillarity to a Hybond-N+ membrane (Amersham) in 5X SSC, 0.01M NaOH, then UV crosslinked 120 J/cm 2 (UVP, HL2000). .. Hybridization was performed using 5’-labeled oligonucleotides atpB (CC2437) and glnA (CC2438) using Ultra-Hyb (Ambion) Article Title: The five homologous CiaR-controlled Ccn sRNAs of Streptococcus pneumoniae modulate Zn-resistance. Article Snippet: Briefly, 3 μg of isolated RNA was fractionated on 10% polyacrylamide gels containing 7% urea by electrophoresis at 55 V and subsequently, transferred to a Zeta-probe membrane (Bio-Rad) using a Trans-Blot SD semidry transfer apparatus (Bio-rad) at 4 mA per cm2 with a maximum of 400 mA for 50 min. RNA was then UV-crosslinked to the membrane with a Spectroline UV crosslinker with the "optimal crosslink" setting. .. 5’-Biotinylated probes were hybridized to the membrane overnight at 42 Article Title: Gγ-protein GS3 Function in Tight Genetic Relation with OsmiR396/GS2 to Regulate Grain Size in Rice. Article Snippet: .. The blots were incubated at 42°C for 30 min in the Article Title: Preclinical development of lentiviral vector gene therapy for Diamond-Blackfan anemia syndrome. Article Snippet: After gel fractionation on a 1.5% formaldehyde-agarose gel, the RNA 445 was transferred onto zeta-probe nylon membranes (Bio-Rad, #1620153). .. Subsequently, 32P-446 labeled ITS1 probes (CCTCGCCCTCCGGGCTCCGTTAATGA) were hybridized with the 447 membrane overnight at 37°C in Article Title: Enhancer Dynamics and Spatial Organization Drive Anatomically Restricted Cellular States in the Human Spinal Cord Article Snippet: .. Tissue was re-hydrated in PBSTR, consisting of 1X PBS + 0.1% Tween-20 (Sigma 655204-100ML) Article Title: Evidence for in vivo mRNA Transport Between Mammalian Cells Article Snippet: .. Cells were twice rinsed in 2 mL of PBS (Corning) and fixed in 4% solution of paraformaldehyde (Sigma-Aldrich) in 1xPBS solution for 15 mins at room temperature, rinsed with phosphate-buffered saline (PBS) (GE Life Sciences), permeabilized with 0.25% Triton X-100 (Sigma- Aldrich) for 20 min and rinsed with Article Title: The five homologous CiaR-controlled Ccn sRNAs of Streptococcus pneumoniae modulate Zn-resistance Article Snippet: Briefly, 3 μg of isolated RNA was fractionated on 10% polyacrylamide gels containing 7% urea by electrophoresis at 55 V and subsequently, transferred to a Zeta-probe membrane (Bio-Rad) using a Trans-Blot SD semidry transfer apparatus (Bio-rad) at 4 mA per cm 2 with a maximum of 400 mA for 50 min. RNA was then UV-crosslinked to the membrane with a Spectroline UV crosslinker with the "optimal crosslink" setting. .. 5’-Biotinylated probes were hybridized to the membrane overnight at 42 ° C in Membrane:Article Title: The five homologous CiaR-controlled Ccn sRNAs of Streptococcus pneumoniae modulate Zn-resistance. Article Snippet: Briefly, 3 μg of isolated RNA was fractionated on 10% polyacrylamide gels containing 7% urea by electrophoresis at 55 V and subsequently, transferred to a Zeta-probe membrane (Bio-Rad) using a Trans-Blot SD semidry transfer apparatus (Bio-rad) at 4 mA per cm2 with a maximum of 400 mA for 50 min. RNA was then UV-crosslinked to the membrane with a Spectroline UV crosslinker with the "optimal crosslink" setting. .. 5’-Biotinylated probes were hybridized to the membrane overnight at 42 Article Title: Preclinical development of lentiviral vector gene therapy for Diamond-Blackfan anemia syndrome. Article Snippet: After gel fractionation on a 1.5% formaldehyde-agarose gel, the RNA 445 was transferred onto zeta-probe nylon membranes (Bio-Rad, #1620153). .. Subsequently, 32P-446 labeled ITS1 probes (CCTCGCCCTCCGGGCTCCGTTAATGA) were hybridized with the 447 membrane overnight at 37°C in Article Title: The five homologous CiaR-controlled Ccn sRNAs of Streptococcus pneumoniae modulate Zn-resistance Article Snippet: Briefly, 3 μg of isolated RNA was fractionated on 10% polyacrylamide gels containing 7% urea by electrophoresis at 55 V and subsequently, transferred to a Zeta-probe membrane (Bio-Rad) using a Trans-Blot SD semidry transfer apparatus (Bio-rad) at 4 mA per cm 2 with a maximum of 400 mA for 50 min. RNA was then UV-crosslinked to the membrane with a Spectroline UV crosslinker with the "optimal crosslink" setting. .. 5’-Biotinylated probes were hybridized to the membrane overnight at 42 ° C in Incubation:Article Title: Gγ-protein GS3 Function in Tight Genetic Relation with OsmiR396/GS2 to Regulate Grain Size in Rice. Article Snippet: .. The blots were incubated at 42°C for 30 min in the Labeling:Article Title: Preclinical development of lentiviral vector gene therapy for Diamond-Blackfan anemia syndrome. Article Snippet: After gel fractionation on a 1.5% formaldehyde-agarose gel, the RNA 445 was transferred onto zeta-probe nylon membranes (Bio-Rad, #1620153). .. Subsequently, 32P-446 labeled ITS1 probes (CCTCGCCCTCCGGGCTCCGTTAATGA) were hybridized with the 447 membrane overnight at 37°C in other:Article Title: Wound-induced small-peptide-mediated signaling cascade, regulated by OsPSKR, dictates balance between growth and defense in rice. Article Snippet: Hybridization was performed using T4 PNK end labeled oligonucleotides with [g-P32] ATP in Saline:Article Title: Evidence for in vivo mRNA Transport Between Mammalian Cells Article Snippet: .. Cells were twice rinsed in 2 mL of PBS (Corning) and fixed in 4% solution of paraformaldehyde (Sigma-Aldrich) in 1xPBS solution for 15 mins at room temperature, rinsed with phosphate-buffered saline (PBS) (GE Life Sciences), permeabilized with 0.25% Triton X-100 (Sigma- Aldrich) for 20 min and rinsed with |