Review



vector 1 c  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc vector 1 c
    Vector 1 C, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vector+1+c/bio_rxiv__64898__2026__02__06__704447-196-8-10?v=Addgene+inc
    Average 93 stars, based on 18 article reviews
    vector 1 c - by Bioz Stars, 2026-08
    93/100 stars

    Images



    Similar Products

    93
    Addgene inc vector 1 c
    Vector 1 C, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vector+1+c/bio_rxiv__64898__2026__02__06__704447-196-8-10?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    vector 1 c - by Bioz Stars, 2026-08
    93/100 stars
      Buy from Supplier

    94
    Sino Biological pcdna3 1 expression vector
    Pcdna3 1 Expression Vector, supplied by Sino Biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vector+1+c/pm41566717-282-11-14?v=Sino+Biological
    Average 94 stars, based on 1 article reviews
    pcdna3 1 expression vector - by Bioz Stars, 2026-08
    94/100 stars
      Buy from Supplier

    94
    OriGene prfp c rs shppard 1 aggtagaagccatccaggacaccattctg
    Prfp C Rs Shppard 1 Aggtagaagccatccaggacaccattctg, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vector+1+c/pmc12820725-51-0-4?v=OriGene
    Average 94 stars, based on 1 article reviews
    prfp c rs shppard 1 aggtagaagccatccaggacaccattctg - by Bioz Stars, 2026-08
    94/100 stars
      Buy from Supplier

    95
    Cytiva Europe c tail fragments
    a Strep-tag pull-down assay demonstrating interaction of ICP8 with either full-length UL9 or UL9CTD. <t>b</t> <t>GST</t> pull-down assay analyzing binding between ICP8 and either UL9CTD or the <t>C-tail.</t> c Comparative ATPase activity of wild-type UL9 versus its functional mutants. ATPase activity assays were performed using the Malachite Green Phosphate Detection Kit. Data are presented as the mean with standard deviation for experiments performed in triplicate. Statistical significance was determined by a two-tailed Student’s t -test (*p < 0.05, **p < 0.01, *p < 0.001). d ICP8-mediated stimulation of UL9 helicase activity. Wild-type UL9 and two C-terminal truncation mutants (ΔC16 and ΔC8) were tested.
    C Tail Fragments, supplied by Cytiva Europe, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vector+1+c/bio_rxiv__2025__10__31__685793-207-14-22?v=Cytiva+Europe
    Average 95 stars, based on 1 article reviews
    c tail fragments - by Bioz Stars, 2026-08
    95/100 stars
      Buy from Supplier

    99
    Vector Laboratories time s vector hsp70 vector only streptavidin bead gaf fl af488 i j k 1 c d f
    a Strep-tag pull-down assay demonstrating interaction of ICP8 with either full-length UL9 or UL9CTD. <t>b</t> <t>GST</t> pull-down assay analyzing binding between ICP8 and either UL9CTD or the <t>C-tail.</t> c Comparative ATPase activity of wild-type UL9 versus its functional mutants. ATPase activity assays were performed using the Malachite Green Phosphate Detection Kit. Data are presented as the mean with standard deviation for experiments performed in triplicate. Statistical significance was determined by a two-tailed Student’s t -test (*p < 0.05, **p < 0.01, *p < 0.001). d ICP8-mediated stimulation of UL9 helicase activity. Wild-type UL9 and two C-terminal truncation mutants (ΔC16 and ΔC8) were tested.
    Time S Vector Hsp70 Vector Only Streptavidin Bead Gaf Fl Af488 I J K 1 C D F, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vector+1+c/pm40764461-148-108-110?v=Vector+Laboratories
    Average 99 stars, based on 1 article reviews
    time s vector hsp70 vector only streptavidin bead gaf fl af488 i j k 1 c d f - by Bioz Stars, 2026-08
    99/100 stars
      Buy from Supplier

    93
    Sino Biological human cebpb cdna
    a Strep-tag pull-down assay demonstrating interaction of ICP8 with either full-length UL9 or UL9CTD. <t>b</t> <t>GST</t> pull-down assay analyzing binding between ICP8 and either UL9CTD or the <t>C-tail.</t> c Comparative ATPase activity of wild-type UL9 versus its functional mutants. ATPase activity assays were performed using the Malachite Green Phosphate Detection Kit. Data are presented as the mean with standard deviation for experiments performed in triplicate. Statistical significance was determined by a two-tailed Student’s t -test (*p < 0.05, **p < 0.01, *p < 0.001). d ICP8-mediated stimulation of UL9 helicase activity. Wild-type UL9 and two C-terminal truncation mutants (ΔC16 and ΔC8) were tested.
    Human Cebpb Cdna, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vector+1+c/pmc12270669__mmc4-302-41-48?v=Sino+Biological
    Average 93 stars, based on 1 article reviews
    human cebpb cdna - by Bioz Stars, 2026-08
    93/100 stars
      Buy from Supplier

    93
    Addgene inc pcdna3 1 vector
    a Strep-tag pull-down assay demonstrating interaction of ICP8 with either full-length UL9 or UL9CTD. <t>b</t> <t>GST</t> pull-down assay analyzing binding between ICP8 and either UL9CTD or the <t>C-tail.</t> c Comparative ATPase activity of wild-type UL9 versus its functional mutants. ATPase activity assays were performed using the Malachite Green Phosphate Detection Kit. Data are presented as the mean with standard deviation for experiments performed in triplicate. Statistical significance was determined by a two-tailed Student’s t -test (*p < 0.05, **p < 0.01, *p < 0.001). d ICP8-mediated stimulation of UL9 helicase activity. Wild-type UL9 and two C-terminal truncation mutants (ΔC16 and ΔC8) were tested.
    Pcdna3 1 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vector+1+c/pm40000606-241-18-20?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    pcdna3 1 vector - by Bioz Stars, 2026-08
    93/100 stars
      Buy from Supplier

    96
    Addgene inc pcdna3 1 mcherry c intermediate construct
    a Strep-tag pull-down assay demonstrating interaction of ICP8 with either full-length UL9 or UL9CTD. <t>b</t> <t>GST</t> pull-down assay analyzing binding between ICP8 and either UL9CTD or the <t>C-tail.</t> c Comparative ATPase activity of wild-type UL9 versus its functional mutants. ATPase activity assays were performed using the Malachite Green Phosphate Detection Kit. Data are presented as the mean with standard deviation for experiments performed in triplicate. Statistical significance was determined by a two-tailed Student’s t -test (*p < 0.05, **p < 0.01, *p < 0.001). d ICP8-mediated stimulation of UL9 helicase activity. Wild-type UL9 and two C-terminal truncation mutants (ΔC16 and ΔC8) were tested.
    Pcdna3 1 Mcherry C Intermediate Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vector+1+c/pmc12269838-352-11-34?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    pcdna3 1 mcherry c intermediate construct - by Bioz Stars, 2026-08
    96/100 stars
      Buy from Supplier

    Image Search Results


    a Strep-tag pull-down assay demonstrating interaction of ICP8 with either full-length UL9 or UL9CTD. b GST pull-down assay analyzing binding between ICP8 and either UL9CTD or the C-tail. c Comparative ATPase activity of wild-type UL9 versus its functional mutants. ATPase activity assays were performed using the Malachite Green Phosphate Detection Kit. Data are presented as the mean with standard deviation for experiments performed in triplicate. Statistical significance was determined by a two-tailed Student’s t -test (*p < 0.05, **p < 0.01, *p < 0.001). d ICP8-mediated stimulation of UL9 helicase activity. Wild-type UL9 and two C-terminal truncation mutants (ΔC16 and ΔC8) were tested.

    Journal: bioRxiv

    Article Title: Structural basis of HSV-1 DNA replication origin-binding protein UL9

    doi: 10.1101/2025.10.31.685793

    Figure Lengend Snippet: a Strep-tag pull-down assay demonstrating interaction of ICP8 with either full-length UL9 or UL9CTD. b GST pull-down assay analyzing binding between ICP8 and either UL9CTD or the C-tail. c Comparative ATPase activity of wild-type UL9 versus its functional mutants. ATPase activity assays were performed using the Malachite Green Phosphate Detection Kit. Data are presented as the mean with standard deviation for experiments performed in triplicate. Statistical significance was determined by a two-tailed Student’s t -test (*p < 0.05, **p < 0.01, *p < 0.001). d ICP8-mediated stimulation of UL9 helicase activity. Wild-type UL9 and two C-terminal truncation mutants (ΔC16 and ΔC8) were tested.

    Article Snippet: UL9 CTD and its truncation mutants used for GST pull-down assays, along with two C-tail fragments, were cloned into the pGEX-6P-1 vector (GE Healthcare) to generate GST-tagged fusion proteins.

    Techniques: Strep-tag, Pull Down Assay, Binding Assay, Activity Assay, Functional Assay, Standard Deviation, Two Tailed Test