Review



cell lines thp 1 monocytes atcc tib 202 software  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    ATCC cell lines thp 1 monocytes atcc tib 202 software
    Cell Lines Thp 1 Monocytes Atcc Tib 202 Software, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 20286 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/thp+1+atcc/THP-1/pm42275226-99-103-107
    Average 99 stars, based on 20286 article reviews
    cell lines thp 1 monocytes atcc tib 202 software - by Bioz Stars, 2026-10
    99/100 stars

    Images

    Related Articles

    other:

    Article Title: HE4 drives PD-L1 expression in myeloid cells via IFN-γR-JAK-STAT3 signaling to promote tumor immune evasion.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant mouse IL-4 MedChemExpress Cat# HY-P701093 recombinant mouse GM-CSF MedChemExpress Cat# HY-P7361 Recombinant Fc-tagged human HE4 protein abinScience Cat# HC595031 Critical commercial assays E.Z.N.A.® Total RNA Kit I Omega Biotek Cat# D6915-04 Hiscript III reverse kit Vazyme Cat# R302-01 SYBR Green qPCR master mix Vazyme Cat# Q311 Enhanced chemiluminescent substrate BioGround Cat# BG0001 Endo-free plasmid medium kit Omega Biotek Cat# D6915-04 FectoPRO transfection reagent Polyplus-transfection Cat# 116–040 Mouse IFN-γ ELISA kit Biolegend Cat# 430804 Human IFN-γ ELISA kit Biolegend Cat# 430104 Mouse TNF-α ELISA kit Biolegend Cat# 430904 Human HE4 ELISA kit Cusabio Cat# CSB-E12923h Mouse HE4 ELISA kit Cusabio Cat# CSB-EL026092MO Human Granzyme B ELISA kit Cusabio Cat# CSB-E08718h Mouse cTnI ELISA kit Solarbio Cat# SEKM-0153 Mouse Granzyme B ELISA kit Elabscience Cat# E-EL-M0594 Mouse FLT3L ELISA kit Elabscience Cat# E-EL-M0030 Mouse CRP ELISA kit Beyotime Cat# PC186 Mouse IL-6 ELISA kit Elabscience Cat# E-EL-M0044 Mouse ALT kit Elabscience Cat# E-BC-K235-S Mouse AST kit Elabscience Cat# E-BC-K236-M Amplex Red Creatinine Assay Kit Beyotime Cat# S0291S Zombie Violet TM Fixable Viability Kit BioLegend Cat# 423114 Quick Genotyping Assay Kit for mouse tail samples Beyotime Cat# D7283 Cell counting kit-8 MedChemExpress Cat# HY-K0301 Deposited data scRNA-seq from primary LUAD patients This study GSE298300 scRNA-seq from mouse LLC tumors This study GSE304155 Bulk RNA-seq from Raw264.7 treated with Fc, HE4-Fc, or IFN-γ, respectively This study GSE298587 Bulk RNA-seq from Raw264.7 treated with HE4-Fc, IFN-γ, or HE4-Fc + IFN-γ This study GSE313133 Experimental models: Cell lines Human: NCI-H358 Cyagen Biosciences N/A Human: OVCAR3 ATCC Cat# HTB161 Human: HEK293T ATCC Cat# CRL-11268 Mouse: LLC ATCC Cat# CRL-1642 Mouse: ID8 Quicell Biotech Cat# I451 Mouse: Raw264.7 ATCC Cat# TIB-71 Human: THP-1 ATCC Cat# TIB202 Mouse: 4T1 ATCC Cat# CRL-2539 Mouse: MC38 ATCC Cat# CRL-2640 Mouse: HGS-1 CancerTools. org Cat# 160537 Bone marrow-derived macrophages This study N/A Bone marrow-derived dendritic cells This study N/A Experimental models: Organisms/strains Wild-type C57BL/6JGpt GemPharmatech N000013 (Continued on next page) e3 Cell Reports Medicine 7, 102691, April 21, 2026 OPEN ACCESS

    Article Title: Protocol for the use of Oredsson universal replacement medium for cell banking and routine culturing of monolayer and suspension cultures.
    Article Snippet: Oredsson et al., STAR Protocols 6, 103781 June 20, 2025 a 2025 The Author(s).. Published by The Oredsson universal replacement (OUR) medium is the formulation of a universal xeno-free medium designed for the cultivation of human normal and cancer cells in 2D and 3D cultures.. Here, we present a protocol for the use of OUR medium for routine culturing, cell banking, and medium modification for suspension culture.


    Article Title: Immune targeting of triple-negative breast cancer through a clinically actionable STING agonist-CAR T cell platform
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples TNBC patient samples DFCI/BWH IRB# 93-085 PBMC STEMCELL Cat# 70025 Chemicals, peptides, and recombinant proteins Nano-Glo Fluorofurimazine In Vivo Substrate (FFz) Promega Cat# N4100 ADU-S100 Chemietek Cat# CT-ADUS100; CAS#: 1638750-95-4 2 ′ 3 ′ cGAMP Invivogen Cat# tlrl-nacga23-1; CAS#: 1441190-66-4 CID1067700 MilliporeSigma Cat# SML0545; CAS#: 314042-01-8 T cell TransAct TM , human Miltenyi Biotec Cat# 130-111-160 Human IL-2 Thermo Fisher Scientific Cat# PHC0021 Human IL-7 Thermo Fisher Scientific Cat# PHC0075 Human IL-15 Thermo Fisher Scientific Cat# PHC9154 Critical commercial assays EasySep TM Human CD8 + T cell Isolation Kit STEMCELL Cat# 17953 Human Cytokine/Chemokine Magnetic Bead Panel Merck Millipore Cat# HCYTMAG-60K-PX30 Human CXCL10 ELISA kit R&D Systems Cat# DIP100 Human CCL5 ELISA kit R&D Systems Cat# DRN00B Human IL-6 ELISA kit R&D Systems Cat# D6050 Human IL-8 ELISA kit R&D Systems Cat# D8000C Human IFNβ ELISA kit R&D Systems Cat# DIFNB0 Human IFNγ ELISA kit R&D Systems Cat# DIF50C Human Granzyme B ELISA kit R&D Systems Cat# DGZB00 Human TNFα ELISA kit R&D Systems Cat# DTA00D CellTiter-Glo Luminescent cell viability assay kit Promega Cat# G7571 Chromium Single Cell 5 ′ Library Construction kit 10X Genomics Cat# PN-1000190 Chromium Single Cell Mouse TCR Amplification kit 10X Genomics Cat# PN-1000254 ONE-Glo TM luciferase assay system Promega Cat# E6110 Deposited data Murine scRNA-seq data (CD45 + cells in 4T1 tumors) This paper NCBI Gene Expression Omnibus: GEO: GSE294854 Murine scRNA-seq data (PBMCs in 4T1 model) This paper NCBI Gene Expression Omnibus: GEO: GSE294846 Experimental models: Cell lines Human: HEK 293T ATCC Cat# CRL-3216 Human: HCC1143 ATCC Cat# CRL-2321 Human: HCC1806 ATCC Cat# CRL-2335 Human: MDAMB231 ATCC Cat# HTB-26 Human: MDAMB468 ATCC Cat# HTB-132 Human: HCC1937 ATCC Cat# CRL-2336 Human: HCC70 ATCC Cat# CRL-2315 Human: THP-1 ATCC Cat# TIB-202 Mouse: 4T1 ATCC Cat# CRL-2539 Human: H29D Laboratory of E. Smith N/A Human: RD114 Laboratory of E. Smith N/A Human: Jurkat, Clone E6-1 ATCC Cat# TIB-152 Human: CXCR3-Jurkat Kitajima et al., 2019 11 N/A (Continued on next page) Cell Reports Medicine 6, 102198, July 15, 2025 e2 Article ll OPEN ACCESS


    Mutagenesis:

    Article Title: Structure and function of a pair of non-competing monoclonal antibodies against Langya henipavirus attachment glycoprotein.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LayG-1133 GASDALIE This paper N/A Bacterial and virus strains E. coli DH5α TransGen Biotech CD201-02 Biological samples Serum and spleen from mice This paper N/A Chemicals, peptides, and recombinant proteins Dulbecco’s Modified Eagle Medium Gibco Cat# 11965092 FreeStyle 293 expression medium Gibco Cat# 12338026 Fetal bovine serum ExCell Bio Cat# FSP500 RPMI 1640, GlutaMAX Gibco Cat# 61870127 Penicillin-Streptomycin (10,000 U/mL) Gibco Cat# 15140163 HEPES (1M) Buffer Solution Gibco Cat# 15630080 Opti-MEM Reduced Serum Medium Gibco Cat# 51985034 Polyethylenimines (PEIs) 25K PolySciences Cat# 23966 SuperSignal West Pico PLUS Thermo Scientific Cat# 34577 Ni-NTA Agarose QIAGEN Cat# 30210 Trypsin-EDTA (0.25%) GIBCO Cat# 25200072 Superose 6, 10/300 G GE Healthcare Cat#17-5172-01 Trizma base Sigma-Aldrich Cat# 77-86-1 Imidazole Sangon Biotech Cat# B540146-0100 EZ Trans Life-iLab Cat# AC04L092 Ampicillin Amresco Cat# 69-52-3 Acetate 5.0 Cytiva Cat# BR100351 Glycine 1.5 Cytiva Cat# BR100354 Glycine 2.0 Cytiva Cat# BR100355 HBS-EP+ Buffer 10× Cytiva Cat# BR100669 LayV-G ECD with C-terminal His and FLAG tag This paper N/A LayV-G Head with C-terminal His and FLAG tag This paper N/A LayV-G Stalk with C-terminal His and FLAG tag This paper N/A MojV-G ECD with C-terminal His tag This paper N/A HeV-G ECD with C-terminal His tag This paper N/A NiV M -G ECD with C-terminal His tag This paper N/A DAPI (4 ′ ,6-diamidino-2-phenylindole, dihydrochloride) Beyotime Cat# C1002 5× SDS loading buffer with DTT Solarbio Cat# P1040 Native Gel Sample Loading Buffer, 5× Beyotime Cat# P0016N Glycoprotein Denaturing Buffer New England Biolabs Cat# B1704SVIAL LIVE/DEAD Fixable Dead Cell Stain reagent Invitrogen Cat# L34968 Aliphatic amine latex beads Invitrogen Cat# A37362 pHrodo Red, SE Invitrogen Cat# P36600 CellTrace CFSE Invitrogen Cat# C34554 Ni-NTA affinity resin Sigma-Aldrich Cat# 70666 0.5 M EDTA, pH 8.0 Invitrogen Cat# AM9260G Papain from papaya latex lyophilized powder Sigma-Aldrich Cat# P4762-1G Iodoacetamide Sigma-Aldrich Cat# I6125-25G L-Cysteine hydrochloride anhydrous Sigma-Aldrich Cat# 30120-50G 2 M H 2 SO 4 Sangon Biotech Cat# E661006-0500 Critical commercial assays Bright-Lite Luciferase Assay System Vazyme Biotech Cat# DD1204-03 TMB substrate Sangon Biotech Cat# E661007-0100 (Continued on next page) 16 Cell Reports 44, 116407, October 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Amine Coupling Kit Cytiva Cat# BR100050 Mut Express II Fast Mutagenesis Kit V2 Vazyme Biotech Cat# C214-01 NucleoBond Xtra Midi Plus Macherey-Nagel Cat# 740412.50 Immunol Staining Blocking Buffer Beyotime Cat# P0102 HRP Conjugation Kit Abcam Cat# ab102890 Deposited data LayV-G head protein in complex with Fabs of LayG-1069 and LayG-1133 This paper PDB: 9LEO EMDB: EMD-63031 Langya Henipavirus attachment protein Guo et al. 18 PDB:8ZJB EMDB: EMD-36741 Experimental models: Cell lines Jurkat-FcγRIIIa-V158 reporter cells Vazyme Biotech Cat# DD1301 Jurkat-FcγRIIa-R131 reporter cells Vazyme Biotech Cat# DD1305 Human: HEK293F Gibco Cat# R79007 Human: HEK293T ATCC Cat# CRL-3216 Human: THP-1 ATCC Cat# TIB-202 Hamster: CHO Cellcook Biotech Cat# CC9510 Experimental models: Organisms/strains Mouse: BALB/cJGpt mice, Female Gempharmatech-GD Cat# N000020-11 Oligonucleotides Primer: L234AL235A-For: TGCTCCTGAAGCA GCAGGCGGCCCTAGCGTGTTC This paper N/A Primer: L234AL235A-Rev: CCTGCTGCTTCAG GAGCAGGACAAGGAGG This paper N/A Primer: P329G For: TGGGTGCCCCTATCGAGAAGACCA This paper N/A Primer: P329G-Rev: TCTCGATAGGGGCACCC AGGGCCTTGTTGGACACC This paper N/A Primer: Fc_GASDALIE_Site1-For: GCAGGCCCT GATGTGTTCCTGTTCCCACCTAAGC This paper N/A Primer: Fc_GASDALIE_Site1-Rev: AACACATCAG GGCCTGCCAGCAGTTCAGGAGCAGGA This paper N/A Primer: Fc_GASDALIE_Site2-For: CCTCTCCCTGA AGAGAAGACCATCTCCAAGGCTAAG This paper N/A Primer: Fc_GASDALIE_Site2-Rev: TTCTCTTCAG GGAGAGGCAGGGCCTTGTTGGA This paper N/A Recombinant DNA Plasmids: pCAGGS-LayV-G-T2A-GFP This paper N/A Plasmids: pCAGGS-MojV-G-T2A-GFP This paper N/A Plasmids: pCAGGS-SARS-CoV-2 WT spike-T2A-GFP This paper N/A Plasmids: pCAGGS-LayV-G This paper N/A Plasmids: pCAGGS-MojV-G This paper N/A Plasmids: pCAGGS This paper N/A Plasmids: pCAGGS-LayV-G ECD (Flag and His tag) This paper N/A Plasmids: pCAGGS-MojV-G ECD (His tag) This paper N/A Plasmids: pCAGGS-HeV-G ECD (His tag) This paper N/A Plasmids: pCAGGS-NiV M -G ECD (His tag) This paper N/A Plasmids: pCAGGS-LayV-G Head (Flag and His tag) This paper N/A Plasmids: pCAGGS-LayV-G Stalk (Flag and His tag) This paper N/A Plasmids: pCDH-CMV-LayV-G-EF1α-GFP-Puro This paper N/A Plasmids: pCDH-CMV-EF1α-GFP-Puro This paper N/A (Continued on next page) Cell Reports 44, 116407, October 28, 2025 17 .. 6- to 8-week-old BALB/cJGpt female mice were sourced from Gempharmatech-GD.

    Article Title: Genomic mediators of acquired resistance to immunotherapy in metastatic melanoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-SEC24C Thermo Fisher Scientific Cat# PA5-59101; RRID: AB_2647077 anti-SEC24D Bethyl Cat# A304-813A-T; RRID: AB_2621008 anti-GAPDH Cell Signaling Technology Cat# 3683; RRID: AB_1642205 HLA-A/B/C antibody BioLegend Cat# 311406; RRID: AB_314875 PE mouse IgG2a,k BD Bioscience Cat# 554648; RRID: AB_395491 anti- CD3/APC BioLegend Cat# 317318; RRID: AB_1937212 anti-CD8/APC-Cy7 BioLegend Cat# 344714; RRID: AB_2044006 anti- CD137/PE BioLegend Cat# 309803; RRID: AB_314782 Anti-CD8 (Clone: 4B11) Leica Cat# NCL-CD8-4B11; RRID: AB_442068 Anti-PD-L1 (Clone: E1L3N) Cell Signaling Technology Cat# 13684; RRID: AB_2687655 Anti-FOXP3 (Clone: D2W8E) Cell Signaling Technology Cat# 98377; RRID: AB_2747370 Anti-PD-1 (Clone: EPR4877(2) Abcam Cat# ab137132; RRID: AB_2894867 Anti-CD11c (Clone: D3V1E) Cell Signaling Technology Cat# 45581; RRID: AB_2799286 Anti-CD4 (Clone: EPR6855) Abcam Cat# ab133616; RRID: AB_2750883 Anti-CD20 (Clone: L26) Dako Cat# GA60461-2 Anti-CD3 Dako Cat# GA50361-2 Anti-CD68 (Clone: D4B9C) Cell Signaling Technology Cat# 97778; RRID: AB_2928056 Anti-SOX10 (Clone: EP268) Epitomics Cat# AC-0237; RRID: AB_2941085 Bacterial and virus strains One Shot Stbl3 Chemically Competent E. coli Invitrogen Cat# C737303 Biological samples Patient tumor samples Dana Farber Cancer Institute See Table S1 Patient tumor samples Vanderbilt University Medical Center See Table S1 Chemicals, peptides, and recombinant proteins ADU-S100 STING agonist Chemietek Cat# CT-ADUS100 Poly(dA:dT) naked (synthetic double-stranded DNA) InVivoGen Cat# tlrl-patn CellTrace Violet Stain Invitrogen Cat# C34557A Live/Dead Green Fixable Green Dead Cell Stain Invitrogen Cat# L34970A PMA Sigma-Aldrich Cat# P1585 Ionomycin Sigma-Aldrich Cat# 200-664-3 Interleukin-7 human Sigma-Aldrich Cat# I5896 Interleukin-15 human Sigma-Aldrich Cat# I8648 TRIzol Invitrogen Cat# 15596018 Pure Ethanol 190 Proof Decon Labs Inc. Cat# UN1170 Isopropanol Fisher Bioreagents Cat# BP2618-1 Chloroform ChemCruz Cat# sc-239527A 2-Mercaptoethanol Sigma Cat# M6250 4x Laemmli Sample Buffer BioRad Cat# 1610747 Fetal Bovine Serum Gemini Bio Cat#100-106-500 penicillin-streptomycin antibiotics Life Technologies Cat#15140122 Puromycin selection antibiotic InVivoGen Cat# ant-pr-1 Blasticidin selection antibiotic InVivoGen Cat# ant-bl-1 (Continued on next page) Cancer Cell 43, 308–316.e1–e6, February 10, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Bovine Serum Albumin Boston BioProducts Cat# C-11070D Polybrene Santa Cruz Cat# SC-134220 Critical commercial assays PCR Mycoplasma Detection Kit Applied Biological Materials Inc. Cat# G238 iTaq Universal SYBR Green One-Step kit Bio-Rad Cat# 1725150 Deposited data Raw sequence data This paper dbGaP phs000452.v5 Experimental models: Cell lines Human: WM266.4 Cory Johannessen from Broad Institute of Harvard and MIT N/A Human: THP-1 ATCC Cat# TIB-202 Human: HEK 293T Lenti-X cells Takara Cat# 632180 MLANA-specific HLA- A*02:01-restricted TCR Oliveira, G. et al.36 N/A Oligonucleotides sgRNA: targeting human ROSA26: ACAGCAAGTTGTCTAACCCG Eton Biosciences N/A sgRNA #1: targeting human SEC24C: AAGAGCCCCACCTTCCTCGG Eton Biosciences N/A sgRNA #2: targeting human SEC24C CTGTGGGCAACCAGCCACCT Eton Biosciences N/A sgRNA: targeting human SEC24D: TTTATGCAGTTCATCGAAGG Eton Biosciences N/A qPCR Primer: human SEC24C Forward (5’-3’): TACGGGCACAGAGATCCCGG Reverse (5’-3’): GCTTACCGGATCCGCCACCA Eton Biosciences N/A qPCR Primer: human ACTB Forward (5’-3’): GTTGTCGACGACGAGCG Reverse (5’-3’): GCACAGAGCCTCGCCTT Eton Biosciences N/A qPCR Primer: human IFNB1 Forward (5’-3’): TTGTTGAGAACCTCCTGGCT Reverse (5’-3’): TGACTATGGTCCAGGCACAG Eton Biosciences N/A qPCR Primer: human CXCL10 Forward (5’-3’): CCACGTGTTGAGATCATTGCT Reverse (5’-3’): TGCATCGATTTTGCTCCCCT Eton Biosciences N/A Mutagenesis Primer: human SEC24C G220C: Forward: TTCAGGGTGTCCTCGGCTGCC Reverse: CCGAGGACACCCTGAAGCTG Eton Biosciences N/A Mutagenesis Primer: human SEC24C S107F: Forward: GGGTTTCAGCCATTTGGGTCC Reverse: AAATGGCTGGGACCCAGGCA Eton Biosciences N/A Recombinant DNA Plasmid: lentiCRISPR v2 Addgene Cat# 52961 Plasmid: pENTR-SEC24C Twist Bioscience N/A Plasmid: PAX2 viral packaging vector Addgene Cat#12260 Plasmid: pMD2.G viral packaging plasmid Addgene Cat#12259 Software and algorithms FlowJo FlowJo LLC v10.8.1 PRISM GraphPad v10 (Continued on next page) e2 Cancer Cell 43, 308–316.e1–e6, February 10, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER The Getz Lab CGA WES Characterization pipeline employs the following tools: MuTect,37 ContEst,38 Strelka,39 Orientation Bias Filter,40 DeTiN,41 AllelicCapSeg,42 MAFPoNFilter,43 ABSOLUTE,44 GATK,45 and Oncotator.46 Broad Institute https://portal.firecloud.org/#methods/ getzlab/CGA_WES_Characterization_ Pipeline_v0.1_Dec2018/ CoMut Crowdis et al.47 https://github.com/vanallenlab/comut GISTIC2.0 Mermal et al.48 https://github.com/broadinstitute/gistic2 deconstructSigs Rosenthal et al.49 https://github.com/raerose01/deconstructSigs PhylogicNDT Leshchiner et al.50 https://github.com/broadinstitute/PhylogicNDT Calculate mutational burden https://github.com/brendanreardon/ calculate_mutational_burden Integrative Genomics Viewer Robinson et al.51 https://github.com/igvteam/igv CADD Kircher et al.52 https://github.com/kircherlab/CADD-scripts Polyphen-2 HumDiv Adzhubei et al.53 http://genetics.bwh.harvard.edu/pph2 Other TransIT-LT1 Transfection Reagent Mirus Bio LLC Cat# MIR 2300 In-Fusion HD Cloning Kit Takara Bio Cat# 639650 MultiSite Gateway Cloning kit ThermoFisher Cat#12538120 iTaq Universal SYBR Green One-Step kit Bio-Rad Cat# 1725151 RIPA lysis buffer Boston Bioproducts Cat# BP-115 cOmplete Mini protease inhibitor Roche Cat# 11836153001 Phospho-STOP phosphatase inhibitor Roche Cat# 4906845001 BCA Protein Assay Kit Thermo Scientific Cat# 23224/23228 4-20% Criterion TGX Stain- Free Precast Gels BioRad Cat# 5678095 Trans- Blot Turbo BioRad Cat# 1704271 Tris Buffered Saline Tween Boston Bioproducts Cat# IBB-180X ECL Western Blotting Substrate Pierce Cat# 32106 CellTrace Violet Stain Invitrogen Cat# C34557A Live/Dead Green Invitrogen Cat# L34970A Tris Glycine-SDS Running Buffer Boston BioProducts Cat# BP-150 Plasmid Plus Mini Kit QIAGEN Cat# 27106 Plasmid Plus Midi Kit QIAGEN Cat# 12945 DMEM, high glucose Gibco Cat# 11965092 RPMI 1640 Medium Gibco Cat# 11875093 Trypsin-EDTA (0.05%), phenol red Gibco Cat# 25300054 LB Broth Lennox Cat# P-830 LB Agar Lennox Cat# P-820 Dry Milk Powder Research Products International Cat# M17200-1000.0 Opti-MEM I Reduced Serum Medium Gibco Cat# 31985070 PBS, pH 7.4 Gibco Cat# 10010023 12 Well Tissue Culture Plate, Sterile CellTreat Scientific Products Cat# 229111 6 Well Tissue Culture Plate, Sterile CellTreat Scientific Products Cat# 229105 96 Well Tissue Culture Plate, Sterile – Flat bottom CellTreat Scientific Products Cat# 229195 96 Well Tissue Culture Plate, Sterile – Round bottom CellTreat Scientific Products Cat# 229590 24 Well Tissue Culture Plate Corning Incorporated Cat# 3526

    Staining:

    Article Title: Structure and function of a pair of non-competing monoclonal antibodies against Langya henipavirus attachment glycoprotein.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LayG-1133 GASDALIE This paper N/A Bacterial and virus strains E. coli DH5α TransGen Biotech CD201-02 Biological samples Serum and spleen from mice This paper N/A Chemicals, peptides, and recombinant proteins Dulbecco’s Modified Eagle Medium Gibco Cat# 11965092 FreeStyle 293 expression medium Gibco Cat# 12338026 Fetal bovine serum ExCell Bio Cat# FSP500 RPMI 1640, GlutaMAX Gibco Cat# 61870127 Penicillin-Streptomycin (10,000 U/mL) Gibco Cat# 15140163 HEPES (1M) Buffer Solution Gibco Cat# 15630080 Opti-MEM Reduced Serum Medium Gibco Cat# 51985034 Polyethylenimines (PEIs) 25K PolySciences Cat# 23966 SuperSignal West Pico PLUS Thermo Scientific Cat# 34577 Ni-NTA Agarose QIAGEN Cat# 30210 Trypsin-EDTA (0.25%) GIBCO Cat# 25200072 Superose 6, 10/300 G GE Healthcare Cat#17-5172-01 Trizma base Sigma-Aldrich Cat# 77-86-1 Imidazole Sangon Biotech Cat# B540146-0100 EZ Trans Life-iLab Cat# AC04L092 Ampicillin Amresco Cat# 69-52-3 Acetate 5.0 Cytiva Cat# BR100351 Glycine 1.5 Cytiva Cat# BR100354 Glycine 2.0 Cytiva Cat# BR100355 HBS-EP+ Buffer 10× Cytiva Cat# BR100669 LayV-G ECD with C-terminal His and FLAG tag This paper N/A LayV-G Head with C-terminal His and FLAG tag This paper N/A LayV-G Stalk with C-terminal His and FLAG tag This paper N/A MojV-G ECD with C-terminal His tag This paper N/A HeV-G ECD with C-terminal His tag This paper N/A NiV M -G ECD with C-terminal His tag This paper N/A DAPI (4 ′ ,6-diamidino-2-phenylindole, dihydrochloride) Beyotime Cat# C1002 5× SDS loading buffer with DTT Solarbio Cat# P1040 Native Gel Sample Loading Buffer, 5× Beyotime Cat# P0016N Glycoprotein Denaturing Buffer New England Biolabs Cat# B1704SVIAL LIVE/DEAD Fixable Dead Cell Stain reagent Invitrogen Cat# L34968 Aliphatic amine latex beads Invitrogen Cat# A37362 pHrodo Red, SE Invitrogen Cat# P36600 CellTrace CFSE Invitrogen Cat# C34554 Ni-NTA affinity resin Sigma-Aldrich Cat# 70666 0.5 M EDTA, pH 8.0 Invitrogen Cat# AM9260G Papain from papaya latex lyophilized powder Sigma-Aldrich Cat# P4762-1G Iodoacetamide Sigma-Aldrich Cat# I6125-25G L-Cysteine hydrochloride anhydrous Sigma-Aldrich Cat# 30120-50G 2 M H 2 SO 4 Sangon Biotech Cat# E661006-0500 Critical commercial assays Bright-Lite Luciferase Assay System Vazyme Biotech Cat# DD1204-03 TMB substrate Sangon Biotech Cat# E661007-0100 (Continued on next page) 16 Cell Reports 44, 116407, October 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Amine Coupling Kit Cytiva Cat# BR100050 Mut Express II Fast Mutagenesis Kit V2 Vazyme Biotech Cat# C214-01 NucleoBond Xtra Midi Plus Macherey-Nagel Cat# 740412.50 Immunol Staining Blocking Buffer Beyotime Cat# P0102 HRP Conjugation Kit Abcam Cat# ab102890 Deposited data LayV-G head protein in complex with Fabs of LayG-1069 and LayG-1133 This paper PDB: 9LEO EMDB: EMD-63031 Langya Henipavirus attachment protein Guo et al. 18 PDB:8ZJB EMDB: EMD-36741 Experimental models: Cell lines Jurkat-FcγRIIIa-V158 reporter cells Vazyme Biotech Cat# DD1301 Jurkat-FcγRIIa-R131 reporter cells Vazyme Biotech Cat# DD1305 Human: HEK293F Gibco Cat# R79007 Human: HEK293T ATCC Cat# CRL-3216 Human: THP-1 ATCC Cat# TIB-202 Hamster: CHO Cellcook Biotech Cat# CC9510 Experimental models: Organisms/strains Mouse: BALB/cJGpt mice, Female Gempharmatech-GD Cat# N000020-11 Oligonucleotides Primer: L234AL235A-For: TGCTCCTGAAGCA GCAGGCGGCCCTAGCGTGTTC This paper N/A Primer: L234AL235A-Rev: CCTGCTGCTTCAG GAGCAGGACAAGGAGG This paper N/A Primer: P329G For: TGGGTGCCCCTATCGAGAAGACCA This paper N/A Primer: P329G-Rev: TCTCGATAGGGGCACCC AGGGCCTTGTTGGACACC This paper N/A Primer: Fc_GASDALIE_Site1-For: GCAGGCCCT GATGTGTTCCTGTTCCCACCTAAGC This paper N/A Primer: Fc_GASDALIE_Site1-Rev: AACACATCAG GGCCTGCCAGCAGTTCAGGAGCAGGA This paper N/A Primer: Fc_GASDALIE_Site2-For: CCTCTCCCTGA AGAGAAGACCATCTCCAAGGCTAAG This paper N/A Primer: Fc_GASDALIE_Site2-Rev: TTCTCTTCAG GGAGAGGCAGGGCCTTGTTGGA This paper N/A Recombinant DNA Plasmids: pCAGGS-LayV-G-T2A-GFP This paper N/A Plasmids: pCAGGS-MojV-G-T2A-GFP This paper N/A Plasmids: pCAGGS-SARS-CoV-2 WT spike-T2A-GFP This paper N/A Plasmids: pCAGGS-LayV-G This paper N/A Plasmids: pCAGGS-MojV-G This paper N/A Plasmids: pCAGGS This paper N/A Plasmids: pCAGGS-LayV-G ECD (Flag and His tag) This paper N/A Plasmids: pCAGGS-MojV-G ECD (His tag) This paper N/A Plasmids: pCAGGS-HeV-G ECD (His tag) This paper N/A Plasmids: pCAGGS-NiV M -G ECD (His tag) This paper N/A Plasmids: pCAGGS-LayV-G Head (Flag and His tag) This paper N/A Plasmids: pCAGGS-LayV-G Stalk (Flag and His tag) This paper N/A Plasmids: pCDH-CMV-LayV-G-EF1α-GFP-Puro This paper N/A Plasmids: pCDH-CMV-EF1α-GFP-Puro This paper N/A (Continued on next page) Cell Reports 44, 116407, October 28, 2025 17 .. 6- to 8-week-old BALB/cJGpt female mice were sourced from Gempharmatech-GD.

    Blocking Assay:

    Article Title: Structure and function of a pair of non-competing monoclonal antibodies against Langya henipavirus attachment glycoprotein.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LayG-1133 GASDALIE This paper N/A Bacterial and virus strains E. coli DH5α TransGen Biotech CD201-02 Biological samples Serum and spleen from mice This paper N/A Chemicals, peptides, and recombinant proteins Dulbecco’s Modified Eagle Medium Gibco Cat# 11965092 FreeStyle 293 expression medium Gibco Cat# 12338026 Fetal bovine serum ExCell Bio Cat# FSP500 RPMI 1640, GlutaMAX Gibco Cat# 61870127 Penicillin-Streptomycin (10,000 U/mL) Gibco Cat# 15140163 HEPES (1M) Buffer Solution Gibco Cat# 15630080 Opti-MEM Reduced Serum Medium Gibco Cat# 51985034 Polyethylenimines (PEIs) 25K PolySciences Cat# 23966 SuperSignal West Pico PLUS Thermo Scientific Cat# 34577 Ni-NTA Agarose QIAGEN Cat# 30210 Trypsin-EDTA (0.25%) GIBCO Cat# 25200072 Superose 6, 10/300 G GE Healthcare Cat#17-5172-01 Trizma base Sigma-Aldrich Cat# 77-86-1 Imidazole Sangon Biotech Cat# B540146-0100 EZ Trans Life-iLab Cat# AC04L092 Ampicillin Amresco Cat# 69-52-3 Acetate 5.0 Cytiva Cat# BR100351 Glycine 1.5 Cytiva Cat# BR100354 Glycine 2.0 Cytiva Cat# BR100355 HBS-EP+ Buffer 10× Cytiva Cat# BR100669 LayV-G ECD with C-terminal His and FLAG tag This paper N/A LayV-G Head with C-terminal His and FLAG tag This paper N/A LayV-G Stalk with C-terminal His and FLAG tag This paper N/A MojV-G ECD with C-terminal His tag This paper N/A HeV-G ECD with C-terminal His tag This paper N/A NiV M -G ECD with C-terminal His tag This paper N/A DAPI (4 ′ ,6-diamidino-2-phenylindole, dihydrochloride) Beyotime Cat# C1002 5× SDS loading buffer with DTT Solarbio Cat# P1040 Native Gel Sample Loading Buffer, 5× Beyotime Cat# P0016N Glycoprotein Denaturing Buffer New England Biolabs Cat# B1704SVIAL LIVE/DEAD Fixable Dead Cell Stain reagent Invitrogen Cat# L34968 Aliphatic amine latex beads Invitrogen Cat# A37362 pHrodo Red, SE Invitrogen Cat# P36600 CellTrace CFSE Invitrogen Cat# C34554 Ni-NTA affinity resin Sigma-Aldrich Cat# 70666 0.5 M EDTA, pH 8.0 Invitrogen Cat# AM9260G Papain from papaya latex lyophilized powder Sigma-Aldrich Cat# P4762-1G Iodoacetamide Sigma-Aldrich Cat# I6125-25G L-Cysteine hydrochloride anhydrous Sigma-Aldrich Cat# 30120-50G 2 M H 2 SO 4 Sangon Biotech Cat# E661006-0500 Critical commercial assays Bright-Lite Luciferase Assay System Vazyme Biotech Cat# DD1204-03 TMB substrate Sangon Biotech Cat# E661007-0100 (Continued on next page) 16 Cell Reports 44, 116407, October 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Amine Coupling Kit Cytiva Cat# BR100050 Mut Express II Fast Mutagenesis Kit V2 Vazyme Biotech Cat# C214-01 NucleoBond Xtra Midi Plus Macherey-Nagel Cat# 740412.50 Immunol Staining Blocking Buffer Beyotime Cat# P0102 HRP Conjugation Kit Abcam Cat# ab102890 Deposited data LayV-G head protein in complex with Fabs of LayG-1069 and LayG-1133 This paper PDB: 9LEO EMDB: EMD-63031 Langya Henipavirus attachment protein Guo et al. 18 PDB:8ZJB EMDB: EMD-36741 Experimental models: Cell lines Jurkat-FcγRIIIa-V158 reporter cells Vazyme Biotech Cat# DD1301 Jurkat-FcγRIIa-R131 reporter cells Vazyme Biotech Cat# DD1305 Human: HEK293F Gibco Cat# R79007 Human: HEK293T ATCC Cat# CRL-3216 Human: THP-1 ATCC Cat# TIB-202 Hamster: CHO Cellcook Biotech Cat# CC9510 Experimental models: Organisms/strains Mouse: BALB/cJGpt mice, Female Gempharmatech-GD Cat# N000020-11 Oligonucleotides Primer: L234AL235A-For: TGCTCCTGAAGCA GCAGGCGGCCCTAGCGTGTTC This paper N/A Primer: L234AL235A-Rev: CCTGCTGCTTCAG GAGCAGGACAAGGAGG This paper N/A Primer: P329G For: TGGGTGCCCCTATCGAGAAGACCA This paper N/A Primer: P329G-Rev: TCTCGATAGGGGCACCC AGGGCCTTGTTGGACACC This paper N/A Primer: Fc_GASDALIE_Site1-For: GCAGGCCCT GATGTGTTCCTGTTCCCACCTAAGC This paper N/A Primer: Fc_GASDALIE_Site1-Rev: AACACATCAG GGCCTGCCAGCAGTTCAGGAGCAGGA This paper N/A Primer: Fc_GASDALIE_Site2-For: CCTCTCCCTGA AGAGAAGACCATCTCCAAGGCTAAG This paper N/A Primer: Fc_GASDALIE_Site2-Rev: TTCTCTTCAG GGAGAGGCAGGGCCTTGTTGGA This paper N/A Recombinant DNA Plasmids: pCAGGS-LayV-G-T2A-GFP This paper N/A Plasmids: pCAGGS-MojV-G-T2A-GFP This paper N/A Plasmids: pCAGGS-SARS-CoV-2 WT spike-T2A-GFP This paper N/A Plasmids: pCAGGS-LayV-G This paper N/A Plasmids: pCAGGS-MojV-G This paper N/A Plasmids: pCAGGS This paper N/A Plasmids: pCAGGS-LayV-G ECD (Flag and His tag) This paper N/A Plasmids: pCAGGS-MojV-G ECD (His tag) This paper N/A Plasmids: pCAGGS-HeV-G ECD (His tag) This paper N/A Plasmids: pCAGGS-NiV M -G ECD (His tag) This paper N/A Plasmids: pCAGGS-LayV-G Head (Flag and His tag) This paper N/A Plasmids: pCAGGS-LayV-G Stalk (Flag and His tag) This paper N/A Plasmids: pCDH-CMV-LayV-G-EF1α-GFP-Puro This paper N/A Plasmids: pCDH-CMV-EF1α-GFP-Puro This paper N/A (Continued on next page) Cell Reports 44, 116407, October 28, 2025 17 .. 6- to 8-week-old BALB/cJGpt female mice were sourced from Gempharmatech-GD.

    Conjugation Assay:

    Article Title: Structure and function of a pair of non-competing monoclonal antibodies against Langya henipavirus attachment glycoprotein.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LayG-1133 GASDALIE This paper N/A Bacterial and virus strains E. coli DH5α TransGen Biotech CD201-02 Biological samples Serum and spleen from mice This paper N/A Chemicals, peptides, and recombinant proteins Dulbecco’s Modified Eagle Medium Gibco Cat# 11965092 FreeStyle 293 expression medium Gibco Cat# 12338026 Fetal bovine serum ExCell Bio Cat# FSP500 RPMI 1640, GlutaMAX Gibco Cat# 61870127 Penicillin-Streptomycin (10,000 U/mL) Gibco Cat# 15140163 HEPES (1M) Buffer Solution Gibco Cat# 15630080 Opti-MEM Reduced Serum Medium Gibco Cat# 51985034 Polyethylenimines (PEIs) 25K PolySciences Cat# 23966 SuperSignal West Pico PLUS Thermo Scientific Cat# 34577 Ni-NTA Agarose QIAGEN Cat# 30210 Trypsin-EDTA (0.25%) GIBCO Cat# 25200072 Superose 6, 10/300 G GE Healthcare Cat#17-5172-01 Trizma base Sigma-Aldrich Cat# 77-86-1 Imidazole Sangon Biotech Cat# B540146-0100 EZ Trans Life-iLab Cat# AC04L092 Ampicillin Amresco Cat# 69-52-3 Acetate 5.0 Cytiva Cat# BR100351 Glycine 1.5 Cytiva Cat# BR100354 Glycine 2.0 Cytiva Cat# BR100355 HBS-EP+ Buffer 10× Cytiva Cat# BR100669 LayV-G ECD with C-terminal His and FLAG tag This paper N/A LayV-G Head with C-terminal His and FLAG tag This paper N/A LayV-G Stalk with C-terminal His and FLAG tag This paper N/A MojV-G ECD with C-terminal His tag This paper N/A HeV-G ECD with C-terminal His tag This paper N/A NiV M -G ECD with C-terminal His tag This paper N/A DAPI (4 ′ ,6-diamidino-2-phenylindole, dihydrochloride) Beyotime Cat# C1002 5× SDS loading buffer with DTT Solarbio Cat# P1040 Native Gel Sample Loading Buffer, 5× Beyotime Cat# P0016N Glycoprotein Denaturing Buffer New England Biolabs Cat# B1704SVIAL LIVE/DEAD Fixable Dead Cell Stain reagent Invitrogen Cat# L34968 Aliphatic amine latex beads Invitrogen Cat# A37362 pHrodo Red, SE Invitrogen Cat# P36600 CellTrace CFSE Invitrogen Cat# C34554 Ni-NTA affinity resin Sigma-Aldrich Cat# 70666 0.5 M EDTA, pH 8.0 Invitrogen Cat# AM9260G Papain from papaya latex lyophilized powder Sigma-Aldrich Cat# P4762-1G Iodoacetamide Sigma-Aldrich Cat# I6125-25G L-Cysteine hydrochloride anhydrous Sigma-Aldrich Cat# 30120-50G 2 M H 2 SO 4 Sangon Biotech Cat# E661006-0500 Critical commercial assays Bright-Lite Luciferase Assay System Vazyme Biotech Cat# DD1204-03 TMB substrate Sangon Biotech Cat# E661007-0100 (Continued on next page) 16 Cell Reports 44, 116407, October 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Amine Coupling Kit Cytiva Cat# BR100050 Mut Express II Fast Mutagenesis Kit V2 Vazyme Biotech Cat# C214-01 NucleoBond Xtra Midi Plus Macherey-Nagel Cat# 740412.50 Immunol Staining Blocking Buffer Beyotime Cat# P0102 HRP Conjugation Kit Abcam Cat# ab102890 Deposited data LayV-G head protein in complex with Fabs of LayG-1069 and LayG-1133 This paper PDB: 9LEO EMDB: EMD-63031 Langya Henipavirus attachment protein Guo et al. 18 PDB:8ZJB EMDB: EMD-36741 Experimental models: Cell lines Jurkat-FcγRIIIa-V158 reporter cells Vazyme Biotech Cat# DD1301 Jurkat-FcγRIIa-R131 reporter cells Vazyme Biotech Cat# DD1305 Human: HEK293F Gibco Cat# R79007 Human: HEK293T ATCC Cat# CRL-3216 Human: THP-1 ATCC Cat# TIB-202 Hamster: CHO Cellcook Biotech Cat# CC9510 Experimental models: Organisms/strains Mouse: BALB/cJGpt mice, Female Gempharmatech-GD Cat# N000020-11 Oligonucleotides Primer: L234AL235A-For: TGCTCCTGAAGCA GCAGGCGGCCCTAGCGTGTTC This paper N/A Primer: L234AL235A-Rev: CCTGCTGCTTCAG GAGCAGGACAAGGAGG This paper N/A Primer: P329G For: TGGGTGCCCCTATCGAGAAGACCA This paper N/A Primer: P329G-Rev: TCTCGATAGGGGCACCC AGGGCCTTGTTGGACACC This paper N/A Primer: Fc_GASDALIE_Site1-For: GCAGGCCCT GATGTGTTCCTGTTCCCACCTAAGC This paper N/A Primer: Fc_GASDALIE_Site1-Rev: AACACATCAG GGCCTGCCAGCAGTTCAGGAGCAGGA This paper N/A Primer: Fc_GASDALIE_Site2-For: CCTCTCCCTGA AGAGAAGACCATCTCCAAGGCTAAG This paper N/A Primer: Fc_GASDALIE_Site2-Rev: TTCTCTTCAG GGAGAGGCAGGGCCTTGTTGGA This paper N/A Recombinant DNA Plasmids: pCAGGS-LayV-G-T2A-GFP This paper N/A Plasmids: pCAGGS-MojV-G-T2A-GFP This paper N/A Plasmids: pCAGGS-SARS-CoV-2 WT spike-T2A-GFP This paper N/A Plasmids: pCAGGS-LayV-G This paper N/A Plasmids: pCAGGS-MojV-G This paper N/A Plasmids: pCAGGS This paper N/A Plasmids: pCAGGS-LayV-G ECD (Flag and His tag) This paper N/A Plasmids: pCAGGS-MojV-G ECD (His tag) This paper N/A Plasmids: pCAGGS-HeV-G ECD (His tag) This paper N/A Plasmids: pCAGGS-NiV M -G ECD (His tag) This paper N/A Plasmids: pCAGGS-LayV-G Head (Flag and His tag) This paper N/A Plasmids: pCAGGS-LayV-G Stalk (Flag and His tag) This paper N/A Plasmids: pCDH-CMV-LayV-G-EF1α-GFP-Puro This paper N/A Plasmids: pCDH-CMV-EF1α-GFP-Puro This paper N/A (Continued on next page) Cell Reports 44, 116407, October 28, 2025 17 .. 6- to 8-week-old BALB/cJGpt female mice were sourced from Gempharmatech-GD.

    Recombinant:

    Article Title: Structure and function of a pair of non-competing monoclonal antibodies against Langya henipavirus attachment glycoprotein.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LayG-1133 GASDALIE This paper N/A Bacterial and virus strains E. coli DH5α TransGen Biotech CD201-02 Biological samples Serum and spleen from mice This paper N/A Chemicals, peptides, and recombinant proteins Dulbecco’s Modified Eagle Medium Gibco Cat# 11965092 FreeStyle 293 expression medium Gibco Cat# 12338026 Fetal bovine serum ExCell Bio Cat# FSP500 RPMI 1640, GlutaMAX Gibco Cat# 61870127 Penicillin-Streptomycin (10,000 U/mL) Gibco Cat# 15140163 HEPES (1M) Buffer Solution Gibco Cat# 15630080 Opti-MEM Reduced Serum Medium Gibco Cat# 51985034 Polyethylenimines (PEIs) 25K PolySciences Cat# 23966 SuperSignal West Pico PLUS Thermo Scientific Cat# 34577 Ni-NTA Agarose QIAGEN Cat# 30210 Trypsin-EDTA (0.25%) GIBCO Cat# 25200072 Superose 6, 10/300 G GE Healthcare Cat#17-5172-01 Trizma base Sigma-Aldrich Cat# 77-86-1 Imidazole Sangon Biotech Cat# B540146-0100 EZ Trans Life-iLab Cat# AC04L092 Ampicillin Amresco Cat# 69-52-3 Acetate 5.0 Cytiva Cat# BR100351 Glycine 1.5 Cytiva Cat# BR100354 Glycine 2.0 Cytiva Cat# BR100355 HBS-EP+ Buffer 10× Cytiva Cat# BR100669 LayV-G ECD with C-terminal His and FLAG tag This paper N/A LayV-G Head with C-terminal His and FLAG tag This paper N/A LayV-G Stalk with C-terminal His and FLAG tag This paper N/A MojV-G ECD with C-terminal His tag This paper N/A HeV-G ECD with C-terminal His tag This paper N/A NiV M -G ECD with C-terminal His tag This paper N/A DAPI (4 ′ ,6-diamidino-2-phenylindole, dihydrochloride) Beyotime Cat# C1002 5× SDS loading buffer with DTT Solarbio Cat# P1040 Native Gel Sample Loading Buffer, 5× Beyotime Cat# P0016N Glycoprotein Denaturing Buffer New England Biolabs Cat# B1704SVIAL LIVE/DEAD Fixable Dead Cell Stain reagent Invitrogen Cat# L34968 Aliphatic amine latex beads Invitrogen Cat# A37362 pHrodo Red, SE Invitrogen Cat# P36600 CellTrace CFSE Invitrogen Cat# C34554 Ni-NTA affinity resin Sigma-Aldrich Cat# 70666 0.5 M EDTA, pH 8.0 Invitrogen Cat# AM9260G Papain from papaya latex lyophilized powder Sigma-Aldrich Cat# P4762-1G Iodoacetamide Sigma-Aldrich Cat# I6125-25G L-Cysteine hydrochloride anhydrous Sigma-Aldrich Cat# 30120-50G 2 M H 2 SO 4 Sangon Biotech Cat# E661006-0500 Critical commercial assays Bright-Lite Luciferase Assay System Vazyme Biotech Cat# DD1204-03 TMB substrate Sangon Biotech Cat# E661007-0100 (Continued on next page) 16 Cell Reports 44, 116407, October 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Amine Coupling Kit Cytiva Cat# BR100050 Mut Express II Fast Mutagenesis Kit V2 Vazyme Biotech Cat# C214-01 NucleoBond Xtra Midi Plus Macherey-Nagel Cat# 740412.50 Immunol Staining Blocking Buffer Beyotime Cat# P0102 HRP Conjugation Kit Abcam Cat# ab102890 Deposited data LayV-G head protein in complex with Fabs of LayG-1069 and LayG-1133 This paper PDB: 9LEO EMDB: EMD-63031 Langya Henipavirus attachment protein Guo et al. 18 PDB:8ZJB EMDB: EMD-36741 Experimental models: Cell lines Jurkat-FcγRIIIa-V158 reporter cells Vazyme Biotech Cat# DD1301 Jurkat-FcγRIIa-R131 reporter cells Vazyme Biotech Cat# DD1305 Human: HEK293F Gibco Cat# R79007 Human: HEK293T ATCC Cat# CRL-3216 Human: THP-1 ATCC Cat# TIB-202 Hamster: CHO Cellcook Biotech Cat# CC9510 Experimental models: Organisms/strains Mouse: BALB/cJGpt mice, Female Gempharmatech-GD Cat# N000020-11 Oligonucleotides Primer: L234AL235A-For: TGCTCCTGAAGCA GCAGGCGGCCCTAGCGTGTTC This paper N/A Primer: L234AL235A-Rev: CCTGCTGCTTCAG GAGCAGGACAAGGAGG This paper N/A Primer: P329G For: TGGGTGCCCCTATCGAGAAGACCA This paper N/A Primer: P329G-Rev: TCTCGATAGGGGCACCC AGGGCCTTGTTGGACACC This paper N/A Primer: Fc_GASDALIE_Site1-For: GCAGGCCCT GATGTGTTCCTGTTCCCACCTAAGC This paper N/A Primer: Fc_GASDALIE_Site1-Rev: AACACATCAG GGCCTGCCAGCAGTTCAGGAGCAGGA This paper N/A Primer: Fc_GASDALIE_Site2-For: CCTCTCCCTGA AGAGAAGACCATCTCCAAGGCTAAG This paper N/A Primer: Fc_GASDALIE_Site2-Rev: TTCTCTTCAG GGAGAGGCAGGGCCTTGTTGGA This paper N/A Recombinant DNA Plasmids: pCAGGS-LayV-G-T2A-GFP This paper N/A Plasmids: pCAGGS-MojV-G-T2A-GFP This paper N/A Plasmids: pCAGGS-SARS-CoV-2 WT spike-T2A-GFP This paper N/A Plasmids: pCAGGS-LayV-G This paper N/A Plasmids: pCAGGS-MojV-G This paper N/A Plasmids: pCAGGS This paper N/A Plasmids: pCAGGS-LayV-G ECD (Flag and His tag) This paper N/A Plasmids: pCAGGS-MojV-G ECD (His tag) This paper N/A Plasmids: pCAGGS-HeV-G ECD (His tag) This paper N/A Plasmids: pCAGGS-NiV M -G ECD (His tag) This paper N/A Plasmids: pCAGGS-LayV-G Head (Flag and His tag) This paper N/A Plasmids: pCAGGS-LayV-G Stalk (Flag and His tag) This paper N/A Plasmids: pCDH-CMV-LayV-G-EF1α-GFP-Puro This paper N/A Plasmids: pCDH-CMV-EF1α-GFP-Puro This paper N/A (Continued on next page) Cell Reports 44, 116407, October 28, 2025 17 .. 6- to 8-week-old BALB/cJGpt female mice were sourced from Gempharmatech-GD.

    Article Title: Genomic mediators of acquired resistance to immunotherapy in metastatic melanoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-SEC24C Thermo Fisher Scientific Cat# PA5-59101; RRID: AB_2647077 anti-SEC24D Bethyl Cat# A304-813A-T; RRID: AB_2621008 anti-GAPDH Cell Signaling Technology Cat# 3683; RRID: AB_1642205 HLA-A/B/C antibody BioLegend Cat# 311406; RRID: AB_314875 PE mouse IgG2a,k BD Bioscience Cat# 554648; RRID: AB_395491 anti- CD3/APC BioLegend Cat# 317318; RRID: AB_1937212 anti-CD8/APC-Cy7 BioLegend Cat# 344714; RRID: AB_2044006 anti- CD137/PE BioLegend Cat# 309803; RRID: AB_314782 Anti-CD8 (Clone: 4B11) Leica Cat# NCL-CD8-4B11; RRID: AB_442068 Anti-PD-L1 (Clone: E1L3N) Cell Signaling Technology Cat# 13684; RRID: AB_2687655 Anti-FOXP3 (Clone: D2W8E) Cell Signaling Technology Cat# 98377; RRID: AB_2747370 Anti-PD-1 (Clone: EPR4877(2) Abcam Cat# ab137132; RRID: AB_2894867 Anti-CD11c (Clone: D3V1E) Cell Signaling Technology Cat# 45581; RRID: AB_2799286 Anti-CD4 (Clone: EPR6855) Abcam Cat# ab133616; RRID: AB_2750883 Anti-CD20 (Clone: L26) Dako Cat# GA60461-2 Anti-CD3 Dako Cat# GA50361-2 Anti-CD68 (Clone: D4B9C) Cell Signaling Technology Cat# 97778; RRID: AB_2928056 Anti-SOX10 (Clone: EP268) Epitomics Cat# AC-0237; RRID: AB_2941085 Bacterial and virus strains One Shot Stbl3 Chemically Competent E. coli Invitrogen Cat# C737303 Biological samples Patient tumor samples Dana Farber Cancer Institute See Table S1 Patient tumor samples Vanderbilt University Medical Center See Table S1 Chemicals, peptides, and recombinant proteins ADU-S100 STING agonist Chemietek Cat# CT-ADUS100 Poly(dA:dT) naked (synthetic double-stranded DNA) InVivoGen Cat# tlrl-patn CellTrace Violet Stain Invitrogen Cat# C34557A Live/Dead Green Fixable Green Dead Cell Stain Invitrogen Cat# L34970A PMA Sigma-Aldrich Cat# P1585 Ionomycin Sigma-Aldrich Cat# 200-664-3 Interleukin-7 human Sigma-Aldrich Cat# I5896 Interleukin-15 human Sigma-Aldrich Cat# I8648 TRIzol Invitrogen Cat# 15596018 Pure Ethanol 190 Proof Decon Labs Inc. Cat# UN1170 Isopropanol Fisher Bioreagents Cat# BP2618-1 Chloroform ChemCruz Cat# sc-239527A 2-Mercaptoethanol Sigma Cat# M6250 4x Laemmli Sample Buffer BioRad Cat# 1610747 Fetal Bovine Serum Gemini Bio Cat#100-106-500 penicillin-streptomycin antibiotics Life Technologies Cat#15140122 Puromycin selection antibiotic InVivoGen Cat# ant-pr-1 Blasticidin selection antibiotic InVivoGen Cat# ant-bl-1 (Continued on next page) Cancer Cell 43, 308–316.e1–e6, February 10, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Bovine Serum Albumin Boston BioProducts Cat# C-11070D Polybrene Santa Cruz Cat# SC-134220 Critical commercial assays PCR Mycoplasma Detection Kit Applied Biological Materials Inc. Cat# G238 iTaq Universal SYBR Green One-Step kit Bio-Rad Cat# 1725150 Deposited data Raw sequence data This paper dbGaP phs000452.v5 Experimental models: Cell lines Human: WM266.4 Cory Johannessen from Broad Institute of Harvard and MIT N/A Human: THP-1 ATCC Cat# TIB-202 Human: HEK 293T Lenti-X cells Takara Cat# 632180 MLANA-specific HLA- A*02:01-restricted TCR Oliveira, G. et al.36 N/A Oligonucleotides sgRNA: targeting human ROSA26: ACAGCAAGTTGTCTAACCCG Eton Biosciences N/A sgRNA #1: targeting human SEC24C: AAGAGCCCCACCTTCCTCGG Eton Biosciences N/A sgRNA #2: targeting human SEC24C CTGTGGGCAACCAGCCACCT Eton Biosciences N/A sgRNA: targeting human SEC24D: TTTATGCAGTTCATCGAAGG Eton Biosciences N/A qPCR Primer: human SEC24C Forward (5’-3’): TACGGGCACAGAGATCCCGG Reverse (5’-3’): GCTTACCGGATCCGCCACCA Eton Biosciences N/A qPCR Primer: human ACTB Forward (5’-3’): GTTGTCGACGACGAGCG Reverse (5’-3’): GCACAGAGCCTCGCCTT Eton Biosciences N/A qPCR Primer: human IFNB1 Forward (5’-3’): TTGTTGAGAACCTCCTGGCT Reverse (5’-3’): TGACTATGGTCCAGGCACAG Eton Biosciences N/A qPCR Primer: human CXCL10 Forward (5’-3’): CCACGTGTTGAGATCATTGCT Reverse (5’-3’): TGCATCGATTTTGCTCCCCT Eton Biosciences N/A Mutagenesis Primer: human SEC24C G220C: Forward: TTCAGGGTGTCCTCGGCTGCC Reverse: CCGAGGACACCCTGAAGCTG Eton Biosciences N/A Mutagenesis Primer: human SEC24C S107F: Forward: GGGTTTCAGCCATTTGGGTCC Reverse: AAATGGCTGGGACCCAGGCA Eton Biosciences N/A Recombinant DNA Plasmid: lentiCRISPR v2 Addgene Cat# 52961 Plasmid: pENTR-SEC24C Twist Bioscience N/A Plasmid: PAX2 viral packaging vector Addgene Cat#12260 Plasmid: pMD2.G viral packaging plasmid Addgene Cat#12259 Software and algorithms FlowJo FlowJo LLC v10.8.1 PRISM GraphPad v10 (Continued on next page) e2 Cancer Cell 43, 308–316.e1–e6, February 10, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER The Getz Lab CGA WES Characterization pipeline employs the following tools: MuTect,37 ContEst,38 Strelka,39 Orientation Bias Filter,40 DeTiN,41 AllelicCapSeg,42 MAFPoNFilter,43 ABSOLUTE,44 GATK,45 and Oncotator.46 Broad Institute https://portal.firecloud.org/#methods/ getzlab/CGA_WES_Characterization_ Pipeline_v0.1_Dec2018/ CoMut Crowdis et al.47 https://github.com/vanallenlab/comut GISTIC2.0 Mermal et al.48 https://github.com/broadinstitute/gistic2 deconstructSigs Rosenthal et al.49 https://github.com/raerose01/deconstructSigs PhylogicNDT Leshchiner et al.50 https://github.com/broadinstitute/PhylogicNDT Calculate mutational burden https://github.com/brendanreardon/ calculate_mutational_burden Integrative Genomics Viewer Robinson et al.51 https://github.com/igvteam/igv CADD Kircher et al.52 https://github.com/kircherlab/CADD-scripts Polyphen-2 HumDiv Adzhubei et al.53 http://genetics.bwh.harvard.edu/pph2 Other TransIT-LT1 Transfection Reagent Mirus Bio LLC Cat# MIR 2300 In-Fusion HD Cloning Kit Takara Bio Cat# 639650 MultiSite Gateway Cloning kit ThermoFisher Cat#12538120 iTaq Universal SYBR Green One-Step kit Bio-Rad Cat# 1725151 RIPA lysis buffer Boston Bioproducts Cat# BP-115 cOmplete Mini protease inhibitor Roche Cat# 11836153001 Phospho-STOP phosphatase inhibitor Roche Cat# 4906845001 BCA Protein Assay Kit Thermo Scientific Cat# 23224/23228 4-20% Criterion TGX Stain- Free Precast Gels BioRad Cat# 5678095 Trans- Blot Turbo BioRad Cat# 1704271 Tris Buffered Saline Tween Boston Bioproducts Cat# IBB-180X ECL Western Blotting Substrate Pierce Cat# 32106 CellTrace Violet Stain Invitrogen Cat# C34557A Live/Dead Green Invitrogen Cat# L34970A Tris Glycine-SDS Running Buffer Boston BioProducts Cat# BP-150 Plasmid Plus Mini Kit QIAGEN Cat# 27106 Plasmid Plus Midi Kit QIAGEN Cat# 12945 DMEM, high glucose Gibco Cat# 11965092 RPMI 1640 Medium Gibco Cat# 11875093 Trypsin-EDTA (0.05%), phenol red Gibco Cat# 25300054 LB Broth Lennox Cat# P-830 LB Agar Lennox Cat# P-820 Dry Milk Powder Research Products International Cat# M17200-1000.0 Opti-MEM I Reduced Serum Medium Gibco Cat# 31985070 PBS, pH 7.4 Gibco Cat# 10010023 12 Well Tissue Culture Plate, Sterile CellTreat Scientific Products Cat# 229111 6 Well Tissue Culture Plate, Sterile CellTreat Scientific Products Cat# 229105 96 Well Tissue Culture Plate, Sterile – Flat bottom CellTreat Scientific Products Cat# 229195 96 Well Tissue Culture Plate, Sterile – Round bottom CellTreat Scientific Products Cat# 229590 24 Well Tissue Culture Plate Corning Incorporated Cat# 3526

    Polymerase Chain Reaction:

    Article Title: Genomic mediators of acquired resistance to immunotherapy in metastatic melanoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-SEC24C Thermo Fisher Scientific Cat# PA5-59101; RRID: AB_2647077 anti-SEC24D Bethyl Cat# A304-813A-T; RRID: AB_2621008 anti-GAPDH Cell Signaling Technology Cat# 3683; RRID: AB_1642205 HLA-A/B/C antibody BioLegend Cat# 311406; RRID: AB_314875 PE mouse IgG2a,k BD Bioscience Cat# 554648; RRID: AB_395491 anti- CD3/APC BioLegend Cat# 317318; RRID: AB_1937212 anti-CD8/APC-Cy7 BioLegend Cat# 344714; RRID: AB_2044006 anti- CD137/PE BioLegend Cat# 309803; RRID: AB_314782 Anti-CD8 (Clone: 4B11) Leica Cat# NCL-CD8-4B11; RRID: AB_442068 Anti-PD-L1 (Clone: E1L3N) Cell Signaling Technology Cat# 13684; RRID: AB_2687655 Anti-FOXP3 (Clone: D2W8E) Cell Signaling Technology Cat# 98377; RRID: AB_2747370 Anti-PD-1 (Clone: EPR4877(2) Abcam Cat# ab137132; RRID: AB_2894867 Anti-CD11c (Clone: D3V1E) Cell Signaling Technology Cat# 45581; RRID: AB_2799286 Anti-CD4 (Clone: EPR6855) Abcam Cat# ab133616; RRID: AB_2750883 Anti-CD20 (Clone: L26) Dako Cat# GA60461-2 Anti-CD3 Dako Cat# GA50361-2 Anti-CD68 (Clone: D4B9C) Cell Signaling Technology Cat# 97778; RRID: AB_2928056 Anti-SOX10 (Clone: EP268) Epitomics Cat# AC-0237; RRID: AB_2941085 Bacterial and virus strains One Shot Stbl3 Chemically Competent E. coli Invitrogen Cat# C737303 Biological samples Patient tumor samples Dana Farber Cancer Institute See Table S1 Patient tumor samples Vanderbilt University Medical Center See Table S1 Chemicals, peptides, and recombinant proteins ADU-S100 STING agonist Chemietek Cat# CT-ADUS100 Poly(dA:dT) naked (synthetic double-stranded DNA) InVivoGen Cat# tlrl-patn CellTrace Violet Stain Invitrogen Cat# C34557A Live/Dead Green Fixable Green Dead Cell Stain Invitrogen Cat# L34970A PMA Sigma-Aldrich Cat# P1585 Ionomycin Sigma-Aldrich Cat# 200-664-3 Interleukin-7 human Sigma-Aldrich Cat# I5896 Interleukin-15 human Sigma-Aldrich Cat# I8648 TRIzol Invitrogen Cat# 15596018 Pure Ethanol 190 Proof Decon Labs Inc. Cat# UN1170 Isopropanol Fisher Bioreagents Cat# BP2618-1 Chloroform ChemCruz Cat# sc-239527A 2-Mercaptoethanol Sigma Cat# M6250 4x Laemmli Sample Buffer BioRad Cat# 1610747 Fetal Bovine Serum Gemini Bio Cat#100-106-500 penicillin-streptomycin antibiotics Life Technologies Cat#15140122 Puromycin selection antibiotic InVivoGen Cat# ant-pr-1 Blasticidin selection antibiotic InVivoGen Cat# ant-bl-1 (Continued on next page) Cancer Cell 43, 308–316.e1–e6, February 10, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Bovine Serum Albumin Boston BioProducts Cat# C-11070D Polybrene Santa Cruz Cat# SC-134220 Critical commercial assays PCR Mycoplasma Detection Kit Applied Biological Materials Inc. Cat# G238 iTaq Universal SYBR Green One-Step kit Bio-Rad Cat# 1725150 Deposited data Raw sequence data This paper dbGaP phs000452.v5 Experimental models: Cell lines Human: WM266.4 Cory Johannessen from Broad Institute of Harvard and MIT N/A Human: THP-1 ATCC Cat# TIB-202 Human: HEK 293T Lenti-X cells Takara Cat# 632180 MLANA-specific HLA- A*02:01-restricted TCR Oliveira, G. et al.36 N/A Oligonucleotides sgRNA: targeting human ROSA26: ACAGCAAGTTGTCTAACCCG Eton Biosciences N/A sgRNA #1: targeting human SEC24C: AAGAGCCCCACCTTCCTCGG Eton Biosciences N/A sgRNA #2: targeting human SEC24C CTGTGGGCAACCAGCCACCT Eton Biosciences N/A sgRNA: targeting human SEC24D: TTTATGCAGTTCATCGAAGG Eton Biosciences N/A qPCR Primer: human SEC24C Forward (5’-3’): TACGGGCACAGAGATCCCGG Reverse (5’-3’): GCTTACCGGATCCGCCACCA Eton Biosciences N/A qPCR Primer: human ACTB Forward (5’-3’): GTTGTCGACGACGAGCG Reverse (5’-3’): GCACAGAGCCTCGCCTT Eton Biosciences N/A qPCR Primer: human IFNB1 Forward (5’-3’): TTGTTGAGAACCTCCTGGCT Reverse (5’-3’): TGACTATGGTCCAGGCACAG Eton Biosciences N/A qPCR Primer: human CXCL10 Forward (5’-3’): CCACGTGTTGAGATCATTGCT Reverse (5’-3’): TGCATCGATTTTGCTCCCCT Eton Biosciences N/A Mutagenesis Primer: human SEC24C G220C: Forward: TTCAGGGTGTCCTCGGCTGCC Reverse: CCGAGGACACCCTGAAGCTG Eton Biosciences N/A Mutagenesis Primer: human SEC24C S107F: Forward: GGGTTTCAGCCATTTGGGTCC Reverse: AAATGGCTGGGACCCAGGCA Eton Biosciences N/A Recombinant DNA Plasmid: lentiCRISPR v2 Addgene Cat# 52961 Plasmid: pENTR-SEC24C Twist Bioscience N/A Plasmid: PAX2 viral packaging vector Addgene Cat#12260 Plasmid: pMD2.G viral packaging plasmid Addgene Cat#12259 Software and algorithms FlowJo FlowJo LLC v10.8.1 PRISM GraphPad v10 (Continued on next page) e2 Cancer Cell 43, 308–316.e1–e6, February 10, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER The Getz Lab CGA WES Characterization pipeline employs the following tools: MuTect,37 ContEst,38 Strelka,39 Orientation Bias Filter,40 DeTiN,41 AllelicCapSeg,42 MAFPoNFilter,43 ABSOLUTE,44 GATK,45 and Oncotator.46 Broad Institute https://portal.firecloud.org/#methods/ getzlab/CGA_WES_Characterization_ Pipeline_v0.1_Dec2018/ CoMut Crowdis et al.47 https://github.com/vanallenlab/comut GISTIC2.0 Mermal et al.48 https://github.com/broadinstitute/gistic2 deconstructSigs Rosenthal et al.49 https://github.com/raerose01/deconstructSigs PhylogicNDT Leshchiner et al.50 https://github.com/broadinstitute/PhylogicNDT Calculate mutational burden https://github.com/brendanreardon/ calculate_mutational_burden Integrative Genomics Viewer Robinson et al.51 https://github.com/igvteam/igv CADD Kircher et al.52 https://github.com/kircherlab/CADD-scripts Polyphen-2 HumDiv Adzhubei et al.53 http://genetics.bwh.harvard.edu/pph2 Other TransIT-LT1 Transfection Reagent Mirus Bio LLC Cat# MIR 2300 In-Fusion HD Cloning Kit Takara Bio Cat# 639650 MultiSite Gateway Cloning kit ThermoFisher Cat#12538120 iTaq Universal SYBR Green One-Step kit Bio-Rad Cat# 1725151 RIPA lysis buffer Boston Bioproducts Cat# BP-115 cOmplete Mini protease inhibitor Roche Cat# 11836153001 Phospho-STOP phosphatase inhibitor Roche Cat# 4906845001 BCA Protein Assay Kit Thermo Scientific Cat# 23224/23228 4-20% Criterion TGX Stain- Free Precast Gels BioRad Cat# 5678095 Trans- Blot Turbo BioRad Cat# 1704271 Tris Buffered Saline Tween Boston Bioproducts Cat# IBB-180X ECL Western Blotting Substrate Pierce Cat# 32106 CellTrace Violet Stain Invitrogen Cat# C34557A Live/Dead Green Invitrogen Cat# L34970A Tris Glycine-SDS Running Buffer Boston BioProducts Cat# BP-150 Plasmid Plus Mini Kit QIAGEN Cat# 27106 Plasmid Plus Midi Kit QIAGEN Cat# 12945 DMEM, high glucose Gibco Cat# 11965092 RPMI 1640 Medium Gibco Cat# 11875093 Trypsin-EDTA (0.05%), phenol red Gibco Cat# 25300054 LB Broth Lennox Cat# P-830 LB Agar Lennox Cat# P-820 Dry Milk Powder Research Products International Cat# M17200-1000.0 Opti-MEM I Reduced Serum Medium Gibco Cat# 31985070 PBS, pH 7.4 Gibco Cat# 10010023 12 Well Tissue Culture Plate, Sterile CellTreat Scientific Products Cat# 229111 6 Well Tissue Culture Plate, Sterile CellTreat Scientific Products Cat# 229105 96 Well Tissue Culture Plate, Sterile – Flat bottom CellTreat Scientific Products Cat# 229195 96 Well Tissue Culture Plate, Sterile – Round bottom CellTreat Scientific Products Cat# 229590 24 Well Tissue Culture Plate Corning Incorporated Cat# 3526

    SYBR Green Assay:

    Article Title: Genomic mediators of acquired resistance to immunotherapy in metastatic melanoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-SEC24C Thermo Fisher Scientific Cat# PA5-59101; RRID: AB_2647077 anti-SEC24D Bethyl Cat# A304-813A-T; RRID: AB_2621008 anti-GAPDH Cell Signaling Technology Cat# 3683; RRID: AB_1642205 HLA-A/B/C antibody BioLegend Cat# 311406; RRID: AB_314875 PE mouse IgG2a,k BD Bioscience Cat# 554648; RRID: AB_395491 anti- CD3/APC BioLegend Cat# 317318; RRID: AB_1937212 anti-CD8/APC-Cy7 BioLegend Cat# 344714; RRID: AB_2044006 anti- CD137/PE BioLegend Cat# 309803; RRID: AB_314782 Anti-CD8 (Clone: 4B11) Leica Cat# NCL-CD8-4B11; RRID: AB_442068 Anti-PD-L1 (Clone: E1L3N) Cell Signaling Technology Cat# 13684; RRID: AB_2687655 Anti-FOXP3 (Clone: D2W8E) Cell Signaling Technology Cat# 98377; RRID: AB_2747370 Anti-PD-1 (Clone: EPR4877(2) Abcam Cat# ab137132; RRID: AB_2894867 Anti-CD11c (Clone: D3V1E) Cell Signaling Technology Cat# 45581; RRID: AB_2799286 Anti-CD4 (Clone: EPR6855) Abcam Cat# ab133616; RRID: AB_2750883 Anti-CD20 (Clone: L26) Dako Cat# GA60461-2 Anti-CD3 Dako Cat# GA50361-2 Anti-CD68 (Clone: D4B9C) Cell Signaling Technology Cat# 97778; RRID: AB_2928056 Anti-SOX10 (Clone: EP268) Epitomics Cat# AC-0237; RRID: AB_2941085 Bacterial and virus strains One Shot Stbl3 Chemically Competent E. coli Invitrogen Cat# C737303 Biological samples Patient tumor samples Dana Farber Cancer Institute See Table S1 Patient tumor samples Vanderbilt University Medical Center See Table S1 Chemicals, peptides, and recombinant proteins ADU-S100 STING agonist Chemietek Cat# CT-ADUS100 Poly(dA:dT) naked (synthetic double-stranded DNA) InVivoGen Cat# tlrl-patn CellTrace Violet Stain Invitrogen Cat# C34557A Live/Dead Green Fixable Green Dead Cell Stain Invitrogen Cat# L34970A PMA Sigma-Aldrich Cat# P1585 Ionomycin Sigma-Aldrich Cat# 200-664-3 Interleukin-7 human Sigma-Aldrich Cat# I5896 Interleukin-15 human Sigma-Aldrich Cat# I8648 TRIzol Invitrogen Cat# 15596018 Pure Ethanol 190 Proof Decon Labs Inc. Cat# UN1170 Isopropanol Fisher Bioreagents Cat# BP2618-1 Chloroform ChemCruz Cat# sc-239527A 2-Mercaptoethanol Sigma Cat# M6250 4x Laemmli Sample Buffer BioRad Cat# 1610747 Fetal Bovine Serum Gemini Bio Cat#100-106-500 penicillin-streptomycin antibiotics Life Technologies Cat#15140122 Puromycin selection antibiotic InVivoGen Cat# ant-pr-1 Blasticidin selection antibiotic InVivoGen Cat# ant-bl-1 (Continued on next page) Cancer Cell 43, 308–316.e1–e6, February 10, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Bovine Serum Albumin Boston BioProducts Cat# C-11070D Polybrene Santa Cruz Cat# SC-134220 Critical commercial assays PCR Mycoplasma Detection Kit Applied Biological Materials Inc. Cat# G238 iTaq Universal SYBR Green One-Step kit Bio-Rad Cat# 1725150 Deposited data Raw sequence data This paper dbGaP phs000452.v5 Experimental models: Cell lines Human: WM266.4 Cory Johannessen from Broad Institute of Harvard and MIT N/A Human: THP-1 ATCC Cat# TIB-202 Human: HEK 293T Lenti-X cells Takara Cat# 632180 MLANA-specific HLA- A*02:01-restricted TCR Oliveira, G. et al.36 N/A Oligonucleotides sgRNA: targeting human ROSA26: ACAGCAAGTTGTCTAACCCG Eton Biosciences N/A sgRNA #1: targeting human SEC24C: AAGAGCCCCACCTTCCTCGG Eton Biosciences N/A sgRNA #2: targeting human SEC24C CTGTGGGCAACCAGCCACCT Eton Biosciences N/A sgRNA: targeting human SEC24D: TTTATGCAGTTCATCGAAGG Eton Biosciences N/A qPCR Primer: human SEC24C Forward (5’-3’): TACGGGCACAGAGATCCCGG Reverse (5’-3’): GCTTACCGGATCCGCCACCA Eton Biosciences N/A qPCR Primer: human ACTB Forward (5’-3’): GTTGTCGACGACGAGCG Reverse (5’-3’): GCACAGAGCCTCGCCTT Eton Biosciences N/A qPCR Primer: human IFNB1 Forward (5’-3’): TTGTTGAGAACCTCCTGGCT Reverse (5’-3’): TGACTATGGTCCAGGCACAG Eton Biosciences N/A qPCR Primer: human CXCL10 Forward (5’-3’): CCACGTGTTGAGATCATTGCT Reverse (5’-3’): TGCATCGATTTTGCTCCCCT Eton Biosciences N/A Mutagenesis Primer: human SEC24C G220C: Forward: TTCAGGGTGTCCTCGGCTGCC Reverse: CCGAGGACACCCTGAAGCTG Eton Biosciences N/A Mutagenesis Primer: human SEC24C S107F: Forward: GGGTTTCAGCCATTTGGGTCC Reverse: AAATGGCTGGGACCCAGGCA Eton Biosciences N/A Recombinant DNA Plasmid: lentiCRISPR v2 Addgene Cat# 52961 Plasmid: pENTR-SEC24C Twist Bioscience N/A Plasmid: PAX2 viral packaging vector Addgene Cat#12260 Plasmid: pMD2.G viral packaging plasmid Addgene Cat#12259 Software and algorithms FlowJo FlowJo LLC v10.8.1 PRISM GraphPad v10 (Continued on next page) e2 Cancer Cell 43, 308–316.e1–e6, February 10, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER The Getz Lab CGA WES Characterization pipeline employs the following tools: MuTect,37 ContEst,38 Strelka,39 Orientation Bias Filter,40 DeTiN,41 AllelicCapSeg,42 MAFPoNFilter,43 ABSOLUTE,44 GATK,45 and Oncotator.46 Broad Institute https://portal.firecloud.org/#methods/ getzlab/CGA_WES_Characterization_ Pipeline_v0.1_Dec2018/ CoMut Crowdis et al.47 https://github.com/vanallenlab/comut GISTIC2.0 Mermal et al.48 https://github.com/broadinstitute/gistic2 deconstructSigs Rosenthal et al.49 https://github.com/raerose01/deconstructSigs PhylogicNDT Leshchiner et al.50 https://github.com/broadinstitute/PhylogicNDT Calculate mutational burden https://github.com/brendanreardon/ calculate_mutational_burden Integrative Genomics Viewer Robinson et al.51 https://github.com/igvteam/igv CADD Kircher et al.52 https://github.com/kircherlab/CADD-scripts Polyphen-2 HumDiv Adzhubei et al.53 http://genetics.bwh.harvard.edu/pph2 Other TransIT-LT1 Transfection Reagent Mirus Bio LLC Cat# MIR 2300 In-Fusion HD Cloning Kit Takara Bio Cat# 639650 MultiSite Gateway Cloning kit ThermoFisher Cat#12538120 iTaq Universal SYBR Green One-Step kit Bio-Rad Cat# 1725151 RIPA lysis buffer Boston Bioproducts Cat# BP-115 cOmplete Mini protease inhibitor Roche Cat# 11836153001 Phospho-STOP phosphatase inhibitor Roche Cat# 4906845001 BCA Protein Assay Kit Thermo Scientific Cat# 23224/23228 4-20% Criterion TGX Stain- Free Precast Gels BioRad Cat# 5678095 Trans- Blot Turbo BioRad Cat# 1704271 Tris Buffered Saline Tween Boston Bioproducts Cat# IBB-180X ECL Western Blotting Substrate Pierce Cat# 32106 CellTrace Violet Stain Invitrogen Cat# C34557A Live/Dead Green Invitrogen Cat# L34970A Tris Glycine-SDS Running Buffer Boston BioProducts Cat# BP-150 Plasmid Plus Mini Kit QIAGEN Cat# 27106 Plasmid Plus Midi Kit QIAGEN Cat# 12945 DMEM, high glucose Gibco Cat# 11965092 RPMI 1640 Medium Gibco Cat# 11875093 Trypsin-EDTA (0.05%), phenol red Gibco Cat# 25300054 LB Broth Lennox Cat# P-830 LB Agar Lennox Cat# P-820 Dry Milk Powder Research Products International Cat# M17200-1000.0 Opti-MEM I Reduced Serum Medium Gibco Cat# 31985070 PBS, pH 7.4 Gibco Cat# 10010023 12 Well Tissue Culture Plate, Sterile CellTreat Scientific Products Cat# 229111 6 Well Tissue Culture Plate, Sterile CellTreat Scientific Products Cat# 229105 96 Well Tissue Culture Plate, Sterile – Flat bottom CellTreat Scientific Products Cat# 229195 96 Well Tissue Culture Plate, Sterile – Round bottom CellTreat Scientific Products Cat# 229590 24 Well Tissue Culture Plate Corning Incorporated Cat# 3526

    Sequencing:

    Article Title: Genomic mediators of acquired resistance to immunotherapy in metastatic melanoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-SEC24C Thermo Fisher Scientific Cat# PA5-59101; RRID: AB_2647077 anti-SEC24D Bethyl Cat# A304-813A-T; RRID: AB_2621008 anti-GAPDH Cell Signaling Technology Cat# 3683; RRID: AB_1642205 HLA-A/B/C antibody BioLegend Cat# 311406; RRID: AB_314875 PE mouse IgG2a,k BD Bioscience Cat# 554648; RRID: AB_395491 anti- CD3/APC BioLegend Cat# 317318; RRID: AB_1937212 anti-CD8/APC-Cy7 BioLegend Cat# 344714; RRID: AB_2044006 anti- CD137/PE BioLegend Cat# 309803; RRID: AB_314782 Anti-CD8 (Clone: 4B11) Leica Cat# NCL-CD8-4B11; RRID: AB_442068 Anti-PD-L1 (Clone: E1L3N) Cell Signaling Technology Cat# 13684; RRID: AB_2687655 Anti-FOXP3 (Clone: D2W8E) Cell Signaling Technology Cat# 98377; RRID: AB_2747370 Anti-PD-1 (Clone: EPR4877(2) Abcam Cat# ab137132; RRID: AB_2894867 Anti-CD11c (Clone: D3V1E) Cell Signaling Technology Cat# 45581; RRID: AB_2799286 Anti-CD4 (Clone: EPR6855) Abcam Cat# ab133616; RRID: AB_2750883 Anti-CD20 (Clone: L26) Dako Cat# GA60461-2 Anti-CD3 Dako Cat# GA50361-2 Anti-CD68 (Clone: D4B9C) Cell Signaling Technology Cat# 97778; RRID: AB_2928056 Anti-SOX10 (Clone: EP268) Epitomics Cat# AC-0237; RRID: AB_2941085 Bacterial and virus strains One Shot Stbl3 Chemically Competent E. coli Invitrogen Cat# C737303 Biological samples Patient tumor samples Dana Farber Cancer Institute See Table S1 Patient tumor samples Vanderbilt University Medical Center See Table S1 Chemicals, peptides, and recombinant proteins ADU-S100 STING agonist Chemietek Cat# CT-ADUS100 Poly(dA:dT) naked (synthetic double-stranded DNA) InVivoGen Cat# tlrl-patn CellTrace Violet Stain Invitrogen Cat# C34557A Live/Dead Green Fixable Green Dead Cell Stain Invitrogen Cat# L34970A PMA Sigma-Aldrich Cat# P1585 Ionomycin Sigma-Aldrich Cat# 200-664-3 Interleukin-7 human Sigma-Aldrich Cat# I5896 Interleukin-15 human Sigma-Aldrich Cat# I8648 TRIzol Invitrogen Cat# 15596018 Pure Ethanol 190 Proof Decon Labs Inc. Cat# UN1170 Isopropanol Fisher Bioreagents Cat# BP2618-1 Chloroform ChemCruz Cat# sc-239527A 2-Mercaptoethanol Sigma Cat# M6250 4x Laemmli Sample Buffer BioRad Cat# 1610747 Fetal Bovine Serum Gemini Bio Cat#100-106-500 penicillin-streptomycin antibiotics Life Technologies Cat#15140122 Puromycin selection antibiotic InVivoGen Cat# ant-pr-1 Blasticidin selection antibiotic InVivoGen Cat# ant-bl-1 (Continued on next page) Cancer Cell 43, 308–316.e1–e6, February 10, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Bovine Serum Albumin Boston BioProducts Cat# C-11070D Polybrene Santa Cruz Cat# SC-134220 Critical commercial assays PCR Mycoplasma Detection Kit Applied Biological Materials Inc. Cat# G238 iTaq Universal SYBR Green One-Step kit Bio-Rad Cat# 1725150 Deposited data Raw sequence data This paper dbGaP phs000452.v5 Experimental models: Cell lines Human: WM266.4 Cory Johannessen from Broad Institute of Harvard and MIT N/A Human: THP-1 ATCC Cat# TIB-202 Human: HEK 293T Lenti-X cells Takara Cat# 632180 MLANA-specific HLA- A*02:01-restricted TCR Oliveira, G. et al.36 N/A Oligonucleotides sgRNA: targeting human ROSA26: ACAGCAAGTTGTCTAACCCG Eton Biosciences N/A sgRNA #1: targeting human SEC24C: AAGAGCCCCACCTTCCTCGG Eton Biosciences N/A sgRNA #2: targeting human SEC24C CTGTGGGCAACCAGCCACCT Eton Biosciences N/A sgRNA: targeting human SEC24D: TTTATGCAGTTCATCGAAGG Eton Biosciences N/A qPCR Primer: human SEC24C Forward (5’-3’): TACGGGCACAGAGATCCCGG Reverse (5’-3’): GCTTACCGGATCCGCCACCA Eton Biosciences N/A qPCR Primer: human ACTB Forward (5’-3’): GTTGTCGACGACGAGCG Reverse (5’-3’): GCACAGAGCCTCGCCTT Eton Biosciences N/A qPCR Primer: human IFNB1 Forward (5’-3’): TTGTTGAGAACCTCCTGGCT Reverse (5’-3’): TGACTATGGTCCAGGCACAG Eton Biosciences N/A qPCR Primer: human CXCL10 Forward (5’-3’): CCACGTGTTGAGATCATTGCT Reverse (5’-3’): TGCATCGATTTTGCTCCCCT Eton Biosciences N/A Mutagenesis Primer: human SEC24C G220C: Forward: TTCAGGGTGTCCTCGGCTGCC Reverse: CCGAGGACACCCTGAAGCTG Eton Biosciences N/A Mutagenesis Primer: human SEC24C S107F: Forward: GGGTTTCAGCCATTTGGGTCC Reverse: AAATGGCTGGGACCCAGGCA Eton Biosciences N/A Recombinant DNA Plasmid: lentiCRISPR v2 Addgene Cat# 52961 Plasmid: pENTR-SEC24C Twist Bioscience N/A Plasmid: PAX2 viral packaging vector Addgene Cat#12260 Plasmid: pMD2.G viral packaging plasmid Addgene Cat#12259 Software and algorithms FlowJo FlowJo LLC v10.8.1 PRISM GraphPad v10 (Continued on next page) e2 Cancer Cell 43, 308–316.e1–e6, February 10, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER The Getz Lab CGA WES Characterization pipeline employs the following tools: MuTect,37 ContEst,38 Strelka,39 Orientation Bias Filter,40 DeTiN,41 AllelicCapSeg,42 MAFPoNFilter,43 ABSOLUTE,44 GATK,45 and Oncotator.46 Broad Institute https://portal.firecloud.org/#methods/ getzlab/CGA_WES_Characterization_ Pipeline_v0.1_Dec2018/ CoMut Crowdis et al.47 https://github.com/vanallenlab/comut GISTIC2.0 Mermal et al.48 https://github.com/broadinstitute/gistic2 deconstructSigs Rosenthal et al.49 https://github.com/raerose01/deconstructSigs PhylogicNDT Leshchiner et al.50 https://github.com/broadinstitute/PhylogicNDT Calculate mutational burden https://github.com/brendanreardon/ calculate_mutational_burden Integrative Genomics Viewer Robinson et al.51 https://github.com/igvteam/igv CADD Kircher et al.52 https://github.com/kircherlab/CADD-scripts Polyphen-2 HumDiv Adzhubei et al.53 http://genetics.bwh.harvard.edu/pph2 Other TransIT-LT1 Transfection Reagent Mirus Bio LLC Cat# MIR 2300 In-Fusion HD Cloning Kit Takara Bio Cat# 639650 MultiSite Gateway Cloning kit ThermoFisher Cat#12538120 iTaq Universal SYBR Green One-Step kit Bio-Rad Cat# 1725151 RIPA lysis buffer Boston Bioproducts Cat# BP-115 cOmplete Mini protease inhibitor Roche Cat# 11836153001 Phospho-STOP phosphatase inhibitor Roche Cat# 4906845001 BCA Protein Assay Kit Thermo Scientific Cat# 23224/23228 4-20% Criterion TGX Stain- Free Precast Gels BioRad Cat# 5678095 Trans- Blot Turbo BioRad Cat# 1704271 Tris Buffered Saline Tween Boston Bioproducts Cat# IBB-180X ECL Western Blotting Substrate Pierce Cat# 32106 CellTrace Violet Stain Invitrogen Cat# C34557A Live/Dead Green Invitrogen Cat# L34970A Tris Glycine-SDS Running Buffer Boston BioProducts Cat# BP-150 Plasmid Plus Mini Kit QIAGEN Cat# 27106 Plasmid Plus Midi Kit QIAGEN Cat# 12945 DMEM, high glucose Gibco Cat# 11965092 RPMI 1640 Medium Gibco Cat# 11875093 Trypsin-EDTA (0.05%), phenol red Gibco Cat# 25300054 LB Broth Lennox Cat# P-830 LB Agar Lennox Cat# P-820 Dry Milk Powder Research Products International Cat# M17200-1000.0 Opti-MEM I Reduced Serum Medium Gibco Cat# 31985070 PBS, pH 7.4 Gibco Cat# 10010023 12 Well Tissue Culture Plate, Sterile CellTreat Scientific Products Cat# 229111 6 Well Tissue Culture Plate, Sterile CellTreat Scientific Products Cat# 229105 96 Well Tissue Culture Plate, Sterile – Flat bottom CellTreat Scientific Products Cat# 229195 96 Well Tissue Culture Plate, Sterile – Round bottom CellTreat Scientific Products Cat# 229590 24 Well Tissue Culture Plate Corning Incorporated Cat# 3526

    Real-time Polymerase Chain Reaction:

    Article Title: Genomic mediators of acquired resistance to immunotherapy in metastatic melanoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-SEC24C Thermo Fisher Scientific Cat# PA5-59101; RRID: AB_2647077 anti-SEC24D Bethyl Cat# A304-813A-T; RRID: AB_2621008 anti-GAPDH Cell Signaling Technology Cat# 3683; RRID: AB_1642205 HLA-A/B/C antibody BioLegend Cat# 311406; RRID: AB_314875 PE mouse IgG2a,k BD Bioscience Cat# 554648; RRID: AB_395491 anti- CD3/APC BioLegend Cat# 317318; RRID: AB_1937212 anti-CD8/APC-Cy7 BioLegend Cat# 344714; RRID: AB_2044006 anti- CD137/PE BioLegend Cat# 309803; RRID: AB_314782 Anti-CD8 (Clone: 4B11) Leica Cat# NCL-CD8-4B11; RRID: AB_442068 Anti-PD-L1 (Clone: E1L3N) Cell Signaling Technology Cat# 13684; RRID: AB_2687655 Anti-FOXP3 (Clone: D2W8E) Cell Signaling Technology Cat# 98377; RRID: AB_2747370 Anti-PD-1 (Clone: EPR4877(2) Abcam Cat# ab137132; RRID: AB_2894867 Anti-CD11c (Clone: D3V1E) Cell Signaling Technology Cat# 45581; RRID: AB_2799286 Anti-CD4 (Clone: EPR6855) Abcam Cat# ab133616; RRID: AB_2750883 Anti-CD20 (Clone: L26) Dako Cat# GA60461-2 Anti-CD3 Dako Cat# GA50361-2 Anti-CD68 (Clone: D4B9C) Cell Signaling Technology Cat# 97778; RRID: AB_2928056 Anti-SOX10 (Clone: EP268) Epitomics Cat# AC-0237; RRID: AB_2941085 Bacterial and virus strains One Shot Stbl3 Chemically Competent E. coli Invitrogen Cat# C737303 Biological samples Patient tumor samples Dana Farber Cancer Institute See Table S1 Patient tumor samples Vanderbilt University Medical Center See Table S1 Chemicals, peptides, and recombinant proteins ADU-S100 STING agonist Chemietek Cat# CT-ADUS100 Poly(dA:dT) naked (synthetic double-stranded DNA) InVivoGen Cat# tlrl-patn CellTrace Violet Stain Invitrogen Cat# C34557A Live/Dead Green Fixable Green Dead Cell Stain Invitrogen Cat# L34970A PMA Sigma-Aldrich Cat# P1585 Ionomycin Sigma-Aldrich Cat# 200-664-3 Interleukin-7 human Sigma-Aldrich Cat# I5896 Interleukin-15 human Sigma-Aldrich Cat# I8648 TRIzol Invitrogen Cat# 15596018 Pure Ethanol 190 Proof Decon Labs Inc. Cat# UN1170 Isopropanol Fisher Bioreagents Cat# BP2618-1 Chloroform ChemCruz Cat# sc-239527A 2-Mercaptoethanol Sigma Cat# M6250 4x Laemmli Sample Buffer BioRad Cat# 1610747 Fetal Bovine Serum Gemini Bio Cat#100-106-500 penicillin-streptomycin antibiotics Life Technologies Cat#15140122 Puromycin selection antibiotic InVivoGen Cat# ant-pr-1 Blasticidin selection antibiotic InVivoGen Cat# ant-bl-1 (Continued on next page) Cancer Cell 43, 308–316.e1–e6, February 10, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Bovine Serum Albumin Boston BioProducts Cat# C-11070D Polybrene Santa Cruz Cat# SC-134220 Critical commercial assays PCR Mycoplasma Detection Kit Applied Biological Materials Inc. Cat# G238 iTaq Universal SYBR Green One-Step kit Bio-Rad Cat# 1725150 Deposited data Raw sequence data This paper dbGaP phs000452.v5 Experimental models: Cell lines Human: WM266.4 Cory Johannessen from Broad Institute of Harvard and MIT N/A Human: THP-1 ATCC Cat# TIB-202 Human: HEK 293T Lenti-X cells Takara Cat# 632180 MLANA-specific HLA- A*02:01-restricted TCR Oliveira, G. et al.36 N/A Oligonucleotides sgRNA: targeting human ROSA26: ACAGCAAGTTGTCTAACCCG Eton Biosciences N/A sgRNA #1: targeting human SEC24C: AAGAGCCCCACCTTCCTCGG Eton Biosciences N/A sgRNA #2: targeting human SEC24C CTGTGGGCAACCAGCCACCT Eton Biosciences N/A sgRNA: targeting human SEC24D: TTTATGCAGTTCATCGAAGG Eton Biosciences N/A qPCR Primer: human SEC24C Forward (5’-3’): TACGGGCACAGAGATCCCGG Reverse (5’-3’): GCTTACCGGATCCGCCACCA Eton Biosciences N/A qPCR Primer: human ACTB Forward (5’-3’): GTTGTCGACGACGAGCG Reverse (5’-3’): GCACAGAGCCTCGCCTT Eton Biosciences N/A qPCR Primer: human IFNB1 Forward (5’-3’): TTGTTGAGAACCTCCTGGCT Reverse (5’-3’): TGACTATGGTCCAGGCACAG Eton Biosciences N/A qPCR Primer: human CXCL10 Forward (5’-3’): CCACGTGTTGAGATCATTGCT Reverse (5’-3’): TGCATCGATTTTGCTCCCCT Eton Biosciences N/A Mutagenesis Primer: human SEC24C G220C: Forward: TTCAGGGTGTCCTCGGCTGCC Reverse: CCGAGGACACCCTGAAGCTG Eton Biosciences N/A Mutagenesis Primer: human SEC24C S107F: Forward: GGGTTTCAGCCATTTGGGTCC Reverse: AAATGGCTGGGACCCAGGCA Eton Biosciences N/A Recombinant DNA Plasmid: lentiCRISPR v2 Addgene Cat# 52961 Plasmid: pENTR-SEC24C Twist Bioscience N/A Plasmid: PAX2 viral packaging vector Addgene Cat#12260 Plasmid: pMD2.G viral packaging plasmid Addgene Cat#12259 Software and algorithms FlowJo FlowJo LLC v10.8.1 PRISM GraphPad v10 (Continued on next page) e2 Cancer Cell 43, 308–316.e1–e6, February 10, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER The Getz Lab CGA WES Characterization pipeline employs the following tools: MuTect,37 ContEst,38 Strelka,39 Orientation Bias Filter,40 DeTiN,41 AllelicCapSeg,42 MAFPoNFilter,43 ABSOLUTE,44 GATK,45 and Oncotator.46 Broad Institute https://portal.firecloud.org/#methods/ getzlab/CGA_WES_Characterization_ Pipeline_v0.1_Dec2018/ CoMut Crowdis et al.47 https://github.com/vanallenlab/comut GISTIC2.0 Mermal et al.48 https://github.com/broadinstitute/gistic2 deconstructSigs Rosenthal et al.49 https://github.com/raerose01/deconstructSigs PhylogicNDT Leshchiner et al.50 https://github.com/broadinstitute/PhylogicNDT Calculate mutational burden https://github.com/brendanreardon/ calculate_mutational_burden Integrative Genomics Viewer Robinson et al.51 https://github.com/igvteam/igv CADD Kircher et al.52 https://github.com/kircherlab/CADD-scripts Polyphen-2 HumDiv Adzhubei et al.53 http://genetics.bwh.harvard.edu/pph2 Other TransIT-LT1 Transfection Reagent Mirus Bio LLC Cat# MIR 2300 In-Fusion HD Cloning Kit Takara Bio Cat# 639650 MultiSite Gateway Cloning kit ThermoFisher Cat#12538120 iTaq Universal SYBR Green One-Step kit Bio-Rad Cat# 1725151 RIPA lysis buffer Boston Bioproducts Cat# BP-115 cOmplete Mini protease inhibitor Roche Cat# 11836153001 Phospho-STOP phosphatase inhibitor Roche Cat# 4906845001 BCA Protein Assay Kit Thermo Scientific Cat# 23224/23228 4-20% Criterion TGX Stain- Free Precast Gels BioRad Cat# 5678095 Trans- Blot Turbo BioRad Cat# 1704271 Tris Buffered Saline Tween Boston Bioproducts Cat# IBB-180X ECL Western Blotting Substrate Pierce Cat# 32106 CellTrace Violet Stain Invitrogen Cat# C34557A Live/Dead Green Invitrogen Cat# L34970A Tris Glycine-SDS Running Buffer Boston BioProducts Cat# BP-150 Plasmid Plus Mini Kit QIAGEN Cat# 27106 Plasmid Plus Midi Kit QIAGEN Cat# 12945 DMEM, high glucose Gibco Cat# 11965092 RPMI 1640 Medium Gibco Cat# 11875093 Trypsin-EDTA (0.05%), phenol red Gibco Cat# 25300054 LB Broth Lennox Cat# P-830 LB Agar Lennox Cat# P-820 Dry Milk Powder Research Products International Cat# M17200-1000.0 Opti-MEM I Reduced Serum Medium Gibco Cat# 31985070 PBS, pH 7.4 Gibco Cat# 10010023 12 Well Tissue Culture Plate, Sterile CellTreat Scientific Products Cat# 229111 6 Well Tissue Culture Plate, Sterile CellTreat Scientific Products Cat# 229105 96 Well Tissue Culture Plate, Sterile – Flat bottom CellTreat Scientific Products Cat# 229195 96 Well Tissue Culture Plate, Sterile – Round bottom CellTreat Scientific Products Cat# 229590 24 Well Tissue Culture Plate Corning Incorporated Cat# 3526

    Plasmid Preparation:

    Article Title: Genomic mediators of acquired resistance to immunotherapy in metastatic melanoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-SEC24C Thermo Fisher Scientific Cat# PA5-59101; RRID: AB_2647077 anti-SEC24D Bethyl Cat# A304-813A-T; RRID: AB_2621008 anti-GAPDH Cell Signaling Technology Cat# 3683; RRID: AB_1642205 HLA-A/B/C antibody BioLegend Cat# 311406; RRID: AB_314875 PE mouse IgG2a,k BD Bioscience Cat# 554648; RRID: AB_395491 anti- CD3/APC BioLegend Cat# 317318; RRID: AB_1937212 anti-CD8/APC-Cy7 BioLegend Cat# 344714; RRID: AB_2044006 anti- CD137/PE BioLegend Cat# 309803; RRID: AB_314782 Anti-CD8 (Clone: 4B11) Leica Cat# NCL-CD8-4B11; RRID: AB_442068 Anti-PD-L1 (Clone: E1L3N) Cell Signaling Technology Cat# 13684; RRID: AB_2687655 Anti-FOXP3 (Clone: D2W8E) Cell Signaling Technology Cat# 98377; RRID: AB_2747370 Anti-PD-1 (Clone: EPR4877(2) Abcam Cat# ab137132; RRID: AB_2894867 Anti-CD11c (Clone: D3V1E) Cell Signaling Technology Cat# 45581; RRID: AB_2799286 Anti-CD4 (Clone: EPR6855) Abcam Cat# ab133616; RRID: AB_2750883 Anti-CD20 (Clone: L26) Dako Cat# GA60461-2 Anti-CD3 Dako Cat# GA50361-2 Anti-CD68 (Clone: D4B9C) Cell Signaling Technology Cat# 97778; RRID: AB_2928056 Anti-SOX10 (Clone: EP268) Epitomics Cat# AC-0237; RRID: AB_2941085 Bacterial and virus strains One Shot Stbl3 Chemically Competent E. coli Invitrogen Cat# C737303 Biological samples Patient tumor samples Dana Farber Cancer Institute See Table S1 Patient tumor samples Vanderbilt University Medical Center See Table S1 Chemicals, peptides, and recombinant proteins ADU-S100 STING agonist Chemietek Cat# CT-ADUS100 Poly(dA:dT) naked (synthetic double-stranded DNA) InVivoGen Cat# tlrl-patn CellTrace Violet Stain Invitrogen Cat# C34557A Live/Dead Green Fixable Green Dead Cell Stain Invitrogen Cat# L34970A PMA Sigma-Aldrich Cat# P1585 Ionomycin Sigma-Aldrich Cat# 200-664-3 Interleukin-7 human Sigma-Aldrich Cat# I5896 Interleukin-15 human Sigma-Aldrich Cat# I8648 TRIzol Invitrogen Cat# 15596018 Pure Ethanol 190 Proof Decon Labs Inc. Cat# UN1170 Isopropanol Fisher Bioreagents Cat# BP2618-1 Chloroform ChemCruz Cat# sc-239527A 2-Mercaptoethanol Sigma Cat# M6250 4x Laemmli Sample Buffer BioRad Cat# 1610747 Fetal Bovine Serum Gemini Bio Cat#100-106-500 penicillin-streptomycin antibiotics Life Technologies Cat#15140122 Puromycin selection antibiotic InVivoGen Cat# ant-pr-1 Blasticidin selection antibiotic InVivoGen Cat# ant-bl-1 (Continued on next page) Cancer Cell 43, 308–316.e1–e6, February 10, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Bovine Serum Albumin Boston BioProducts Cat# C-11070D Polybrene Santa Cruz Cat# SC-134220 Critical commercial assays PCR Mycoplasma Detection Kit Applied Biological Materials Inc. Cat# G238 iTaq Universal SYBR Green One-Step kit Bio-Rad Cat# 1725150 Deposited data Raw sequence data This paper dbGaP phs000452.v5 Experimental models: Cell lines Human: WM266.4 Cory Johannessen from Broad Institute of Harvard and MIT N/A Human: THP-1 ATCC Cat# TIB-202 Human: HEK 293T Lenti-X cells Takara Cat# 632180 MLANA-specific HLA- A*02:01-restricted TCR Oliveira, G. et al.36 N/A Oligonucleotides sgRNA: targeting human ROSA26: ACAGCAAGTTGTCTAACCCG Eton Biosciences N/A sgRNA #1: targeting human SEC24C: AAGAGCCCCACCTTCCTCGG Eton Biosciences N/A sgRNA #2: targeting human SEC24C CTGTGGGCAACCAGCCACCT Eton Biosciences N/A sgRNA: targeting human SEC24D: TTTATGCAGTTCATCGAAGG Eton Biosciences N/A qPCR Primer: human SEC24C Forward (5’-3’): TACGGGCACAGAGATCCCGG Reverse (5’-3’): GCTTACCGGATCCGCCACCA Eton Biosciences N/A qPCR Primer: human ACTB Forward (5’-3’): GTTGTCGACGACGAGCG Reverse (5’-3’): GCACAGAGCCTCGCCTT Eton Biosciences N/A qPCR Primer: human IFNB1 Forward (5’-3’): TTGTTGAGAACCTCCTGGCT Reverse (5’-3’): TGACTATGGTCCAGGCACAG Eton Biosciences N/A qPCR Primer: human CXCL10 Forward (5’-3’): CCACGTGTTGAGATCATTGCT Reverse (5’-3’): TGCATCGATTTTGCTCCCCT Eton Biosciences N/A Mutagenesis Primer: human SEC24C G220C: Forward: TTCAGGGTGTCCTCGGCTGCC Reverse: CCGAGGACACCCTGAAGCTG Eton Biosciences N/A Mutagenesis Primer: human SEC24C S107F: Forward: GGGTTTCAGCCATTTGGGTCC Reverse: AAATGGCTGGGACCCAGGCA Eton Biosciences N/A Recombinant DNA Plasmid: lentiCRISPR v2 Addgene Cat# 52961 Plasmid: pENTR-SEC24C Twist Bioscience N/A Plasmid: PAX2 viral packaging vector Addgene Cat#12260 Plasmid: pMD2.G viral packaging plasmid Addgene Cat#12259 Software and algorithms FlowJo FlowJo LLC v10.8.1 PRISM GraphPad v10 (Continued on next page) e2 Cancer Cell 43, 308–316.e1–e6, February 10, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER The Getz Lab CGA WES Characterization pipeline employs the following tools: MuTect,37 ContEst,38 Strelka,39 Orientation Bias Filter,40 DeTiN,41 AllelicCapSeg,42 MAFPoNFilter,43 ABSOLUTE,44 GATK,45 and Oncotator.46 Broad Institute https://portal.firecloud.org/#methods/ getzlab/CGA_WES_Characterization_ Pipeline_v0.1_Dec2018/ CoMut Crowdis et al.47 https://github.com/vanallenlab/comut GISTIC2.0 Mermal et al.48 https://github.com/broadinstitute/gistic2 deconstructSigs Rosenthal et al.49 https://github.com/raerose01/deconstructSigs PhylogicNDT Leshchiner et al.50 https://github.com/broadinstitute/PhylogicNDT Calculate mutational burden https://github.com/brendanreardon/ calculate_mutational_burden Integrative Genomics Viewer Robinson et al.51 https://github.com/igvteam/igv CADD Kircher et al.52 https://github.com/kircherlab/CADD-scripts Polyphen-2 HumDiv Adzhubei et al.53 http://genetics.bwh.harvard.edu/pph2 Other TransIT-LT1 Transfection Reagent Mirus Bio LLC Cat# MIR 2300 In-Fusion HD Cloning Kit Takara Bio Cat# 639650 MultiSite Gateway Cloning kit ThermoFisher Cat#12538120 iTaq Universal SYBR Green One-Step kit Bio-Rad Cat# 1725151 RIPA lysis buffer Boston Bioproducts Cat# BP-115 cOmplete Mini protease inhibitor Roche Cat# 11836153001 Phospho-STOP phosphatase inhibitor Roche Cat# 4906845001 BCA Protein Assay Kit Thermo Scientific Cat# 23224/23228 4-20% Criterion TGX Stain- Free Precast Gels BioRad Cat# 5678095 Trans- Blot Turbo BioRad Cat# 1704271 Tris Buffered Saline Tween Boston Bioproducts Cat# IBB-180X ECL Western Blotting Substrate Pierce Cat# 32106 CellTrace Violet Stain Invitrogen Cat# C34557A Live/Dead Green Invitrogen Cat# L34970A Tris Glycine-SDS Running Buffer Boston BioProducts Cat# BP-150 Plasmid Plus Mini Kit QIAGEN Cat# 27106 Plasmid Plus Midi Kit QIAGEN Cat# 12945 DMEM, high glucose Gibco Cat# 11965092 RPMI 1640 Medium Gibco Cat# 11875093 Trypsin-EDTA (0.05%), phenol red Gibco Cat# 25300054 LB Broth Lennox Cat# P-830 LB Agar Lennox Cat# P-820 Dry Milk Powder Research Products International Cat# M17200-1000.0 Opti-MEM I Reduced Serum Medium Gibco Cat# 31985070 PBS, pH 7.4 Gibco Cat# 10010023 12 Well Tissue Culture Plate, Sterile CellTreat Scientific Products Cat# 229111 6 Well Tissue Culture Plate, Sterile CellTreat Scientific Products Cat# 229105 96 Well Tissue Culture Plate, Sterile – Flat bottom CellTreat Scientific Products Cat# 229195 96 Well Tissue Culture Plate, Sterile – Round bottom CellTreat Scientific Products Cat# 229590 24 Well Tissue Culture Plate Corning Incorporated Cat# 3526

    Software:

    Article Title: Genomic mediators of acquired resistance to immunotherapy in metastatic melanoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-SEC24C Thermo Fisher Scientific Cat# PA5-59101; RRID: AB_2647077 anti-SEC24D Bethyl Cat# A304-813A-T; RRID: AB_2621008 anti-GAPDH Cell Signaling Technology Cat# 3683; RRID: AB_1642205 HLA-A/B/C antibody BioLegend Cat# 311406; RRID: AB_314875 PE mouse IgG2a,k BD Bioscience Cat# 554648; RRID: AB_395491 anti- CD3/APC BioLegend Cat# 317318; RRID: AB_1937212 anti-CD8/APC-Cy7 BioLegend Cat# 344714; RRID: AB_2044006 anti- CD137/PE BioLegend Cat# 309803; RRID: AB_314782 Anti-CD8 (Clone: 4B11) Leica Cat# NCL-CD8-4B11; RRID: AB_442068 Anti-PD-L1 (Clone: E1L3N) Cell Signaling Technology Cat# 13684; RRID: AB_2687655 Anti-FOXP3 (Clone: D2W8E) Cell Signaling Technology Cat# 98377; RRID: AB_2747370 Anti-PD-1 (Clone: EPR4877(2) Abcam Cat# ab137132; RRID: AB_2894867 Anti-CD11c (Clone: D3V1E) Cell Signaling Technology Cat# 45581; RRID: AB_2799286 Anti-CD4 (Clone: EPR6855) Abcam Cat# ab133616; RRID: AB_2750883 Anti-CD20 (Clone: L26) Dako Cat# GA60461-2 Anti-CD3 Dako Cat# GA50361-2 Anti-CD68 (Clone: D4B9C) Cell Signaling Technology Cat# 97778; RRID: AB_2928056 Anti-SOX10 (Clone: EP268) Epitomics Cat# AC-0237; RRID: AB_2941085 Bacterial and virus strains One Shot Stbl3 Chemically Competent E. coli Invitrogen Cat# C737303 Biological samples Patient tumor samples Dana Farber Cancer Institute See Table S1 Patient tumor samples Vanderbilt University Medical Center See Table S1 Chemicals, peptides, and recombinant proteins ADU-S100 STING agonist Chemietek Cat# CT-ADUS100 Poly(dA:dT) naked (synthetic double-stranded DNA) InVivoGen Cat# tlrl-patn CellTrace Violet Stain Invitrogen Cat# C34557A Live/Dead Green Fixable Green Dead Cell Stain Invitrogen Cat# L34970A PMA Sigma-Aldrich Cat# P1585 Ionomycin Sigma-Aldrich Cat# 200-664-3 Interleukin-7 human Sigma-Aldrich Cat# I5896 Interleukin-15 human Sigma-Aldrich Cat# I8648 TRIzol Invitrogen Cat# 15596018 Pure Ethanol 190 Proof Decon Labs Inc. Cat# UN1170 Isopropanol Fisher Bioreagents Cat# BP2618-1 Chloroform ChemCruz Cat# sc-239527A 2-Mercaptoethanol Sigma Cat# M6250 4x Laemmli Sample Buffer BioRad Cat# 1610747 Fetal Bovine Serum Gemini Bio Cat#100-106-500 penicillin-streptomycin antibiotics Life Technologies Cat#15140122 Puromycin selection antibiotic InVivoGen Cat# ant-pr-1 Blasticidin selection antibiotic InVivoGen Cat# ant-bl-1 (Continued on next page) Cancer Cell 43, 308–316.e1–e6, February 10, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Bovine Serum Albumin Boston BioProducts Cat# C-11070D Polybrene Santa Cruz Cat# SC-134220 Critical commercial assays PCR Mycoplasma Detection Kit Applied Biological Materials Inc. Cat# G238 iTaq Universal SYBR Green One-Step kit Bio-Rad Cat# 1725150 Deposited data Raw sequence data This paper dbGaP phs000452.v5 Experimental models: Cell lines Human: WM266.4 Cory Johannessen from Broad Institute of Harvard and MIT N/A Human: THP-1 ATCC Cat# TIB-202 Human: HEK 293T Lenti-X cells Takara Cat# 632180 MLANA-specific HLA- A*02:01-restricted TCR Oliveira, G. et al.36 N/A Oligonucleotides sgRNA: targeting human ROSA26: ACAGCAAGTTGTCTAACCCG Eton Biosciences N/A sgRNA #1: targeting human SEC24C: AAGAGCCCCACCTTCCTCGG Eton Biosciences N/A sgRNA #2: targeting human SEC24C CTGTGGGCAACCAGCCACCT Eton Biosciences N/A sgRNA: targeting human SEC24D: TTTATGCAGTTCATCGAAGG Eton Biosciences N/A qPCR Primer: human SEC24C Forward (5’-3’): TACGGGCACAGAGATCCCGG Reverse (5’-3’): GCTTACCGGATCCGCCACCA Eton Biosciences N/A qPCR Primer: human ACTB Forward (5’-3’): GTTGTCGACGACGAGCG Reverse (5’-3’): GCACAGAGCCTCGCCTT Eton Biosciences N/A qPCR Primer: human IFNB1 Forward (5’-3’): TTGTTGAGAACCTCCTGGCT Reverse (5’-3’): TGACTATGGTCCAGGCACAG Eton Biosciences N/A qPCR Primer: human CXCL10 Forward (5’-3’): CCACGTGTTGAGATCATTGCT Reverse (5’-3’): TGCATCGATTTTGCTCCCCT Eton Biosciences N/A Mutagenesis Primer: human SEC24C G220C: Forward: TTCAGGGTGTCCTCGGCTGCC Reverse: CCGAGGACACCCTGAAGCTG Eton Biosciences N/A Mutagenesis Primer: human SEC24C S107F: Forward: GGGTTTCAGCCATTTGGGTCC Reverse: AAATGGCTGGGACCCAGGCA Eton Biosciences N/A Recombinant DNA Plasmid: lentiCRISPR v2 Addgene Cat# 52961 Plasmid: pENTR-SEC24C Twist Bioscience N/A Plasmid: PAX2 viral packaging vector Addgene Cat#12260 Plasmid: pMD2.G viral packaging plasmid Addgene Cat#12259 Software and algorithms FlowJo FlowJo LLC v10.8.1 PRISM GraphPad v10 (Continued on next page) e2 Cancer Cell 43, 308–316.e1–e6, February 10, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER The Getz Lab CGA WES Characterization pipeline employs the following tools: MuTect,37 ContEst,38 Strelka,39 Orientation Bias Filter,40 DeTiN,41 AllelicCapSeg,42 MAFPoNFilter,43 ABSOLUTE,44 GATK,45 and Oncotator.46 Broad Institute https://portal.firecloud.org/#methods/ getzlab/CGA_WES_Characterization_ Pipeline_v0.1_Dec2018/ CoMut Crowdis et al.47 https://github.com/vanallenlab/comut GISTIC2.0 Mermal et al.48 https://github.com/broadinstitute/gistic2 deconstructSigs Rosenthal et al.49 https://github.com/raerose01/deconstructSigs PhylogicNDT Leshchiner et al.50 https://github.com/broadinstitute/PhylogicNDT Calculate mutational burden https://github.com/brendanreardon/ calculate_mutational_burden Integrative Genomics Viewer Robinson et al.51 https://github.com/igvteam/igv CADD Kircher et al.52 https://github.com/kircherlab/CADD-scripts Polyphen-2 HumDiv Adzhubei et al.53 http://genetics.bwh.harvard.edu/pph2 Other TransIT-LT1 Transfection Reagent Mirus Bio LLC Cat# MIR 2300 In-Fusion HD Cloning Kit Takara Bio Cat# 639650 MultiSite Gateway Cloning kit ThermoFisher Cat#12538120 iTaq Universal SYBR Green One-Step kit Bio-Rad Cat# 1725151 RIPA lysis buffer Boston Bioproducts Cat# BP-115 cOmplete Mini protease inhibitor Roche Cat# 11836153001 Phospho-STOP phosphatase inhibitor Roche Cat# 4906845001 BCA Protein Assay Kit Thermo Scientific Cat# 23224/23228 4-20% Criterion TGX Stain- Free Precast Gels BioRad Cat# 5678095 Trans- Blot Turbo BioRad Cat# 1704271 Tris Buffered Saline Tween Boston Bioproducts Cat# IBB-180X ECL Western Blotting Substrate Pierce Cat# 32106 CellTrace Violet Stain Invitrogen Cat# C34557A Live/Dead Green Invitrogen Cat# L34970A Tris Glycine-SDS Running Buffer Boston BioProducts Cat# BP-150 Plasmid Plus Mini Kit QIAGEN Cat# 27106 Plasmid Plus Midi Kit QIAGEN Cat# 12945 DMEM, high glucose Gibco Cat# 11965092 RPMI 1640 Medium Gibco Cat# 11875093 Trypsin-EDTA (0.05%), phenol red Gibco Cat# 25300054 LB Broth Lennox Cat# P-830 LB Agar Lennox Cat# P-820 Dry Milk Powder Research Products International Cat# M17200-1000.0 Opti-MEM I Reduced Serum Medium Gibco Cat# 31985070 PBS, pH 7.4 Gibco Cat# 10010023 12 Well Tissue Culture Plate, Sterile CellTreat Scientific Products Cat# 229111 6 Well Tissue Culture Plate, Sterile CellTreat Scientific Products Cat# 229105 96 Well Tissue Culture Plate, Sterile – Flat bottom CellTreat Scientific Products Cat# 229195 96 Well Tissue Culture Plate, Sterile – Round bottom CellTreat Scientific Products Cat# 229590 24 Well Tissue Culture Plate Corning Incorporated Cat# 3526



    Similar Products

    cell lines thp 1 monocytes atcc tib 202 software  (ATCC)
    99
    ATCC cell lines thp 1 monocytes atcc tib 202 software
    Cell Lines Thp 1 Monocytes Atcc Tib 202 Software, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/thp+1+atcc/THP-1/pm42275226-99-103-107
    Average 99 stars, based on 1 article reviews
    cell lines thp 1 monocytes atcc tib 202 software - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    sepsis infant wt 1457 cell line thp 1 cell atcc tib 202 chemicals  (ATCC)
    99
    ATCC sepsis infant wt 1457 cell line thp 1 cell atcc tib 202 chemicals
    Sepsis Infant Wt 1457 Cell Line Thp 1 Cell Atcc Tib 202 Chemicals, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/thp+1+atcc/THP-1/pm42260137-294-16-23
    Average 99 stars, based on 1 article reviews
    sepsis infant wt 1457 cell line thp 1 cell atcc tib 202 chemicals - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    5803 thp 1 atcc cat  (ATCC)
    99
    ATCC 5803 thp 1 atcc cat
    5803 Thp 1 Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/thp+1+atcc/NCI-H1299/pm42172124-270-70-72
    Average 99 stars, based on 1 article reviews
    5803 thp 1 atcc cat - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    n a thp 1 atcc  (ATCC)
    99
    ATCC n a thp 1 atcc
    N A Thp 1 Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/thp+1+atcc/THP-1/pm42102820-725-13-15
    Average 99 stars, based on 1 article reviews
    n a thp 1 atcc - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    ht2l ahr thp 1 cells atcc cat  (ATCC)
    99
    ATCC ht2l ahr thp 1 cells atcc cat
    Ht2l Ahr Thp 1 Cells Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/thp+1+atcc/THP-1/pm42095083-169-266-269
    Average 99 stars, based on 1 article reviews
    ht2l ahr thp 1 cells atcc cat - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    zq1099 thp 1 atcc  (ATCC)
    99
    ATCC zq1099 thp 1 atcc
    Zq1099 Thp 1 Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/thp+1+atcc/THP-1/pm41856104-231-13-15
    Average 99 stars, based on 1 article reviews
    zq1099 thp 1 atcc - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    cell lines thp 1 cells atcc n a software  (ATCC)
    99
    ATCC cell lines thp 1 cells atcc n a software
    Cell Lines Thp 1 Cells Atcc N A Software, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/thp+1+atcc/THP-1/pm41926284-190-134-138
    Average 99 stars, based on 1 article reviews
    cell lines thp 1 cells atcc n a software - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    icell u013 thp 1 atcc cat  (ATCC)
    99
    ATCC icell u013 thp 1 atcc cat
    Icell U013 Thp 1 Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/thp+1+atcc/THP-1/pm41887221-260-106-108
    Average 99 stars, based on 1 article reviews
    icell u013 thp 1 atcc cat - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    atcc tib 202  (ATCC)
    99
    ATCC atcc tib 202
    Atcc Tib 202, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/thp+1+atcc/THP-1/pm41866519-91-5-5
    Average 99 stars, based on 1 article reviews
    atcc tib 202 - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier

    Image Search Results