Review



shscramble vector  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc shscramble vector
    In vivo validation of adavosertib and vincristine (VCR) in LFS SHH-MB models (A) Survival of mice injected with BT084 patient-derived xenograft (PDX) model during treatment with adavosertib and VCR; log rank test was used for statistical analysis. (B) Tumor growth dynamics of BT084 PDX model during treatment with adavosertib and vincristine (VCR): data are represented as mean ± SEM. (C) Phospho (p)-CDK1 in LFS SHH-MB PDX cells (HS231222 and LFS primary) following in vivo treatment with adavosertib and VCR: numbers below the blot represent normalized fold change relative to non-treated control. (D) Tumor growth dynamics of LFS MB PDX models expressing WEE1 shRNA (shWEE1) and control shRNA <t>(shSCRAMBLE).</t> (E) Survival of mice injected with LFS MB PDX models expressing shWEE1 and shSCRAMBLE; log rank test was used for statistical analysis.
    Shscramble Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1089 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shscramble+vector/scramble+shRNA+(Plasmid+%231864)/pmc12828543-406-4-8
    Average 96 stars, based on 1089 article reviews
    shscramble vector - by Bioz Stars, 2026-09
    96/100 stars

    Images

    1) Product Images from "Preclinical drug screen identifies WEE1 inhibitor and vinca alkaloid as a combination treatment concept for Li-Fraumeni syndrome medulloblastoma"

    Article Title: Preclinical drug screen identifies WEE1 inhibitor and vinca alkaloid as a combination treatment concept for Li-Fraumeni syndrome medulloblastoma

    Journal: iScience

    doi: 10.1016/j.isci.2025.114564

    In vivo validation of adavosertib and vincristine (VCR) in LFS SHH-MB models (A) Survival of mice injected with BT084 patient-derived xenograft (PDX) model during treatment with adavosertib and VCR; log rank test was used for statistical analysis. (B) Tumor growth dynamics of BT084 PDX model during treatment with adavosertib and vincristine (VCR): data are represented as mean ± SEM. (C) Phospho (p)-CDK1 in LFS SHH-MB PDX cells (HS231222 and LFS primary) following in vivo treatment with adavosertib and VCR: numbers below the blot represent normalized fold change relative to non-treated control. (D) Tumor growth dynamics of LFS MB PDX models expressing WEE1 shRNA (shWEE1) and control shRNA (shSCRAMBLE). (E) Survival of mice injected with LFS MB PDX models expressing shWEE1 and shSCRAMBLE; log rank test was used for statistical analysis.
    Figure Legend Snippet: In vivo validation of adavosertib and vincristine (VCR) in LFS SHH-MB models (A) Survival of mice injected with BT084 patient-derived xenograft (PDX) model during treatment with adavosertib and VCR; log rank test was used for statistical analysis. (B) Tumor growth dynamics of BT084 PDX model during treatment with adavosertib and vincristine (VCR): data are represented as mean ± SEM. (C) Phospho (p)-CDK1 in LFS SHH-MB PDX cells (HS231222 and LFS primary) following in vivo treatment with adavosertib and VCR: numbers below the blot represent normalized fold change relative to non-treated control. (D) Tumor growth dynamics of LFS MB PDX models expressing WEE1 shRNA (shWEE1) and control shRNA (shSCRAMBLE). (E) Survival of mice injected with LFS MB PDX models expressing shWEE1 and shSCRAMBLE; log rank test was used for statistical analysis.

    Techniques Used: In Vivo, Biomarker Discovery, Injection, Derivative Assay, Control, Expressing, shRNA

    Related Articles

    Transduction:

    Article Title: Preclinical drug screen identifies WEE1 inhibitor and vinca alkaloid as a combination treatment concept for Li-Fraumeni syndrome medulloblastoma
    Article Snippet: .. LFS_primary cells transduced with shSCRAMBLE vector (Plasmid #1864, Addgene) were used as a negative control. ..

    Plasmid Preparation:

    Article Title: Preclinical drug screen identifies WEE1 inhibitor and vinca alkaloid as a combination treatment concept for Li-Fraumeni syndrome medulloblastoma
    Article Snippet: .. LFS_primary cells transduced with shSCRAMBLE vector (Plasmid #1864, Addgene) were used as a negative control. ..

    Article Title: Preclinical drug screen identifies WEE1 inhibitor and vinca alkaloid as a combination treatment concept for Li-Fraumeni Syndrome medulloblastoma
    Article Snippet: .. LFS_primary cells transduced 744 with shSCRAMBLE vector (Plasmid #1864, Addgene) were used as a negative 745 control. ..

    Negative Control:

    Article Title: Preclinical drug screen identifies WEE1 inhibitor and vinca alkaloid as a combination treatment concept for Li-Fraumeni syndrome medulloblastoma
    Article Snippet: .. LFS_primary cells transduced with shSCRAMBLE vector (Plasmid #1864, Addgene) were used as a negative control. ..

    Control:

    Article Title: Preclinical drug screen identifies WEE1 inhibitor and vinca alkaloid as a combination treatment concept for Li-Fraumeni Syndrome medulloblastoma
    Article Snippet: .. LFS_primary cells transduced 744 with shSCRAMBLE vector (Plasmid #1864, Addgene) were used as a negative 745 control. ..



    Similar Products

    95
    PackGene Biotech lnc aav2 7 m8 gfaabc1d shscramble egfp
    Aav2 7 M8 Gfaabc1d Shscramble Egfp, supplied by PackGene Biotech lnc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shscramble+vector/AAV2+Vector+Production/pm42035927-54-1-7
    Average 95 stars, based on 1 article reviews
    aav2 7 m8 gfaabc1d shscramble egfp - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    96
    Addgene inc shscramble vector
    In vivo validation of adavosertib and vincristine (VCR) in LFS SHH-MB models (A) Survival of mice injected with BT084 patient-derived xenograft (PDX) model during treatment with adavosertib and VCR; log rank test was used for statistical analysis. (B) Tumor growth dynamics of BT084 PDX model during treatment with adavosertib and vincristine (VCR): data are represented as mean ± SEM. (C) Phospho (p)-CDK1 in LFS SHH-MB PDX cells (HS231222 and LFS primary) following in vivo treatment with adavosertib and VCR: numbers below the blot represent normalized fold change relative to non-treated control. (D) Tumor growth dynamics of LFS MB PDX models expressing WEE1 shRNA (shWEE1) and control shRNA <t>(shSCRAMBLE).</t> (E) Survival of mice injected with LFS MB PDX models expressing shWEE1 and shSCRAMBLE; log rank test was used for statistical analysis.
    Shscramble Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shscramble+vector/scramble+shRNA+(Plasmid+%231864)/pmc12828543-406-4-8
    Average 96 stars, based on 1 article reviews
    shscramble vector - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    OriGene shscramble sequence as control
    A , B Tumor spheroid invasion in collagen matrix after ( A ) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or ( B ) treatment with MEL23. Representative images above and quantification below of the area invaded and the number of cells invading 24 h after implantation. C , D Tumor spheroid invasion in the collagen-BME matrix after ( C ) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or ( D ) treatment with MEL23. Representative images and quantification of the area invaded 24 h after implantation. Graphs show three pooled independent experimental replicates, the total number of spheroids in each condition is: siCtrl = 10, siMdm2#1 = 15, siMdm2#2 = 12 in panel ( A ); DMSO = 25, MEL23 = 24 in panel ( B ); siCtrl = 12, siMdm2#1 = 14, siMdm2#2 = 15 in panel ( C ), and DMSO = 8, MEL23 = 9 in panel ( D ). E Representative images of cell morphology of HT1080 p53KO cells transfected with siRNAs against Mdm2 or siCtrl in collagen matrix, 6 h after implantation. F Quantification of more circular cells (circularity of 0.75 or higher) in each condition shown in ( E ), n = 3 groups. The graph represents the average fold change of more circular morphology in Mdm2 silenced cells compared to control in three independent experimental replicates. More details about the quantification can be found in the method’s session. G – I HT1080 p53KO cells stably expressing shRNA scramble <t>(shScramble)</t> or a pool of Mdm2 shRNAs (shMdm2) were used to analyze metastatic burden using mouse models. G Protein levels of Mdm2 and MdmX in HT1080 shScramble and shMdm2 stable cell lines. β-actin was used as a loading control. H , I Representative images above and quantification below of metastatic foci in the lungs after implantation of shScramble or shMdm2 cells using ( H ) orthotropic model, n = 4 mice/group or ( I ) tail-vein model, n = 8 mice/group. In all box and whisker plots the boxes extend from 25 to 75 percentiles and whiskers show min and max values, The line in the center of each box represents the median. Graphs shown in panels ( F , H , I ) represent the mean ± SD of independent experimental replicates. More details about the statistical tests used can be found in the Source Data file.
    Shscramble Sequence As Control, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shscramble+vector/Scrambled+shRNA+control+in+pGFP-C-shLenti+shRNA+Vector/pmc11336179-343-27-31
    Average 96 stars, based on 1 article reviews
    shscramble sequence as control - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    90
    Shanghai GenePharma lentiviral vectors shscramble
    A , B Tumor spheroid invasion in collagen matrix after ( A ) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or ( B ) treatment with MEL23. Representative images above and quantification below of the area invaded and the number of cells invading 24 h after implantation. C , D Tumor spheroid invasion in the collagen-BME matrix after ( C ) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or ( D ) treatment with MEL23. Representative images and quantification of the area invaded 24 h after implantation. Graphs show three pooled independent experimental replicates, the total number of spheroids in each condition is: siCtrl = 10, siMdm2#1 = 15, siMdm2#2 = 12 in panel ( A ); DMSO = 25, MEL23 = 24 in panel ( B ); siCtrl = 12, siMdm2#1 = 14, siMdm2#2 = 15 in panel ( C ), and DMSO = 8, MEL23 = 9 in panel ( D ). E Representative images of cell morphology of HT1080 p53KO cells transfected with siRNAs against Mdm2 or siCtrl in collagen matrix, 6 h after implantation. F Quantification of more circular cells (circularity of 0.75 or higher) in each condition shown in ( E ), n = 3 groups. The graph represents the average fold change of more circular morphology in Mdm2 silenced cells compared to control in three independent experimental replicates. More details about the quantification can be found in the method’s session. G – I HT1080 p53KO cells stably expressing shRNA scramble <t>(shScramble)</t> or a pool of Mdm2 shRNAs (shMdm2) were used to analyze metastatic burden using mouse models. G Protein levels of Mdm2 and MdmX in HT1080 shScramble and shMdm2 stable cell lines. β-actin was used as a loading control. H , I Representative images above and quantification below of metastatic foci in the lungs after implantation of shScramble or shMdm2 cells using ( H ) orthotropic model, n = 4 mice/group or ( I ) tail-vein model, n = 8 mice/group. In all box and whisker plots the boxes extend from 25 to 75 percentiles and whiskers show min and max values, The line in the center of each box represents the median. Graphs shown in panels ( F , H , I ) represent the mean ± SD of independent experimental replicates. More details about the statistical tests used can be found in the Source Data file.
    Lentiviral Vectors Shscramble, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shscramble+vector/lentiviral+vectors+shscramble/pm34528694-49-11-18
    Average 90 stars, based on 1 article reviews
    lentiviral vectors shscramble - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    VectorBuilder GmbH lentiviral vectors encoding shrnas that were scrambled (shscramble) (i.e., sham) or to plin2 (shplin2)
    A , B Tumor spheroid invasion in collagen matrix after ( A ) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or ( B ) treatment with MEL23. Representative images above and quantification below of the area invaded and the number of cells invading 24 h after implantation. C , D Tumor spheroid invasion in the collagen-BME matrix after ( C ) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or ( D ) treatment with MEL23. Representative images and quantification of the area invaded 24 h after implantation. Graphs show three pooled independent experimental replicates, the total number of spheroids in each condition is: siCtrl = 10, siMdm2#1 = 15, siMdm2#2 = 12 in panel ( A ); DMSO = 25, MEL23 = 24 in panel ( B ); siCtrl = 12, siMdm2#1 = 14, siMdm2#2 = 15 in panel ( C ), and DMSO = 8, MEL23 = 9 in panel ( D ). E Representative images of cell morphology of HT1080 p53KO cells transfected with siRNAs against Mdm2 or siCtrl in collagen matrix, 6 h after implantation. F Quantification of more circular cells (circularity of 0.75 or higher) in each condition shown in ( E ), n = 3 groups. The graph represents the average fold change of more circular morphology in Mdm2 silenced cells compared to control in three independent experimental replicates. More details about the quantification can be found in the method’s session. G – I HT1080 p53KO cells stably expressing shRNA scramble <t>(shScramble)</t> or a pool of Mdm2 shRNAs (shMdm2) were used to analyze metastatic burden using mouse models. G Protein levels of Mdm2 and MdmX in HT1080 shScramble and shMdm2 stable cell lines. β-actin was used as a loading control. H , I Representative images above and quantification below of metastatic foci in the lungs after implantation of shScramble or shMdm2 cells using ( H ) orthotropic model, n = 4 mice/group or ( I ) tail-vein model, n = 8 mice/group. In all box and whisker plots the boxes extend from 25 to 75 percentiles and whiskers show min and max values, The line in the center of each box represents the median. Graphs shown in panels ( F , H , I ) represent the mean ± SD of independent experimental replicates. More details about the statistical tests used can be found in the Source Data file.
    Lentiviral Vectors Encoding Shrnas That Were Scrambled (Shscramble) (I.E., Sham) Or To Plin2 (Shplin2), supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shscramble+vector/lentiviral+vectors+encoding+short+hairpin+rnas+that+were+either+scrambled++i+e+++sham++or+to+plin2++shplin2+/pmc08564404-23-13-18
    Average 90 stars, based on 1 article reviews
    lentiviral vectors encoding shrnas that were scrambled (shscramble) (i.e., sham) or to plin2 (shplin2) - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    95
    OriGene mel cellsc shpcbp1 cggcgtgccgcagtccgtcaccgagtgtg shpcbp2 ggcctataccattcaaggacagtatgcca shscramble tr30013 af
    A , B Tumor spheroid invasion in collagen matrix after ( A ) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or ( B ) treatment with MEL23. Representative images above and quantification below of the area invaded and the number of cells invading 24 h after implantation. C , D Tumor spheroid invasion in the collagen-BME matrix after ( C ) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or ( D ) treatment with MEL23. Representative images and quantification of the area invaded 24 h after implantation. Graphs show three pooled independent experimental replicates, the total number of spheroids in each condition is: siCtrl = 10, siMdm2#1 = 15, siMdm2#2 = 12 in panel ( A ); DMSO = 25, MEL23 = 24 in panel ( B ); siCtrl = 12, siMdm2#1 = 14, siMdm2#2 = 15 in panel ( C ), and DMSO = 8, MEL23 = 9 in panel ( D ). E Representative images of cell morphology of HT1080 p53KO cells transfected with siRNAs against Mdm2 or siCtrl in collagen matrix, 6 h after implantation. F Quantification of more circular cells (circularity of 0.75 or higher) in each condition shown in ( E ), n = 3 groups. The graph represents the average fold change of more circular morphology in Mdm2 silenced cells compared to control in three independent experimental replicates. More details about the quantification can be found in the method’s session. G – I HT1080 p53KO cells stably expressing shRNA scramble <t>(shScramble)</t> or a pool of Mdm2 shRNAs (shMdm2) were used to analyze metastatic burden using mouse models. G Protein levels of Mdm2 and MdmX in HT1080 shScramble and shMdm2 stable cell lines. β-actin was used as a loading control. H , I Representative images above and quantification below of metastatic foci in the lungs after implantation of shScramble or shMdm2 cells using ( H ) orthotropic model, n = 4 mice/group or ( I ) tail-vein model, n = 8 mice/group. In all box and whisker plots the boxes extend from 25 to 75 percentiles and whiskers show min and max values, The line in the center of each box represents the median. Graphs shown in panels ( F , H , I ) represent the mean ± SD of independent experimental replicates. More details about the statistical tests used can be found in the Source Data file.
    Mel Cellsc Shpcbp1 Cggcgtgccgcagtccgtcaccgagtgtg Shpcbp2 Ggcctataccattcaaggacagtatgcca Shscramble Tr30013 Af, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shscramble+vector/Scrambled+shRNA+control+in+pGFP-V-RS+shRNA+Vector/10__1128_slash_mcb__00668___20-165-43-75
    Average 95 stars, based on 1 article reviews
    mel cellsc shpcbp1 cggcgtgccgcagtccgtcaccgagtgtg shpcbp2 ggcctataccattcaaggacagtatgcca shscramble tr30013 af - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    Image Search Results


    In vivo validation of adavosertib and vincristine (VCR) in LFS SHH-MB models (A) Survival of mice injected with BT084 patient-derived xenograft (PDX) model during treatment with adavosertib and VCR; log rank test was used for statistical analysis. (B) Tumor growth dynamics of BT084 PDX model during treatment with adavosertib and vincristine (VCR): data are represented as mean ± SEM. (C) Phospho (p)-CDK1 in LFS SHH-MB PDX cells (HS231222 and LFS primary) following in vivo treatment with adavosertib and VCR: numbers below the blot represent normalized fold change relative to non-treated control. (D) Tumor growth dynamics of LFS MB PDX models expressing WEE1 shRNA (shWEE1) and control shRNA (shSCRAMBLE). (E) Survival of mice injected with LFS MB PDX models expressing shWEE1 and shSCRAMBLE; log rank test was used for statistical analysis.

    Journal: iScience

    Article Title: Preclinical drug screen identifies WEE1 inhibitor and vinca alkaloid as a combination treatment concept for Li-Fraumeni syndrome medulloblastoma

    doi: 10.1016/j.isci.2025.114564

    Figure Lengend Snippet: In vivo validation of adavosertib and vincristine (VCR) in LFS SHH-MB models (A) Survival of mice injected with BT084 patient-derived xenograft (PDX) model during treatment with adavosertib and VCR; log rank test was used for statistical analysis. (B) Tumor growth dynamics of BT084 PDX model during treatment with adavosertib and vincristine (VCR): data are represented as mean ± SEM. (C) Phospho (p)-CDK1 in LFS SHH-MB PDX cells (HS231222 and LFS primary) following in vivo treatment with adavosertib and VCR: numbers below the blot represent normalized fold change relative to non-treated control. (D) Tumor growth dynamics of LFS MB PDX models expressing WEE1 shRNA (shWEE1) and control shRNA (shSCRAMBLE). (E) Survival of mice injected with LFS MB PDX models expressing shWEE1 and shSCRAMBLE; log rank test was used for statistical analysis.

    Article Snippet: LFS_primary cells transduced with shSCRAMBLE vector (Plasmid #1864, Addgene) were used as a negative control.

    Techniques: In Vivo, Biomarker Discovery, Injection, Derivative Assay, Control, Expressing, shRNA

    A , B Tumor spheroid invasion in collagen matrix after ( A ) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or ( B ) treatment with MEL23. Representative images above and quantification below of the area invaded and the number of cells invading 24 h after implantation. C , D Tumor spheroid invasion in the collagen-BME matrix after ( C ) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or ( D ) treatment with MEL23. Representative images and quantification of the area invaded 24 h after implantation. Graphs show three pooled independent experimental replicates, the total number of spheroids in each condition is: siCtrl = 10, siMdm2#1 = 15, siMdm2#2 = 12 in panel ( A ); DMSO = 25, MEL23 = 24 in panel ( B ); siCtrl = 12, siMdm2#1 = 14, siMdm2#2 = 15 in panel ( C ), and DMSO = 8, MEL23 = 9 in panel ( D ). E Representative images of cell morphology of HT1080 p53KO cells transfected with siRNAs against Mdm2 or siCtrl in collagen matrix, 6 h after implantation. F Quantification of more circular cells (circularity of 0.75 or higher) in each condition shown in ( E ), n = 3 groups. The graph represents the average fold change of more circular morphology in Mdm2 silenced cells compared to control in three independent experimental replicates. More details about the quantification can be found in the method’s session. G – I HT1080 p53KO cells stably expressing shRNA scramble (shScramble) or a pool of Mdm2 shRNAs (shMdm2) were used to analyze metastatic burden using mouse models. G Protein levels of Mdm2 and MdmX in HT1080 shScramble and shMdm2 stable cell lines. β-actin was used as a loading control. H , I Representative images above and quantification below of metastatic foci in the lungs after implantation of shScramble or shMdm2 cells using ( H ) orthotropic model, n = 4 mice/group or ( I ) tail-vein model, n = 8 mice/group. In all box and whisker plots the boxes extend from 25 to 75 percentiles and whiskers show min and max values, The line in the center of each box represents the median. Graphs shown in panels ( F , H , I ) represent the mean ± SD of independent experimental replicates. More details about the statistical tests used can be found in the Source Data file.

    Journal: Nature Communications

    Article Title: Mdm2 requires Sprouty4 to regulate focal adhesion formation and metastasis independent of p53

    doi: 10.1038/s41467-024-51488-2

    Figure Lengend Snippet: A , B Tumor spheroid invasion in collagen matrix after ( A ) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or ( B ) treatment with MEL23. Representative images above and quantification below of the area invaded and the number of cells invading 24 h after implantation. C , D Tumor spheroid invasion in the collagen-BME matrix after ( C ) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or ( D ) treatment with MEL23. Representative images and quantification of the area invaded 24 h after implantation. Graphs show three pooled independent experimental replicates, the total number of spheroids in each condition is: siCtrl = 10, siMdm2#1 = 15, siMdm2#2 = 12 in panel ( A ); DMSO = 25, MEL23 = 24 in panel ( B ); siCtrl = 12, siMdm2#1 = 14, siMdm2#2 = 15 in panel ( C ), and DMSO = 8, MEL23 = 9 in panel ( D ). E Representative images of cell morphology of HT1080 p53KO cells transfected with siRNAs against Mdm2 or siCtrl in collagen matrix, 6 h after implantation. F Quantification of more circular cells (circularity of 0.75 or higher) in each condition shown in ( E ), n = 3 groups. The graph represents the average fold change of more circular morphology in Mdm2 silenced cells compared to control in three independent experimental replicates. More details about the quantification can be found in the method’s session. G – I HT1080 p53KO cells stably expressing shRNA scramble (shScramble) or a pool of Mdm2 shRNAs (shMdm2) were used to analyze metastatic burden using mouse models. G Protein levels of Mdm2 and MdmX in HT1080 shScramble and shMdm2 stable cell lines. β-actin was used as a loading control. H , I Representative images above and quantification below of metastatic foci in the lungs after implantation of shScramble or shMdm2 cells using ( H ) orthotropic model, n = 4 mice/group or ( I ) tail-vein model, n = 8 mice/group. In all box and whisker plots the boxes extend from 25 to 75 percentiles and whiskers show min and max values, The line in the center of each box represents the median. Graphs shown in panels ( F , H , I ) represent the mean ± SD of independent experimental replicates. More details about the statistical tests used can be found in the Source Data file.

    Article Snippet: For the single Mdm2 knockdown, HT1080 p53KO cells were transduced with lentivirus carrying a pool of shRNAs against Mdm2 (4 different shRNAs purchased from OriGene, cat.#TL311529) or shScramble sequence as control (OriGene, cat.#TR30021).

    Techniques: Transfection, Control, Stable Transfection, Expressing, shRNA, Whisker Assay