Review



u6 expression vectors  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc u6 expression vectors
    U6 Expression Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+expression+vector/SpCas9_sgRNA_expression_in_pBluescript+(Plasmid+%23122089)/pmc12957561-33-23-26
    Average 93 stars, based on 12 article reviews
    u6 expression vectors - by Bioz Stars, 2026-10
    93/100 stars

    Images

    Related Articles

    Expressing:

    Article Title: P3a site-specific or cassette mutagenesis for seamless protein and plasmid engineering
    Article Snippet: .. Primers for modifying the sgRNA expression vector eSpCas9(1.1)_No_FLAG_ATP1A1_G3 (Addgene #86611) were OB352-F1, CACCGGGTCTTCGAGAAGACCTGTTTTAGAGCTAGAAATAGC; OB352-R, CTTCTCGAAGACCCGGTGTTTCGTCCTTTCCAC. ..

    Article Title: Heterochromatin fidelity is a therapeutic vulnerability in lymphoma and other human cancers
    Article Snippet: .. Lentivirus was produced for each CRISPR and sgRNA expression vector by transfection of pMD2.G (Addgene #12259), psPAX2 (Addgene #12260), and the transfer plasmid (2:3:4 ratio by mass, 3 μg total) into HEK293FT cells using Lipofectamine 3000 (Thermo Scientific cat. no. L3000015). .. Viral supernatants were harvested 48 hours after plasmid transfection, centrifuged at 1000g for 5 minutes, and then filtered through 0.45 μm PVDF filters (Millipore cat. no. SLHVR04NL).

    Article Title: SMYD2-mediated methylation of STAT1 protects against hepatic ischaemia/reperfusion injury by blocking JAK-STAT1 signalling pathways.
    Article Snippet: .. The in vitro transcripts of sgRNA expression vector (pUC57- sgRNA, Addgene, 51132) and another expression vector (pST1374- Cas9, Addgene 44758) were purified, mixed and injected into singlecell fertilised eggs of C57BL/6 mice using the FemtoJet 5247 microinjection system. ..

    Article Title: Genetic disruption of leucine rich repeat transmembrane protein 4 like 1 induces a pro-social behavioural phenotype in zebrafish
    Article Snippet: .. The sgRNA was generated by in vitro transcription using the mMESSAGE mMACHINE kit (Life Technologies) on a sgRNA expression vector (pDR274; Addgene plasmid #42250) as a template. .. Cas9 mRNA was transcribed from the pMLM3613 vector (Addgene plasmid #42251) using the mMESSAGE mMACHINE T7 Ultra Kit (Life Technologies).

    Article Title: SMYD2-mediated methylation of STAT1 protects against hepatic ischaemia/reperfusion injury by blocking JAK-STAT1 signalling pathways
    Article Snippet: .. The in vitro transcripts of sgRNA expression vector (pUC57-sgRNA, Addgene, 51132) and another expression vector (pST1374-Cas9, Addgene 44758) were purified, mixed and injected into single-cell fertilised eggs of C57BL/6 mice using the FemtoJet 5247 microinjection system. ..

    Article Title: P3a site-specific or cassette mutagenesis for seamless protein and plasmid engineering
    Article Snippet: .. Related to this, we tested a pair of primers to mutate an sgRNA-coding sequence on an sgRNA expression vector for marker-free genome editing (Addgene, Cat 86611, 8.4 kb [ ]) and analyzed 8 of the resulting colonies. ..

    Article Title: Positive regulation of Hedgehog signaling via phosphorylation of GLI2/GLI3 by DYRK2 kinase Authors
    Article Snippet: .. Briefly, single-guide RNA (sgRNA) sequences targeting the mouse Gpr161 (#1: 5¢-GATGACCAACCAAATAGGGGCGG-3¢) and (#2: 5¢- GTACACCATTGGATACAGGACGG-3¢), Ift80 (5¢-GGTTCCACTTGACGATCTGGTGG-3¢) and Ift52 (5¢-GGCACCAAAAGGGTAGACAAAGG-3¢) was designed and inserted into the all-in-one sgRNA expression vector, pHiFiCas9-2 × sgRNA (Addgene. .. Briefly, single-guide RNA (sgRNA) sequences targeting the mouse Gpr161 (#1: 5¢-GATGACCAACCAAATAGGGGCGG-3¢) and (#2: 5¢- GTACACCATTGGATACAGGACGG-3¢), Ift80 (5¢-GGTTCCACTTGACGATCTGGTGG-3¢) and Ift52 (5¢-GGCACCAAAAGGGTAGACAAAGG-3¢) was designed and inserted into the all-in-one sgRNA expression vector, pHiFiCas9-2 × sgRNA (Addgene.

    Article Title: An induced pluripotent stem cell line carrying a silencing-resistant calcium reporter allele
    Article Snippet: User-customizable nuclease (UCN) delivery method , Encoding plasmid transfection. .. All double-stranded DNA genetic material molecules introduced into the cells , sgRNA expression vector: pXAT2; Addgene Plasmid #80494HDR donor: pSINA-UCOE-CAG-GCaMP6; pSM_033. .. Evidence of the absence of random integration of any plasmids or DS DNA introduced into the cells. , PCR from genomic DNA for plasmid backbone.

    Plasmid Preparation:

    Article Title: P3a site-specific or cassette mutagenesis for seamless protein and plasmid engineering
    Article Snippet: .. Primers for modifying the sgRNA expression vector eSpCas9(1.1)_No_FLAG_ATP1A1_G3 (Addgene #86611) were OB352-F1, CACCGGGTCTTCGAGAAGACCTGTTTTAGAGCTAGAAATAGC; OB352-R, CTTCTCGAAGACCCGGTGTTTCGTCCTTTCCAC. ..

    Article Title: Heterochromatin fidelity is a therapeutic vulnerability in lymphoma and other human cancers
    Article Snippet: .. Lentivirus was produced for each CRISPR and sgRNA expression vector by transfection of pMD2.G (Addgene #12259), psPAX2 (Addgene #12260), and the transfer plasmid (2:3:4 ratio by mass, 3 μg total) into HEK293FT cells using Lipofectamine 3000 (Thermo Scientific cat. no. L3000015). .. Viral supernatants were harvested 48 hours after plasmid transfection, centrifuged at 1000g for 5 minutes, and then filtered through 0.45 μm PVDF filters (Millipore cat. no. SLHVR04NL).

    Article Title: SMYD2-mediated methylation of STAT1 protects against hepatic ischaemia/reperfusion injury by blocking JAK-STAT1 signalling pathways.
    Article Snippet: .. The in vitro transcripts of sgRNA expression vector (pUC57- sgRNA, Addgene, 51132) and another expression vector (pST1374- Cas9, Addgene 44758) were purified, mixed and injected into singlecell fertilised eggs of C57BL/6 mice using the FemtoJet 5247 microinjection system. ..

    Article Title: Genetic disruption of leucine rich repeat transmembrane protein 4 like 1 induces a pro-social behavioural phenotype in zebrafish
    Article Snippet: .. The sgRNA was generated by in vitro transcription using the mMESSAGE mMACHINE kit (Life Technologies) on a sgRNA expression vector (pDR274; Addgene plasmid #42250) as a template. .. Cas9 mRNA was transcribed from the pMLM3613 vector (Addgene plasmid #42251) using the mMESSAGE mMACHINE T7 Ultra Kit (Life Technologies).

    Article Title: SMYD2-mediated methylation of STAT1 protects against hepatic ischaemia/reperfusion injury by blocking JAK-STAT1 signalling pathways
    Article Snippet: .. The in vitro transcripts of sgRNA expression vector (pUC57-sgRNA, Addgene, 51132) and another expression vector (pST1374-Cas9, Addgene 44758) were purified, mixed and injected into single-cell fertilised eggs of C57BL/6 mice using the FemtoJet 5247 microinjection system. ..

    Article Title: P3a site-specific or cassette mutagenesis for seamless protein and plasmid engineering
    Article Snippet: .. Related to this, we tested a pair of primers to mutate an sgRNA-coding sequence on an sgRNA expression vector for marker-free genome editing (Addgene, Cat 86611, 8.4 kb [ ]) and analyzed 8 of the resulting colonies. ..

    Article Title: An induced pluripotent stem cell line carrying a silencing-resistant calcium reporter allele
    Article Snippet: User-customizable nuclease (UCN) delivery method , Encoding plasmid transfection. .. All double-stranded DNA genetic material molecules introduced into the cells , sgRNA expression vector: pXAT2; Addgene Plasmid #80494HDR donor: pSINA-UCOE-CAG-GCaMP6; pSM_033. .. Evidence of the absence of random integration of any plasmids or DS DNA introduced into the cells. , PCR from genomic DNA for plasmid backbone.

    Produced:

    Article Title: Heterochromatin fidelity is a therapeutic vulnerability in lymphoma and other human cancers
    Article Snippet: .. Lentivirus was produced for each CRISPR and sgRNA expression vector by transfection of pMD2.G (Addgene #12259), psPAX2 (Addgene #12260), and the transfer plasmid (2:3:4 ratio by mass, 3 μg total) into HEK293FT cells using Lipofectamine 3000 (Thermo Scientific cat. no. L3000015). .. Viral supernatants were harvested 48 hours after plasmid transfection, centrifuged at 1000g for 5 minutes, and then filtered through 0.45 μm PVDF filters (Millipore cat. no. SLHVR04NL).

    CRISPR:

    Article Title: Heterochromatin fidelity is a therapeutic vulnerability in lymphoma and other human cancers
    Article Snippet: .. Lentivirus was produced for each CRISPR and sgRNA expression vector by transfection of pMD2.G (Addgene #12259), psPAX2 (Addgene #12260), and the transfer plasmid (2:3:4 ratio by mass, 3 μg total) into HEK293FT cells using Lipofectamine 3000 (Thermo Scientific cat. no. L3000015). .. Viral supernatants were harvested 48 hours after plasmid transfection, centrifuged at 1000g for 5 minutes, and then filtered through 0.45 μm PVDF filters (Millipore cat. no. SLHVR04NL).

    Transfection:

    Article Title: Heterochromatin fidelity is a therapeutic vulnerability in lymphoma and other human cancers
    Article Snippet: .. Lentivirus was produced for each CRISPR and sgRNA expression vector by transfection of pMD2.G (Addgene #12259), psPAX2 (Addgene #12260), and the transfer plasmid (2:3:4 ratio by mass, 3 μg total) into HEK293FT cells using Lipofectamine 3000 (Thermo Scientific cat. no. L3000015). .. Viral supernatants were harvested 48 hours after plasmid transfection, centrifuged at 1000g for 5 minutes, and then filtered through 0.45 μm PVDF filters (Millipore cat. no. SLHVR04NL).

    In Vitro:

    Article Title: SMYD2-mediated methylation of STAT1 protects against hepatic ischaemia/reperfusion injury by blocking JAK-STAT1 signalling pathways.
    Article Snippet: .. The in vitro transcripts of sgRNA expression vector (pUC57- sgRNA, Addgene, 51132) and another expression vector (pST1374- Cas9, Addgene 44758) were purified, mixed and injected into singlecell fertilised eggs of C57BL/6 mice using the FemtoJet 5247 microinjection system. ..

    Article Title: Genetic disruption of leucine rich repeat transmembrane protein 4 like 1 induces a pro-social behavioural phenotype in zebrafish
    Article Snippet: .. The sgRNA was generated by in vitro transcription using the mMESSAGE mMACHINE kit (Life Technologies) on a sgRNA expression vector (pDR274; Addgene plasmid #42250) as a template. .. Cas9 mRNA was transcribed from the pMLM3613 vector (Addgene plasmid #42251) using the mMESSAGE mMACHINE T7 Ultra Kit (Life Technologies).

    Article Title: SMYD2-mediated methylation of STAT1 protects against hepatic ischaemia/reperfusion injury by blocking JAK-STAT1 signalling pathways
    Article Snippet: .. The in vitro transcripts of sgRNA expression vector (pUC57-sgRNA, Addgene, 51132) and another expression vector (pST1374-Cas9, Addgene 44758) were purified, mixed and injected into single-cell fertilised eggs of C57BL/6 mice using the FemtoJet 5247 microinjection system. ..

    Purification:

    Article Title: SMYD2-mediated methylation of STAT1 protects against hepatic ischaemia/reperfusion injury by blocking JAK-STAT1 signalling pathways.
    Article Snippet: .. The in vitro transcripts of sgRNA expression vector (pUC57- sgRNA, Addgene, 51132) and another expression vector (pST1374- Cas9, Addgene 44758) were purified, mixed and injected into singlecell fertilised eggs of C57BL/6 mice using the FemtoJet 5247 microinjection system. ..

    Article Title: SMYD2-mediated methylation of STAT1 protects against hepatic ischaemia/reperfusion injury by blocking JAK-STAT1 signalling pathways
    Article Snippet: .. The in vitro transcripts of sgRNA expression vector (pUC57-sgRNA, Addgene, 51132) and another expression vector (pST1374-Cas9, Addgene 44758) were purified, mixed and injected into single-cell fertilised eggs of C57BL/6 mice using the FemtoJet 5247 microinjection system. ..

    Injection:

    Article Title: SMYD2-mediated methylation of STAT1 protects against hepatic ischaemia/reperfusion injury by blocking JAK-STAT1 signalling pathways.
    Article Snippet: .. The in vitro transcripts of sgRNA expression vector (pUC57- sgRNA, Addgene, 51132) and another expression vector (pST1374- Cas9, Addgene 44758) were purified, mixed and injected into singlecell fertilised eggs of C57BL/6 mice using the FemtoJet 5247 microinjection system. ..

    Article Title: SMYD2-mediated methylation of STAT1 protects against hepatic ischaemia/reperfusion injury by blocking JAK-STAT1 signalling pathways
    Article Snippet: .. The in vitro transcripts of sgRNA expression vector (pUC57-sgRNA, Addgene, 51132) and another expression vector (pST1374-Cas9, Addgene 44758) were purified, mixed and injected into single-cell fertilised eggs of C57BL/6 mice using the FemtoJet 5247 microinjection system. ..

    Microinjection:

    Article Title: SMYD2-mediated methylation of STAT1 protects against hepatic ischaemia/reperfusion injury by blocking JAK-STAT1 signalling pathways.
    Article Snippet: .. The in vitro transcripts of sgRNA expression vector (pUC57- sgRNA, Addgene, 51132) and another expression vector (pST1374- Cas9, Addgene 44758) were purified, mixed and injected into singlecell fertilised eggs of C57BL/6 mice using the FemtoJet 5247 microinjection system. ..

    Article Title: SMYD2-mediated methylation of STAT1 protects against hepatic ischaemia/reperfusion injury by blocking JAK-STAT1 signalling pathways
    Article Snippet: .. The in vitro transcripts of sgRNA expression vector (pUC57-sgRNA, Addgene, 51132) and another expression vector (pST1374-Cas9, Addgene 44758) were purified, mixed and injected into single-cell fertilised eggs of C57BL/6 mice using the FemtoJet 5247 microinjection system. ..

    Generated:

    Article Title: Genetic disruption of leucine rich repeat transmembrane protein 4 like 1 induces a pro-social behavioural phenotype in zebrafish
    Article Snippet: .. The sgRNA was generated by in vitro transcription using the mMESSAGE mMACHINE kit (Life Technologies) on a sgRNA expression vector (pDR274; Addgene plasmid #42250) as a template. .. Cas9 mRNA was transcribed from the pMLM3613 vector (Addgene plasmid #42251) using the mMESSAGE mMACHINE T7 Ultra Kit (Life Technologies).

    Single Cell:

    Article Title: SMYD2-mediated methylation of STAT1 protects against hepatic ischaemia/reperfusion injury by blocking JAK-STAT1 signalling pathways
    Article Snippet: .. The in vitro transcripts of sgRNA expression vector (pUC57-sgRNA, Addgene, 51132) and another expression vector (pST1374-Cas9, Addgene 44758) were purified, mixed and injected into single-cell fertilised eggs of C57BL/6 mice using the FemtoJet 5247 microinjection system. ..

    Sequencing:

    Article Title: P3a site-specific or cassette mutagenesis for seamless protein and plasmid engineering
    Article Snippet: .. Related to this, we tested a pair of primers to mutate an sgRNA-coding sequence on an sgRNA expression vector for marker-free genome editing (Addgene, Cat 86611, 8.4 kb [ ]) and analyzed 8 of the resulting colonies. ..

    Marker:

    Article Title: P3a site-specific or cassette mutagenesis for seamless protein and plasmid engineering
    Article Snippet: .. Related to this, we tested a pair of primers to mutate an sgRNA-coding sequence on an sgRNA expression vector for marker-free genome editing (Addgene, Cat 86611, 8.4 kb [ ]) and analyzed 8 of the resulting colonies. ..



    Similar Products

    93
    Addgene inc u6 expression vectors
    U6 Expression Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+expression+vector/SpCas9_sgRNA_expression_in_pBluescript+(Plasmid+%23122089)/pmc12957561-33-23-26
    Average 93 stars, based on 1 article reviews
    u6 expression vectors - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    95
    Addgene inc lv sgrna expression vectors
    Lv Sgrna Expression Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+expression+vector/lentiCRISPR+(Plasmid+%2349535)/pmc12850638-256-0-8
    Average 95 stars, based on 1 article reviews
    lv sgrna expression vectors - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    93
    Addgene inc library expression vector pu6 sgrna ef1alpha puro t2a gfp
    Library Expression Vector Pu6 Sgrna Ef1alpha Puro T2a Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+expression+vector/pU6-sgRNA+Ef1alpha+Puro-T2A-GFP+(Plasmid+%23111596)/pmc12948414-158-18-28
    Average 93 stars, based on 1 article reviews
    library expression vector pu6 sgrna ef1alpha puro t2a gfp - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    96
    Addgene inc lentiviral sgrna expression vectors lentiguide puromycin
    A. Schematic of the XBP1-Venus IRE1 splicing reporter. B . Expression, measured by qPCR, of the IRE1/XBP1s target genes XBP1s and ERDJ4/DNAJB9 in HEK293 cells expressing non-targeting or SLC33A1 shRNA and treated for 4 h with Tg (0.5 µM) or IXA4 (10 µM). C . Expression, measured by qPCR, of the IRE1 target genes Xbp1s and Erdj4/Dnajb9 , the ATF6 target gene BiP , and the PERK target gene Chop in MEF cells CRISPR-deleted of Slc33a1 using two distinct <t>sgRNA</t> and treated for 4 h with IXA4 (10 µM). MEF cells expressing two distinct non-targeting sgRNAs are shown as a control. D . Expression, measured by qPCR, of the IRE1 target gene XBP1s in non-targeting HEK293 cells or HEK293 cells lacking SLC33A1 transfected with mock or wild-type SLC33A1, as indicated, and then treated for 4 h with Tg (0.5 µM) or IXA4 (10 µM). E . Immunoblots of the indicated proteins in HEK293T cells expressing non-targeting or SLC33A1 sgRNAs treated for 4 h with IXA4 (10 µM). Black asterisks in ( C ) represent comparisons between vehicle-treated control cells expressing NT sgRNA #1 and mutant cells treated with or without IXA4. Red asterisks in ( C ) indicate comparisons between vehicle and IXA4-treated samples. *p<0.05, **p<0.01, ***p<0.005, one-way ANOVA.
    Lentiviral Sgrna Expression Vectors Lentiguide Puromycin, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+expression+vector/lentiGuide-Puro+(Plasmid+%2352963)/bio_rxiv__64898__2026__02__17__706344-145-14-19
    Average 96 stars, based on 1 article reviews
    lentiviral sgrna expression vectors lentiguide puromycin - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    95
    Addgene inc puc57 sgrna 647
    A. Schematic of the XBP1-Venus IRE1 splicing reporter. B . Expression, measured by qPCR, of the IRE1/XBP1s target genes XBP1s and ERDJ4/DNAJB9 in HEK293 cells expressing non-targeting or SLC33A1 shRNA and treated for 4 h with Tg (0.5 µM) or IXA4 (10 µM). C . Expression, measured by qPCR, of the IRE1 target genes Xbp1s and Erdj4/Dnajb9 , the ATF6 target gene BiP , and the PERK target gene Chop in MEF cells CRISPR-deleted of Slc33a1 using two distinct <t>sgRNA</t> and treated for 4 h with IXA4 (10 µM). MEF cells expressing two distinct non-targeting sgRNAs are shown as a control. D . Expression, measured by qPCR, of the IRE1 target gene XBP1s in non-targeting HEK293 cells or HEK293 cells lacking SLC33A1 transfected with mock or wild-type SLC33A1, as indicated, and then treated for 4 h with Tg (0.5 µM) or IXA4 (10 µM). E . Immunoblots of the indicated proteins in HEK293T cells expressing non-targeting or SLC33A1 sgRNAs treated for 4 h with IXA4 (10 µM). Black asterisks in ( C ) represent comparisons between vehicle-treated control cells expressing NT sgRNA #1 and mutant cells treated with or without IXA4. Red asterisks in ( C ) indicate comparisons between vehicle and IXA4-treated samples. *p<0.05, **p<0.01, ***p<0.005, one-way ANOVA.
    Puc57 Sgrna 647, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+expression+vector/pUC57-sgRNA+expression+vector+(Plasmid+%2351132)/pm41655632-259-15-17
    Average 95 stars, based on 1 article reviews
    puc57 sgrna 647 - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    95
    Addgene inc sgrna expression vector
    A. Schematic of the XBP1-Venus IRE1 splicing reporter. B . Expression, measured by qPCR, of the IRE1/XBP1s target genes XBP1s and ERDJ4/DNAJB9 in HEK293 cells expressing non-targeting or SLC33A1 shRNA and treated for 4 h with Tg (0.5 µM) or IXA4 (10 µM). C . Expression, measured by qPCR, of the IRE1 target genes Xbp1s and Erdj4/Dnajb9 , the ATF6 target gene BiP , and the PERK target gene Chop in MEF cells CRISPR-deleted of Slc33a1 using two distinct <t>sgRNA</t> and treated for 4 h with IXA4 (10 µM). MEF cells expressing two distinct non-targeting sgRNAs are shown as a control. D . Expression, measured by qPCR, of the IRE1 target gene XBP1s in non-targeting HEK293 cells or HEK293 cells lacking SLC33A1 transfected with mock or wild-type SLC33A1, as indicated, and then treated for 4 h with Tg (0.5 µM) or IXA4 (10 µM). E . Immunoblots of the indicated proteins in HEK293T cells expressing non-targeting or SLC33A1 sgRNAs treated for 4 h with IXA4 (10 µM). Black asterisks in ( C ) represent comparisons between vehicle-treated control cells expressing NT sgRNA #1 and mutant cells treated with or without IXA4. Red asterisks in ( C ) indicate comparisons between vehicle and IXA4-treated samples. *p<0.05, **p<0.01, ***p<0.005, one-way ANOVA.
    Sgrna Expression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+expression+vector/pUC57-sgRNA+expression+vector+(Plasmid+%2351132)/pmc12911573-45-5-9
    Average 95 stars, based on 1 article reviews
    sgrna expression vector - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    98
    Addgene inc vectors expressing sgrna
    a , PEtn levels in parental KP sh and clonal KP sh cells expressing <t>sgRNA</t> and complemented with guide-resistant <t>Pcyt2</t> <t>cDNA</t> as indicated cultured on or off dox for 6 days ( P values, left to right: 0.0183, 0.0341, 0.0068 and 0.0104). b , c , PCA of RNA-seq ( b ) and bubble plot of pathway overrepresentation for genes that are upregulated in KP sh Pcyt2 -KO cells relative to cells complemented with sgRNA-resistant Pcyt2 cDNA following 6 days of dox withdrawal to activate p53 ( c ). d , Representative transmission electron microscope images from Pcyt2 -KO or Pcyt2 -KO complemented with guide-resistant Pcyt2 cDNA KP sh cells cultured on or off dox for 6 days. Scale bars as indicated. e , Population doublings of Pcyt2 -KO or Pcyt2 -KO complemented with guide-resistant Pcyt2 cDNA KP sh cells cultured on or off dox for indicated times. f , g , Tumour growth curve ( f ) or endpoint tumour volumes ( g ) for Pcyt2 -KO and Pcyt2 -KO complemented with guide-resistant Pcyt2 cDNA KP sh cell line xenograft maintained on dox chow ( sgPcyt2 , n = 8; sgPcyt2 + cDNA, n = 10) or withdrawn from dox chow ( sgPcyt2 , n = 12; sgPcyt2 + cDNA, n = 12) for 3 weeks. Otherwise, data represent n = 3 independently treated wells. Data are presented as mean ± s.d. ( a , e and g ) or s.e.m. ( f ), and statistical significance was assessed by two-sided Holm–Šídák method for multiple unpaired t- tests ( a ), Fisher’s exact test and adjusted for multiple testing using the Benjamini–Hochberg false discovery rate ( c ) or unpaired, two-tailed Student’s t- test ( g ). * P < 0.05, ** P < 0.01.
    Vectors Expressing Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+expression+vector/psPAX2+(Plasmid+%2312260)/pmc12904796-259-7-18
    Average 98 stars, based on 1 article reviews
    vectors expressing sgrna - by Bioz Stars, 2026-10
    98/100 stars
      Buy from Supplier

    96
    Addgene inc sgrna expression vector pcrispria v2
    a , PEtn levels in parental KP sh and clonal KP sh cells expressing <t>sgRNA</t> and complemented with guide-resistant <t>Pcyt2</t> <t>cDNA</t> as indicated cultured on or off dox for 6 days ( P values, left to right: 0.0183, 0.0341, 0.0068 and 0.0104). b , c , PCA of RNA-seq ( b ) and bubble plot of pathway overrepresentation for genes that are upregulated in KP sh Pcyt2 -KO cells relative to cells complemented with sgRNA-resistant Pcyt2 cDNA following 6 days of dox withdrawal to activate p53 ( c ). d , Representative transmission electron microscope images from Pcyt2 -KO or Pcyt2 -KO complemented with guide-resistant Pcyt2 cDNA KP sh cells cultured on or off dox for 6 days. Scale bars as indicated. e , Population doublings of Pcyt2 -KO or Pcyt2 -KO complemented with guide-resistant Pcyt2 cDNA KP sh cells cultured on or off dox for indicated times. f , g , Tumour growth curve ( f ) or endpoint tumour volumes ( g ) for Pcyt2 -KO and Pcyt2 -KO complemented with guide-resistant Pcyt2 cDNA KP sh cell line xenograft maintained on dox chow ( sgPcyt2 , n = 8; sgPcyt2 + cDNA, n = 10) or withdrawn from dox chow ( sgPcyt2 , n = 12; sgPcyt2 + cDNA, n = 12) for 3 weeks. Otherwise, data represent n = 3 independently treated wells. Data are presented as mean ± s.d. ( a , e and g ) or s.e.m. ( f ), and statistical significance was assessed by two-sided Holm–Šídák method for multiple unpaired t- tests ( a ), Fisher’s exact test and adjusted for multiple testing using the Benjamini–Hochberg false discovery rate ( c ) or unpaired, two-tailed Student’s t- test ( g ). * P < 0.05, ** P < 0.01.
    Sgrna Expression Vector Pcrispria V2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+expression+vector/pCRISPRia-v2+(Plasmid+%2384832)/pm41422267-207-34-38
    Average 96 stars, based on 1 article reviews
    sgrna expression vector pcrispria v2 - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    Image Search Results


    A. Schematic of the XBP1-Venus IRE1 splicing reporter. B . Expression, measured by qPCR, of the IRE1/XBP1s target genes XBP1s and ERDJ4/DNAJB9 in HEK293 cells expressing non-targeting or SLC33A1 shRNA and treated for 4 h with Tg (0.5 µM) or IXA4 (10 µM). C . Expression, measured by qPCR, of the IRE1 target genes Xbp1s and Erdj4/Dnajb9 , the ATF6 target gene BiP , and the PERK target gene Chop in MEF cells CRISPR-deleted of Slc33a1 using two distinct sgRNA and treated for 4 h with IXA4 (10 µM). MEF cells expressing two distinct non-targeting sgRNAs are shown as a control. D . Expression, measured by qPCR, of the IRE1 target gene XBP1s in non-targeting HEK293 cells or HEK293 cells lacking SLC33A1 transfected with mock or wild-type SLC33A1, as indicated, and then treated for 4 h with Tg (0.5 µM) or IXA4 (10 µM). E . Immunoblots of the indicated proteins in HEK293T cells expressing non-targeting or SLC33A1 sgRNAs treated for 4 h with IXA4 (10 µM). Black asterisks in ( C ) represent comparisons between vehicle-treated control cells expressing NT sgRNA #1 and mutant cells treated with or without IXA4. Red asterisks in ( C ) indicate comparisons between vehicle and IXA4-treated samples. *p<0.05, **p<0.01, ***p<0.005, one-way ANOVA.

    Journal: bioRxiv

    Article Title: Pharmacological Inhibition of SLC33A1 Promotes Endoplasmic Reticulum Hyperoxidation and Induces Adaptive IRE1/XBP1s Signaling

    doi: 10.64898/2026.02.17.706344

    Figure Lengend Snippet: A. Schematic of the XBP1-Venus IRE1 splicing reporter. B . Expression, measured by qPCR, of the IRE1/XBP1s target genes XBP1s and ERDJ4/DNAJB9 in HEK293 cells expressing non-targeting or SLC33A1 shRNA and treated for 4 h with Tg (0.5 µM) or IXA4 (10 µM). C . Expression, measured by qPCR, of the IRE1 target genes Xbp1s and Erdj4/Dnajb9 , the ATF6 target gene BiP , and the PERK target gene Chop in MEF cells CRISPR-deleted of Slc33a1 using two distinct sgRNA and treated for 4 h with IXA4 (10 µM). MEF cells expressing two distinct non-targeting sgRNAs are shown as a control. D . Expression, measured by qPCR, of the IRE1 target gene XBP1s in non-targeting HEK293 cells or HEK293 cells lacking SLC33A1 transfected with mock or wild-type SLC33A1, as indicated, and then treated for 4 h with Tg (0.5 µM) or IXA4 (10 µM). E . Immunoblots of the indicated proteins in HEK293T cells expressing non-targeting or SLC33A1 sgRNAs treated for 4 h with IXA4 (10 µM). Black asterisks in ( C ) represent comparisons between vehicle-treated control cells expressing NT sgRNA #1 and mutant cells treated with or without IXA4. Red asterisks in ( C ) indicate comparisons between vehicle and IXA4-treated samples. *p<0.05, **p<0.01, ***p<0.005, one-way ANOVA.

    Article Snippet: To clone individual sgRNAs, top and bottom oligonucleotides (IDT) were annealed and ligated to lentiviral sgRNA expression vectors LentiGuide-puromycin (Addgene #52963), LentiCRISPRv2-puromycin (Addgene #98290), or LentiCRISPRv2-blasticidin (Addgene #98293)).

    Techniques: Expressing, shRNA, CRISPR, Control, Transfection, Western Blot, Mutagenesis

    A . XBP1-Venus reporter signal, measured by flow cytometry, in HEK293 cells stably expressing Cas9 and transduced with lentivirus encoding non-targeting (NT) or IRE1 sgRNA treated for 14 h with vehicle or IXA4 (10 µM). B . CRISPR screen used to identify genes whose deletion blocks IXA4-induced IRE1 activation. C . Plot showing gene score (DMSO) vs. gene score (IXA4), quantified as previously defined , from genome-wide CRISPR screen. D . XBP1-Venus signal, measured by flow cytometry, in HEK293 cells stably expressing Cas9 and transduced with lentivirus encoding non-targeting (NT) or SLC33A1 sgRNA treated for 14 h with vehicle or IXA4 (10 µM). E . Expression, measured by qPCR, of the IRE1 target genes XBP1s and DNAJB9 , the ATF6 target gene BiP, and the PERK target gene CHOP in HEK293 cells stably expressing Cas9 transduced with lentivirus encoding NT or SLC33A1 sgRNA treated for 4 h with vehicle, IXA4 (10 µM) or Tg (0.5 µM). *p<0.05, ***p<0.005 one-way ANOVA.

    Journal: bioRxiv

    Article Title: Pharmacological Inhibition of SLC33A1 Promotes Endoplasmic Reticulum Hyperoxidation and Induces Adaptive IRE1/XBP1s Signaling

    doi: 10.64898/2026.02.17.706344

    Figure Lengend Snippet: A . XBP1-Venus reporter signal, measured by flow cytometry, in HEK293 cells stably expressing Cas9 and transduced with lentivirus encoding non-targeting (NT) or IRE1 sgRNA treated for 14 h with vehicle or IXA4 (10 µM). B . CRISPR screen used to identify genes whose deletion blocks IXA4-induced IRE1 activation. C . Plot showing gene score (DMSO) vs. gene score (IXA4), quantified as previously defined , from genome-wide CRISPR screen. D . XBP1-Venus signal, measured by flow cytometry, in HEK293 cells stably expressing Cas9 and transduced with lentivirus encoding non-targeting (NT) or SLC33A1 sgRNA treated for 14 h with vehicle or IXA4 (10 µM). E . Expression, measured by qPCR, of the IRE1 target genes XBP1s and DNAJB9 , the ATF6 target gene BiP, and the PERK target gene CHOP in HEK293 cells stably expressing Cas9 transduced with lentivirus encoding NT or SLC33A1 sgRNA treated for 4 h with vehicle, IXA4 (10 µM) or Tg (0.5 µM). *p<0.05, ***p<0.005 one-way ANOVA.

    Article Snippet: To clone individual sgRNAs, top and bottom oligonucleotides (IDT) were annealed and ligated to lentiviral sgRNA expression vectors LentiGuide-puromycin (Addgene #52963), LentiCRISPRv2-puromycin (Addgene #98290), or LentiCRISPRv2-blasticidin (Addgene #98293)).

    Techniques: Flow Cytometry, Stable Transfection, Expressing, Transduction, CRISPR, Activation Assay, Genome Wide

    A. XBP1-Rluc signal in HEK293 cells stably expressing XBP1-RLuc treated with the indicated concentration of IXA4 or PTG2018 in the presence or absence of the IRE1 RNAse inhibitor 4µ8c (32 µM) for 14 h. Data are normalized to the XBP1-RLuc signal seen in cells treated with thapsigargin (Tg; 0.5 µM). Error bars show SEM for n=3 replicates. B . Dose-dependent proteome labeling with PTG2018 (left, rhodamine fluorescence; right, Coomassie stain). PTG2018-labeled proteins were identified by appending TAMRA-azide to PTG2018 via click chemistry. C . Streptavidin affinity purification and proteomes (input) from HEK293T cells overexpressing FLAG-tagged EPHX1 and treated with the indicated concentration of PTG2018 and IXA4. PTG2018 labeling of FLAG-tagged EPHX1 was visualized by appending a biotin to the alkyne handle of PTG2018 using click chemistry and monitoring the recovery of FLAG-tagged protein in streptavidin isolates. Mock transfected cells are shown as a control. D . Streptavidin affinity purification and proteomes (input) from HEK293T cells treated with the indicated concentration of PTG2018 and IXA4. PTG2018 labeling of SOAT1 was visualized by appending biotin to the alkyne handle of PTG2018 via click chemistry and monitoring the recovery the recovery of endogenous SOAT1 in streptavidin isolates. E , F . XBP1-Venus signal, measured by flow cytometry, in HEK293 cell stably expressing Cas9 and transduced with lentivirus encoding non-targeting (NT), SOAT1 or EPHX1 sgRNA treated for 14 h with vehicle or IXA4 (10 µM).

    Journal: bioRxiv

    Article Title: Pharmacological Inhibition of SLC33A1 Promotes Endoplasmic Reticulum Hyperoxidation and Induces Adaptive IRE1/XBP1s Signaling

    doi: 10.64898/2026.02.17.706344

    Figure Lengend Snippet: A. XBP1-Rluc signal in HEK293 cells stably expressing XBP1-RLuc treated with the indicated concentration of IXA4 or PTG2018 in the presence or absence of the IRE1 RNAse inhibitor 4µ8c (32 µM) for 14 h. Data are normalized to the XBP1-RLuc signal seen in cells treated with thapsigargin (Tg; 0.5 µM). Error bars show SEM for n=3 replicates. B . Dose-dependent proteome labeling with PTG2018 (left, rhodamine fluorescence; right, Coomassie stain). PTG2018-labeled proteins were identified by appending TAMRA-azide to PTG2018 via click chemistry. C . Streptavidin affinity purification and proteomes (input) from HEK293T cells overexpressing FLAG-tagged EPHX1 and treated with the indicated concentration of PTG2018 and IXA4. PTG2018 labeling of FLAG-tagged EPHX1 was visualized by appending a biotin to the alkyne handle of PTG2018 using click chemistry and monitoring the recovery of FLAG-tagged protein in streptavidin isolates. Mock transfected cells are shown as a control. D . Streptavidin affinity purification and proteomes (input) from HEK293T cells treated with the indicated concentration of PTG2018 and IXA4. PTG2018 labeling of SOAT1 was visualized by appending biotin to the alkyne handle of PTG2018 via click chemistry and monitoring the recovery the recovery of endogenous SOAT1 in streptavidin isolates. E , F . XBP1-Venus signal, measured by flow cytometry, in HEK293 cell stably expressing Cas9 and transduced with lentivirus encoding non-targeting (NT), SOAT1 or EPHX1 sgRNA treated for 14 h with vehicle or IXA4 (10 µM).

    Article Snippet: To clone individual sgRNAs, top and bottom oligonucleotides (IDT) were annealed and ligated to lentiviral sgRNA expression vectors LentiGuide-puromycin (Addgene #52963), LentiCRISPRv2-puromycin (Addgene #98290), or LentiCRISPRv2-blasticidin (Addgene #98293)).

    Techniques: Stable Transfection, Expressing, Concentration Assay, Labeling, Fluorescence, Staining, Affinity Purification, Transfection, Control, Flow Cytometry, Transduction

    A. [ 3 H]-acetyl-CoA uptake by ER microsomes (50 µg protein) isolated from HEK293T cells treated with/without IXA4 (10 µM) during the uptake assay. B . [ 3 H]-acetyl-CoA uptake by ER microsomes (50 µg protein) isolated from HEK293T cells expressing Cas9 and non-targeting (NT) or SLC33A1 sgRNA. C , D . Relative acetyl-CoA abundance ( C ) and oxidized glutathione abundance (GSSG; D ) in whole cell or ER isolated from HEK293T cells with non-targeting (NT) sgRNA or sgRNA targeting SLC33A1. Cells were treated with IXA4 (10 µM) for 4 h before ER isolation and LC/MS analysis. E . Immunoblot of DNAJC10 and PDIA4 in proteomes prepared from HeLa cells treated for 1 h with IXA4 (10 µM), DTT (5 mM), or diamide (500 µM). Following lysis in the presence of alkylating agents, disulfides within these proteins were reduced and then labeled with PEG(5K)-maleimide (2 mM), allowing visualization of oxidized and reduced protein populations. F . Immunoblot of proteomes from Ire1 -/- MEFs reconstituted with wild-type or a C148S IRE1 mutant, treated for 2 h with IXA4 (10 µM) or thapsigargin (Tg; 0.5 µM), and separated on a non-reducing SDS-PAGE gel. Oxidized and reduced IRE1 populations are shown. G . XBP1s levels, measured by qPCR, in HEK293T cells pre-treated for 18 h with BSO (50 µM) and then treated for 3 h with IXA4 (10 µM). H . Viability, assessed with CellTiter-Glo, of KP and KPK cells treated for 3 days with IXA4 (10 µM) or thapsigargin (Tg; 0.5 µM). I . Viability, assessed with CellTiter-Glo, of KP and KPK cells treated for 3 days with IXA4 (10 µM), BSO (50 µM), and 4µ8c (32 µM). *p<0.05, ***p<0.005, one-way ANOVA.

    Journal: bioRxiv

    Article Title: Pharmacological Inhibition of SLC33A1 Promotes Endoplasmic Reticulum Hyperoxidation and Induces Adaptive IRE1/XBP1s Signaling

    doi: 10.64898/2026.02.17.706344

    Figure Lengend Snippet: A. [ 3 H]-acetyl-CoA uptake by ER microsomes (50 µg protein) isolated from HEK293T cells treated with/without IXA4 (10 µM) during the uptake assay. B . [ 3 H]-acetyl-CoA uptake by ER microsomes (50 µg protein) isolated from HEK293T cells expressing Cas9 and non-targeting (NT) or SLC33A1 sgRNA. C , D . Relative acetyl-CoA abundance ( C ) and oxidized glutathione abundance (GSSG; D ) in whole cell or ER isolated from HEK293T cells with non-targeting (NT) sgRNA or sgRNA targeting SLC33A1. Cells were treated with IXA4 (10 µM) for 4 h before ER isolation and LC/MS analysis. E . Immunoblot of DNAJC10 and PDIA4 in proteomes prepared from HeLa cells treated for 1 h with IXA4 (10 µM), DTT (5 mM), or diamide (500 µM). Following lysis in the presence of alkylating agents, disulfides within these proteins were reduced and then labeled with PEG(5K)-maleimide (2 mM), allowing visualization of oxidized and reduced protein populations. F . Immunoblot of proteomes from Ire1 -/- MEFs reconstituted with wild-type or a C148S IRE1 mutant, treated for 2 h with IXA4 (10 µM) or thapsigargin (Tg; 0.5 µM), and separated on a non-reducing SDS-PAGE gel. Oxidized and reduced IRE1 populations are shown. G . XBP1s levels, measured by qPCR, in HEK293T cells pre-treated for 18 h with BSO (50 µM) and then treated for 3 h with IXA4 (10 µM). H . Viability, assessed with CellTiter-Glo, of KP and KPK cells treated for 3 days with IXA4 (10 µM) or thapsigargin (Tg; 0.5 µM). I . Viability, assessed with CellTiter-Glo, of KP and KPK cells treated for 3 days with IXA4 (10 µM), BSO (50 µM), and 4µ8c (32 µM). *p<0.05, ***p<0.005, one-way ANOVA.

    Article Snippet: To clone individual sgRNAs, top and bottom oligonucleotides (IDT) were annealed and ligated to lentiviral sgRNA expression vectors LentiGuide-puromycin (Addgene #52963), LentiCRISPRv2-puromycin (Addgene #98290), or LentiCRISPRv2-blasticidin (Addgene #98293)).

    Techniques: Isolation, Expressing, Liquid Chromatography with Mass Spectroscopy, Western Blot, Lysis, Labeling, Mutagenesis, SDS Page

    A . In-gel fluorescence of acetylated proteins in ER and mitochondrial fractions isolated from HEK293T cells treated for 3 h with IXA4 (10 µM) and then incubated for 1 h with 3-butynoic acid. Acetylated proteins were identified by appending a rhodamine tag onto the 3-butynoic acid probe via click chemistry. B . In-gel fluorescence of acetylated proteins in ER fractions isolated from HEK293T Cas9 cells expressing non-targeting (NT) or SLC33A1 sgRNA incubated for 1 h with the 3-butynoic acid probe. Acetylated proteins were then identified by appending a rhodamine tag onto the 3-butynoic acid probe via click chemistry. C . Expression (published DNA microarrays) of IRE1/XBP1s, ATF6, and PERK target genesets in HEK293T cells overexpressing the ER oxidase ERO1. Source data available in GEO (GSE40601). D . XBP1 mRNA splicing (RT-PCR) in IRE1 -deficient HeLa cells transfected with wild-type IRE1 or a C109S/C148S/C332S IRE1 triple mutant and treated for 2 h with IXA4 (10 µM) or thapsigargin (Tg; 0.5 µM). Unspliced (u), spliced (s), and hybrid (*), XBP1 are shown. E . Crystal violet stained KPK cells treated for 2 days with thapsigargin (Tg; 0.5 µM) or IXA4 (10 µM). F . Crystal violet stained KPK cells incubated for 2 days with IXA4 (10 µM) and/or BSO (50 µM). p<0.05, **p<0.01, ***p<0.005, one-way ANOVA.

    Journal: bioRxiv

    Article Title: Pharmacological Inhibition of SLC33A1 Promotes Endoplasmic Reticulum Hyperoxidation and Induces Adaptive IRE1/XBP1s Signaling

    doi: 10.64898/2026.02.17.706344

    Figure Lengend Snippet: A . In-gel fluorescence of acetylated proteins in ER and mitochondrial fractions isolated from HEK293T cells treated for 3 h with IXA4 (10 µM) and then incubated for 1 h with 3-butynoic acid. Acetylated proteins were identified by appending a rhodamine tag onto the 3-butynoic acid probe via click chemistry. B . In-gel fluorescence of acetylated proteins in ER fractions isolated from HEK293T Cas9 cells expressing non-targeting (NT) or SLC33A1 sgRNA incubated for 1 h with the 3-butynoic acid probe. Acetylated proteins were then identified by appending a rhodamine tag onto the 3-butynoic acid probe via click chemistry. C . Expression (published DNA microarrays) of IRE1/XBP1s, ATF6, and PERK target genesets in HEK293T cells overexpressing the ER oxidase ERO1. Source data available in GEO (GSE40601). D . XBP1 mRNA splicing (RT-PCR) in IRE1 -deficient HeLa cells transfected with wild-type IRE1 or a C109S/C148S/C332S IRE1 triple mutant and treated for 2 h with IXA4 (10 µM) or thapsigargin (Tg; 0.5 µM). Unspliced (u), spliced (s), and hybrid (*), XBP1 are shown. E . Crystal violet stained KPK cells treated for 2 days with thapsigargin (Tg; 0.5 µM) or IXA4 (10 µM). F . Crystal violet stained KPK cells incubated for 2 days with IXA4 (10 µM) and/or BSO (50 µM). p<0.05, **p<0.01, ***p<0.005, one-way ANOVA.

    Article Snippet: To clone individual sgRNAs, top and bottom oligonucleotides (IDT) were annealed and ligated to lentiviral sgRNA expression vectors LentiGuide-puromycin (Addgene #52963), LentiCRISPRv2-puromycin (Addgene #98290), or LentiCRISPRv2-blasticidin (Addgene #98293)).

    Techniques: Fluorescence, Isolation, Incubation, Expressing, Reverse Transcription Polymerase Chain Reaction, Transfection, Mutagenesis, Staining

    a , PEtn levels in parental KP sh and clonal KP sh cells expressing sgRNA and complemented with guide-resistant Pcyt2 cDNA as indicated cultured on or off dox for 6 days ( P values, left to right: 0.0183, 0.0341, 0.0068 and 0.0104). b , c , PCA of RNA-seq ( b ) and bubble plot of pathway overrepresentation for genes that are upregulated in KP sh Pcyt2 -KO cells relative to cells complemented with sgRNA-resistant Pcyt2 cDNA following 6 days of dox withdrawal to activate p53 ( c ). d , Representative transmission electron microscope images from Pcyt2 -KO or Pcyt2 -KO complemented with guide-resistant Pcyt2 cDNA KP sh cells cultured on or off dox for 6 days. Scale bars as indicated. e , Population doublings of Pcyt2 -KO or Pcyt2 -KO complemented with guide-resistant Pcyt2 cDNA KP sh cells cultured on or off dox for indicated times. f , g , Tumour growth curve ( f ) or endpoint tumour volumes ( g ) for Pcyt2 -KO and Pcyt2 -KO complemented with guide-resistant Pcyt2 cDNA KP sh cell line xenograft maintained on dox chow ( sgPcyt2 , n = 8; sgPcyt2 + cDNA, n = 10) or withdrawn from dox chow ( sgPcyt2 , n = 12; sgPcyt2 + cDNA, n = 12) for 3 weeks. Otherwise, data represent n = 3 independently treated wells. Data are presented as mean ± s.d. ( a , e and g ) or s.e.m. ( f ), and statistical significance was assessed by two-sided Holm–Šídák method for multiple unpaired t- tests ( a ), Fisher’s exact test and adjusted for multiple testing using the Benjamini–Hochberg false discovery rate ( c ) or unpaired, two-tailed Student’s t- test ( g ). * P < 0.05, ** P < 0.01.

    Journal: Nature Cell Biology

    Article Title: p53 increases phospholipid headgroup scavenging in senescence

    doi: 10.1038/s41556-025-01853-0

    Figure Lengend Snippet: a , PEtn levels in parental KP sh and clonal KP sh cells expressing sgRNA and complemented with guide-resistant Pcyt2 cDNA as indicated cultured on or off dox for 6 days ( P values, left to right: 0.0183, 0.0341, 0.0068 and 0.0104). b , c , PCA of RNA-seq ( b ) and bubble plot of pathway overrepresentation for genes that are upregulated in KP sh Pcyt2 -KO cells relative to cells complemented with sgRNA-resistant Pcyt2 cDNA following 6 days of dox withdrawal to activate p53 ( c ). d , Representative transmission electron microscope images from Pcyt2 -KO or Pcyt2 -KO complemented with guide-resistant Pcyt2 cDNA KP sh cells cultured on or off dox for 6 days. Scale bars as indicated. e , Population doublings of Pcyt2 -KO or Pcyt2 -KO complemented with guide-resistant Pcyt2 cDNA KP sh cells cultured on or off dox for indicated times. f , g , Tumour growth curve ( f ) or endpoint tumour volumes ( g ) for Pcyt2 -KO and Pcyt2 -KO complemented with guide-resistant Pcyt2 cDNA KP sh cell line xenograft maintained on dox chow ( sgPcyt2 , n = 8; sgPcyt2 + cDNA, n = 10) or withdrawn from dox chow ( sgPcyt2 , n = 12; sgPcyt2 + cDNA, n = 12) for 3 weeks. Otherwise, data represent n = 3 independently treated wells. Data are presented as mean ± s.d. ( a , e and g ) or s.e.m. ( f ), and statistical significance was assessed by two-sided Holm–Šídák method for multiple unpaired t- tests ( a ), Fisher’s exact test and adjusted for multiple testing using the Benjamini–Hochberg false discovery rate ( c ) or unpaired, two-tailed Student’s t- test ( g ). * P < 0.05, ** P < 0.01.

    Article Snippet: Lentivirus was generated by cotransfection of viral vectors expressing sgRNA or cDNA of interest with packaging plasmids psPAX2 (Addgene, 12260) and pMD2.G (Addgene, 12259) into 293T cells.

    Techniques: Expressing, Cell Culture, RNA Sequencing, Transmission Assay, Microscopy, Two Tailed Test

    a , Schematic depicting the metabolism-focused CRISPR genetic screens in KP sh cells. Cells were sequenced at day 0 (prior to dox withdrawal) and then after 10 days of additional growth with or without dox. b , Scatter plot showing normalized counts for each gene at day 0 (x-axis) and log 2 foldchange in normalized counts between day 10 and day 0 (y axis). Left: p53 off, right: p53 on. Genes highlighted in orange are genes differentially essential in p53-on cells, as shown in Fig. . c , Scatter plot comparing changes in gene expression induced by p53 activation (x-axis, log 2 fold change in expression KP sh cells cultured -dox compared to cells cultured +dox) with changes in gene scores following p53 activation (y-axis, gene scores determined by comparing sgRNA abundance of cells following 10 days culture with or without dox). Pearson correlation (two-sided) r = −0.10, P < 5.2 ×10 −8 . Genes both induced by p53 and more essential following p53 activation (log 2 fold change > 0.4; screen enrichment difference < −0.2) are highlighted in orange. Data are available in Supplementary Table . d , Bubble plot of pathway enrichment for genes highlighted in ( c ). e , Volcano plot showing pathways from gene set enrichment analysis (GSEA) analysis of genes co-expressed with HNF4A in pancreatic cancer cell lines in DepMap. Each dot present one pathway. f , GSEA plot showing lipid metabolism related pathways enriched among genes exhibiting similar expression patterns as HNF4A . g,h , Normalized counts individual sgRNA targeting Cers2 ( g ) and Hnf4a ( h ) in indicated conditions from the screen (P value: g = 0.0469, h = 0.0078). i , Scatter plot of DepMap gene effect versus log2 fold change in gene score (-dox/+dox at day 10) in KP sh cells. Each dot represents a gene; Cers2 and Hnf4a are highlighted in cyan and blue. j,k , Western blot of KP sh cells expressing sgRNA targeting Cers2 ( j ) and Hnf4a ( k ). Statistical significance was assessed by Fisher’s Exact test and adjusted for multiple testing using the Benjamini-Hochberg false discovery rate ( d ), GSEA ( e ), or Wilcoxon matched-pairs two-tails signed rank test ( g, h ). Source numerical data and unprocessed blots are available in source data.

    Journal: Nature Cell Biology

    Article Title: p53 increases phospholipid headgroup scavenging in senescence

    doi: 10.1038/s41556-025-01853-0

    Figure Lengend Snippet: a , Schematic depicting the metabolism-focused CRISPR genetic screens in KP sh cells. Cells were sequenced at day 0 (prior to dox withdrawal) and then after 10 days of additional growth with or without dox. b , Scatter plot showing normalized counts for each gene at day 0 (x-axis) and log 2 foldchange in normalized counts between day 10 and day 0 (y axis). Left: p53 off, right: p53 on. Genes highlighted in orange are genes differentially essential in p53-on cells, as shown in Fig. . c , Scatter plot comparing changes in gene expression induced by p53 activation (x-axis, log 2 fold change in expression KP sh cells cultured -dox compared to cells cultured +dox) with changes in gene scores following p53 activation (y-axis, gene scores determined by comparing sgRNA abundance of cells following 10 days culture with or without dox). Pearson correlation (two-sided) r = −0.10, P < 5.2 ×10 −8 . Genes both induced by p53 and more essential following p53 activation (log 2 fold change > 0.4; screen enrichment difference < −0.2) are highlighted in orange. Data are available in Supplementary Table . d , Bubble plot of pathway enrichment for genes highlighted in ( c ). e , Volcano plot showing pathways from gene set enrichment analysis (GSEA) analysis of genes co-expressed with HNF4A in pancreatic cancer cell lines in DepMap. Each dot present one pathway. f , GSEA plot showing lipid metabolism related pathways enriched among genes exhibiting similar expression patterns as HNF4A . g,h , Normalized counts individual sgRNA targeting Cers2 ( g ) and Hnf4a ( h ) in indicated conditions from the screen (P value: g = 0.0469, h = 0.0078). i , Scatter plot of DepMap gene effect versus log2 fold change in gene score (-dox/+dox at day 10) in KP sh cells. Each dot represents a gene; Cers2 and Hnf4a are highlighted in cyan and blue. j,k , Western blot of KP sh cells expressing sgRNA targeting Cers2 ( j ) and Hnf4a ( k ). Statistical significance was assessed by Fisher’s Exact test and adjusted for multiple testing using the Benjamini-Hochberg false discovery rate ( d ), GSEA ( e ), or Wilcoxon matched-pairs two-tails signed rank test ( g, h ). Source numerical data and unprocessed blots are available in source data.

    Article Snippet: Lentivirus was generated by cotransfection of viral vectors expressing sgRNA or cDNA of interest with packaging plasmids psPAX2 (Addgene, 12260) and pMD2.G (Addgene, 12259) into 293T cells.

    Techniques: CRISPR, Gene Expression, Activation Assay, Expressing, Cell Culture, Western Blot