sds page running buffer powder (Servicebio Inc)

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Servicebio Inc sds page running buffer powder

XRN2 is a new partner of MEIOC and involved in RMY-dependent RNA repression (A) Immunoprecipitated MEIOC complexes were separated <t>by</t> <t>SDS-PAGE</t> and the protein in the gel was stained with silver prior to mass spectrometry (MS). (B) Related proteins in MEIOC complex were identified by MS. (C) Cytoplasm and nuclei were separated from HEK293T cells transfected with MEIOC and YTHDC2 (M + Y). Lamin B1 was used as a nuclear marker and GADPH as a cytoplasmic marker, N = 3. (D) XRN2 protein was co-immunoprecipitated with MEIOC. IgG was used as a negative control. N = 3. (E) Western blot analysis of MEIOC and XNR2 protein. A lentivirus containing HIS-MEIOC infected HEK293T cells. The cells were lysed with RIPA buffer and then coIP assay was performed with anti-XRN2 antibody. IgG was used as a negative control. N = 3. (F) Western blot analysis of XRN2 and β-Actin from HEK293T cells transfected with XRN2 siRNAs and control siRNA, N = 3. (G) RT-qPCR analysis showing relative mRNA levels of XRN2 in HEK293T cells transfected with XRN2 siRNAs and control siRNA, N = 3. (H) Relative luciferase activities of F-Luc-Rad21 3′UTR in HEK293T cells after knockdown of XRN2 only or combined with the expression of RBM46, MEIOC and YTHDC2 (RMY). N = 3. Data are presented as mean ± SEM. p values were determined by unpaired t test with Welch’s correction (C–E) or by one-way ANOVA with Benjamini-Hochberg correction (F–H). (I) A model of RMY complex assembly and target mRNA degradation.

Sds Page Running Buffer Powder, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sds+running+buffer/buffer+loading/pmc13254979-126-0-5
Average 86 stars, based on 1 article reviews

sds page running buffer powder - by Bioz Stars, 2026-09

86/100 stars

Images

1) Product Images from "A mechanism of target mRNA selection and activity regulation in meiosis-related RBM46-MEIOC-YTHDC2 complex"

Article Title: A mechanism of target mRNA selection and activity regulation in meiosis-related RBM46-MEIOC-YTHDC2 complex

Journal: iScience

doi: 10.1016/j.isci.2026.116234

XRN2 is a new partner of MEIOC and involved in RMY-dependent RNA repression (A) Immunoprecipitated MEIOC complexes were separated by SDS-PAGE and the protein in the gel was stained with silver prior to mass spectrometry (MS). (B) Related proteins in MEIOC complex were identified by MS. (C) Cytoplasm and nuclei were separated from HEK293T cells transfected with MEIOC and YTHDC2 (M + Y). Lamin B1 was used as a nuclear marker and GADPH as a cytoplasmic marker, N = 3. (D) XRN2 protein was co-immunoprecipitated with MEIOC. IgG was used as a negative control. N = 3. (E) Western blot analysis of MEIOC and XNR2 protein. A lentivirus containing HIS-MEIOC infected HEK293T cells. The cells were lysed with RIPA buffer and then coIP assay was performed with anti-XRN2 antibody. IgG was used as a negative control. N = 3. (F) Western blot analysis of XRN2 and β-Actin from HEK293T cells transfected with XRN2 siRNAs and control siRNA, N = 3. (G) RT-qPCR analysis showing relative mRNA levels of XRN2 in HEK293T cells transfected with XRN2 siRNAs and control siRNA, N = 3. (H) Relative luciferase activities of F-Luc-Rad21 3′UTR in HEK293T cells after knockdown of XRN2 only or combined with the expression of RBM46, MEIOC and YTHDC2 (RMY). N = 3. Data are presented as mean ± SEM. p values were determined by unpaired t test with Welch’s correction (C–E) or by one-way ANOVA with Benjamini-Hochberg correction (F–H). (I) A model of RMY complex assembly and target mRNA degradation.

Figure Legend Snippet: XRN2 is a new partner of MEIOC and involved in RMY-dependent RNA repression (A) Immunoprecipitated MEIOC complexes were separated by SDS-PAGE and the protein in the gel was stained with silver prior to mass spectrometry (MS). (B) Related proteins in MEIOC complex were identified by MS. (C) Cytoplasm and nuclei were separated from HEK293T cells transfected with MEIOC and YTHDC2 (M + Y). Lamin B1 was used as a nuclear marker and GADPH as a cytoplasmic marker, N = 3. (D) XRN2 protein was co-immunoprecipitated with MEIOC. IgG was used as a negative control. N = 3. (E) Western blot analysis of MEIOC and XNR2 protein. A lentivirus containing HIS-MEIOC infected HEK293T cells. The cells were lysed with RIPA buffer and then coIP assay was performed with anti-XRN2 antibody. IgG was used as a negative control. N = 3. (F) Western blot analysis of XRN2 and β-Actin from HEK293T cells transfected with XRN2 siRNAs and control siRNA, N = 3. (G) RT-qPCR analysis showing relative mRNA levels of XRN2 in HEK293T cells transfected with XRN2 siRNAs and control siRNA, N = 3. (H) Relative luciferase activities of F-Luc-Rad21 3′UTR in HEK293T cells after knockdown of XRN2 only or combined with the expression of RBM46, MEIOC and YTHDC2 (RMY). N = 3. Data are presented as mean ± SEM. p values were determined by unpaired t test with Welch’s correction (C–E) or by one-way ANOVA with Benjamini-Hochberg correction (F–H). (I) A model of RMY complex assembly and target mRNA degradation.

Techniques Used: Immunoprecipitation, SDS Page, Staining, Mass Spectrometry, Transfection, Marker, Negative Control, Western Blot, Infection, Co-Immunoprecipitation Assay, Control, Quantitative RT-PCR, Luciferase, Knockdown, Expressing

SDS Page:

Article Title: Lacto-N-Triose II Alleviates DSS-Induced Colitis via Gut Microbiota and Metabolites Associated with the PI3K-Akt Pathway.
Article Snippet: Ulcerative colitis (UC) is a chronic inflammatory bowel disease marked by intestinal barrier dysfunction, immune dysregulation, and gut microbiota dysbiosis.. This study examined the therapeutic potential of lacto-N-triose II (LNT II), a core component of human milk oligosaccharides, in colitis.. Results showed LNT II significantly alleviated disease pathology, restored epithelial barrier integrity, and modulated inflammatory responses.

Article Title: Traditional medicine Kuanxiong Aerosol alleviates atherosclerotic plaque inflammation by mitigating CX3CR1 + macrophage apoptosis via the cGAS-STING pathway.
Article Snippet: Background: Atherosclerosis (AS), a chronic inflammatory vascular disease, represents the leading cause of lethal cardiovascular events and demands innovative therapies targeting plaque inflammation.. Kuanxiong Aerosol (KX), a clinically used traditional Chinese medicine for angina, exhibits potent anti-inflammatory activities.. Purpose: This investigation aimed to explore the therapeutic potential and mechanism of KX for AS.

Article Title: Bidirectional transport studies of flavonoids from Alpiniae oxyphyllae fructus by in vitro inflammatory blood-brain barrier model combined with UHPLC-MS/MS analysis.
Article Snippet: Alpiniae oxyphyllae fructus (AOF) has been widely used for the treatment of central nervous system (CNS) diseases.. Flavonoids, namely, baicalein, wogonin, and pinocembrin, are bioactive components with neuroprotective effects against AOF.. Herein, a lipopolysaccharide (LPS)-induced in vitro inflammatory blood–brain barrier (BBB) model of a co-culture of hCMEC/D3 and HA1800 cells was constructed to investigate the permeability of flavonoids.

Article Title: A mechanism of target mRNA selection and activity regulation in meiosis-related RBM46-MEIOC-YTHDC2 complex
Article Snippet: PAGE Gel Rapid Preparation Kit , EPIZYME , Cat#PG111. .. SDS-PAGE running buffer powder , Servicebio , Cat#G2018-1L. .. Rapid Membrane Transfer Buffer , EPIZYME , Cat#PS109S.

Marker:

Electrophoresis:

Article Title: Micro-nano microbial fuel cell-driven bioelectrochemical tumor therapy
Article Snippet: Next, the electrophoresis system (BIO-RAD, Mini-PROTEAN Tetra System) was assembled. .. Tris-glycine-SDS running buffer (Servicebio) was added to the electrophoresis tank, and a 10% PAGE gel was placed in the system. ..

Polyacrylamide Gel Electrophoresis:

other:

Article Title: Multifunctional nanoparticles confers both multiple inflammatory mediators scavenging and macrophage polarization for sepsis therapy
Article Snippet: DNA ladder Phosphate Buffered Saline (PBS), Tris-Glycine SDS-PAGE Running Buffer, Tris-Glycine Transfer Buffer, Tris Buffered Saline (TBS), TNF-α Mouse Uncoated ELISA, and IL-6 Mouse Uncoated ELISA were obtained from Servicebio (Wuhan, China).

Article Title: Deciphering transcription activity of mammalian early embryos unveils on/off of zygotic genome activation by protein translation/degradation.
Article Snippet: The lysates were then electrophoresed on 10% SDS-polyacrylamide gel in Tris-Glycine SDS-PAGE Running Buffer(Servicebio, China)at 110 V for 60–90min and transferred onto polyvinylidene fluoride (PVDF)membranes (MerckMillipore, USA) at 350 mA for 1–2 h. Membranes were blocked in 3% BSA (w/v in PBS) for 1–2 h at room temperature, followed by incubation with primary antibody (anti-MFN1, Proteintech, China) at 4 C overnight in PBS with 1% Tween 20 (PBS-T) (BioFroxx, Germary).

Article Title: Deciphering transcription activity of mammalian early embryos unveils on/off of zygotic genome activation by protein translation/degradation.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antifade Mounting Medium Beyotime Cat#P0126 RIPA buffer Sangon Biotech Cat#C500005 phenylmethylsulfonyl fluoride (PMSF) Solarbio Cat#P0100 Tris-Glycine SDS-PAGE Running Buffer Servicebio Cat#G2018-1L Polyvinylidene fluoride (PVDF) membranes Merck Millipore Cat#C3117 Tween 20 BioFroxx Cat#1716 Critical commercial assays Universal CUT&Tag Assay Kit for Illumina Vazyme Cat#TD903 Hifair II 1st Strand cDNA Synthesis SuperMix Yeasen Cat#11120ES Hieff qPCR SYBR Green Master Mix(High Rox Plus) Yeasen Cat#11203ES EU RNA de novo assay kit RIBOBIO Cat#R11081 Deposited data mouse ChIP-seq data This study GEO: GSE241197, GSE241246 mouse RNA-seq data This study GEO: GSE241388 human ChIP-seq data This study GSA-Human: HRA005274 proteomics data This study ProteomeXchange: PXD042633 Experimental models: Cell lines AB2.2 This study ATCC Oligonucleotides (50-30) Mfn1-siRNA-antisense: AUGUCUCCGAGACAGCACCTT This study N/A Control-siRNA-antisense: ACGUGACACGUUCGGAGAATT This study N/A Mfn1-primer-sense: ATCACTGCAATCTTCGGCCA antisense: AGCAGTTGGTTGTGTGACCA This study N/A Zscan4-primer-sense: GAGATTCATGGAGAGTCTGACTGATGAGTG antisense: GCTGTTGTTTCAAAAGCTTGATGACTTC This study N/A Zfp352-primer-sense: ACCACCTCAAAGAACACCAG antisense: ACAAGGGACAAGCGTAGAAC This study N/A MERVL-primer-sense: CTTCCATTCACAGCTGCGACTG antisense: CTAGAACCACTCCTGGTACCAAC This study N/A Nelfa-primer-sense: GAAGGCGGCTCTGATGGATA antisense: GGTGGTCAGGGCATTCTTGT This study N/A Tcstv1-primer-sense: GGATCCCTGAAGGTAAATCCTC antisense: AACCATCCATCCTCAGGAAC This study N/A Gapdh-primer-sense: TCTTCCAGGAGCGAGACCC antisense: CGGAGATGATGACCCTTTT This study N/A Software and algorithms Trim Galore v0.6.4 The Babraham Institute https://www.bioinformatics.babraham. ac.uk/projects/trim_galore/ Bowtie2 v2.4.1 Langmead and Salzberg37 https://github.com/BenLangmead/bowtie2 Picard v2.26.6 Broad Institute https://broadinstitute.github.io/picard/ deepTools v3.5.1 Ramirez et al.38 https://github.com/deeptools/deepTools MACS2 v2.2.7.1 Zhang et al.39 https://pypi.org/project/MACS2/ ChIPseeker v1.34.1 Wang et al.40 https://bioconductor.org/packages/ release/bioc/html/ChIPseeker.html HOMER v4.11.1 Heinz et al.41 http://homer.ucsd.edu/homer/ ChIPpeakAnno v3.34.1 Zhu et al.42 https://bioconductor.org/packages/ release/bioc/html/ChIPpeakAnno.html R v4.1.2 N/A rhttps://www.r-project.org/ Mfuzz v2.54.0 Futschik and Carlisle43 https://bioconductor.org/packages/ release/bioc/html/Mfuzz.html (Continued on next page) Cell Reports 44, 115215, January 28, 2025 19

Review