quickchange kit (Qiagen)
Qiagen is a verified supplier 
Qiagen manufactures this product 
90
Structured Review
Qiagen
quickchange kit
Quickchange Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/quickchange/quickchange+kit/pmc12205366-60-26-28
Average 90 stars, based on 1 article reviews
Quickchange Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/quickchange/quickchange+kit/pmc12205366-60-26-28
Average 90 stars, based on 1 article reviews
quickchange kit - by Bioz Stars,
2026-10
90/100 stars
Images
Related Articles
other:Article Title: Tyrosine kinase inhibitors Article Snippet: Binding Assay:Article Title: Regulators of aldehyde dehydrogenase ALDH3A1 and related therapeutic methods Article Snippet: .. In order to characterize the binding pattern of CB7 to catalytic site of ALDH3A1, two important mutations Q122A and Q122W were made. oint mutations of ALDH3A1 were performed using Mutagenesis:Article Title: Regulators of aldehyde dehydrogenase ALDH3A1 and related therapeutic methods Article Snippet: .. In order to characterize the binding pattern of CB7 to catalytic site of ALDH3A1, two important mutations Q122A and Q122W were made. oint mutations of ALDH3A1 were performed using Article Title: Selective ALDH3A1 Inhibition by Benzimidazole Analogues Increase Mafosfamide Sensitivity in Cancer Cells Article Snippet: .. Point mutations of ALDH3A1 were performed using Article Title: Regulator of G protein signaling 2 (RGS2) and RGS4 form distinct G protein-dependent complexes with protease activated-receptor 1 (PAR1) in live cells. Article Snippet: .. To generate a Gq/11-insensitive mutant of PAR1 (R205A) [24] for BRET studies, the wild type mPAR1-Ven plasmid (above) was used as a template for Article Title: Selective ALDH3A1 Inhibition by Benzimidazole Analogues Increase Mafosfamide Sensitivity in Cancer Cells Article Snippet: .. Point mutations of ALDH3A1 were performed using Article Title: Regulator of G Protein Signaling 2 (RGS2) and RGS4 Form Distinct G Protein-Dependent Complexes with Protease Activated-Receptor 1 (PAR1) in Live Cells Article Snippet: .. To generate a G q/11 -insensitive mutant of PAR1 (R205A) for BRET studies, the wild type mPAR1-Ven plasmid (above) was used as a template for Bioluminescence Resonance Energy Transfer:Article Title: Regulator of G protein signaling 2 (RGS2) and RGS4 form distinct G protein-dependent complexes with protease activated-receptor 1 (PAR1) in live cells. Article Snippet: .. To generate a Gq/11-insensitive mutant of PAR1 (R205A) [24] for BRET studies, the wild type mPAR1-Ven plasmid (above) was used as a template for Article Title: Regulator of G Protein Signaling 2 (RGS2) and RGS4 Form Distinct G Protein-Dependent Complexes with Protease Activated-Receptor 1 (PAR1) in Live Cells Article Snippet: .. To generate a G q/11 -insensitive mutant of PAR1 (R205A) for BRET studies, the wild type mPAR1-Ven plasmid (above) was used as a template for Plasmid Preparation:Article Title: Regulator of G protein signaling 2 (RGS2) and RGS4 form distinct G protein-dependent complexes with protease activated-receptor 1 (PAR1) in live cells. Article Snippet: .. To generate a Gq/11-insensitive mutant of PAR1 (R205A) [24] for BRET studies, the wild type mPAR1-Ven plasmid (above) was used as a template for Article Title: Regulator of G Protein Signaling 2 (RGS2) and RGS4 Form Distinct G Protein-Dependent Complexes with Protease Activated-Receptor 1 (PAR1) in Live Cells Article Snippet: .. To generate a G q/11 -insensitive mutant of PAR1 (R205A) for BRET studies, the wild type mPAR1-Ven plasmid (above) was used as a template for Amplification:Article Title: Regulator of G protein signaling 2 (RGS2) and RGS4 form distinct G protein-dependent complexes with protease activated-receptor 1 (PAR1) in live cells. Article Snippet: .. To generate a Gq/11-insensitive mutant of PAR1 (R205A) [24] for BRET studies, the wild type mPAR1-Ven plasmid (above) was used as a template for Article Title: Regulator of G Protein Signaling 2 (RGS2) and RGS4 Form Distinct G Protein-Dependent Complexes with Protease Activated-Receptor 1 (PAR1) in Live Cells Article Snippet: .. To generate a G q/11 -insensitive mutant of PAR1 (R205A) for BRET studies, the wild type mPAR1-Ven plasmid (above) was used as a template for Generated:Article Title: Hereditary spastic paraplegia SPG13 mutation increases structural stability and ATPase activity of human mitochondrial chaperonin. Article Snippet: .. To remove the C-terminal 26 a.a. Gly-Met repeats, primers (5’) AAA CAT ATG GCT AAA GAT GTG AAG TTT and (3’) TTT CTT AAG TTA TGG GTC CTT CTC T were used to generate mHsp60GMless. mHsp60 mutants, mHsp60F72I, mHsp60V72A and their truncated counterparts were generated using Article Title: Hereditary spastic paraplegia SPG13 mutation increases structural stability and ATPase activity of human mitochondrial chaperonin Article Snippet: .. To remove the C-terminal 26 a.a. Gly-Met repeats, primers (5’) AAACATATGGCTAAAGATGTGAAGTTT and (3’) TTTCTTAAGTTATGGGTCCTTCTCT were used to generate mHsp60 GMless . mHsp60 mutants, mHsp60 F72I , mHsp60 V72A and their truncated counterparts were generated using |