crispr cas9 genomic engineering idt star methods rbns primers idt star methods recombinant dna px458 addgene plasmid (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
crispr cas9 genomic engineering idt star methods rbns primers idt star methods recombinant dna px458 addgene plasmid
Crispr Cas9 Genomic Engineering Idt Star Methods Rbns Primers Idt Star Methods Recombinant Dna Px458 Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 4083 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px458/pSpCas9(BB)-2A-GFP+(PX458)+(Plasmid+%2348138)/pm41932309-792-83-97
Average 96 stars, based on 4083 article reviews
Crispr Cas9 Genomic Engineering Idt Star Methods Rbns Primers Idt Star Methods Recombinant Dna Px458 Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 4083 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px458/pSpCas9(BB)-2A-GFP+(PX458)+(Plasmid+%2348138)/pm41932309-792-83-97
Average 96 stars, based on 4083 article reviews
crispr cas9 genomic engineering idt star methods rbns primers idt star methods recombinant dna px458 addgene plasmid - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
Clone Assay:Article Title: Ribosome Molecular Aging Shapes Translation Dynamics Article Snippet: .. The guide RNA, GAACCGCCACCATGGTAAGG, was designed with CRISPOR and cloned into a modified version of Article Title: The conserved N-terminal SANT1-binding domain (SBD) of EZH2 regulates PRC2 activity. Article Snippet: .. Plasmid generation and lentivirus production for cell culture Single guide RNAs (sgRNAs) directed againstmouse Ezh2 were cloned into Article Title: Plagl1 and Lrrc58 control mammalian body size by triggering target-directed microRNA degradation of miR-322 and miR-503 Article Snippet: .. MEF trigger site knockout clones were generated in one of two ways: (1) Guide sequences were cloned into Article Title: Combined targeted and epigenetic-based therapy enhances antitumor immunity by stabilizing GATA6-dependent MHCI expression in pancreatic ductal adenocarcinoma Article Snippet: HAs were PCR-amplified using murine primary PDAC cell line (110299) genomic DNA as template and cloned into pJET (Thermo Fisher Scientific) flanking the Blast-P2A-V5-AID cassette to generate pJET_gata6_N-AID_HDR. .. Two sgRNAs targeting around the gata6 start codon were cloned into Modification:Article Title: Ribosome Molecular Aging Shapes Translation Dynamics Article Snippet: .. The guide RNA, GAACCGCCACCATGGTAAGG, was designed with CRISPOR and cloned into a modified version of Plasmid Preparation:Article Title: Ribosome Molecular Aging Shapes Translation Dynamics Article Snippet: .. The guide RNA, GAACCGCCACCATGGTAAGG, was designed with CRISPOR and cloned into a modified version of Article Title: The conserved N-terminal SANT1-binding domain (SBD) of EZH2 regulates PRC2 activity. Article Snippet: .. Plasmid generation and lentivirus production for cell culture Single guide RNAs (sgRNAs) directed againstmouse Ezh2 were cloned into Article Title: U2AF regulates the translation and localization of nuclear-encoded mitochondrial mRNAs Article Snippet: Recombinant DNA , , . .. Article Title: Generation of functionally competent testicular somatic cells from pluripotent stem cells. Article Snippet: After cleavage at Kpn I and Sac I sites to replace the Rosa homology arm of the pDonor- Rosa26 plasmid (Addgene; no. 37200) and Sox92A- CGFP, each cloned DNA fragment was joined together using an In- Fusion HD cloning kit (Takara Bio, Shiga, Japan) to generate the Sox9- CGFP targeting vector. .. A Cas9 and chimeric guide RNA expression plasmid, Cell Culture:Article Title: The conserved N-terminal SANT1-binding domain (SBD) of EZH2 regulates PRC2 activity. Article Snippet: .. Plasmid generation and lentivirus production for cell culture Single guide RNAs (sgRNAs) directed againstmouse Ezh2 were cloned into Knock-Out:Article Title: The integrated stress response promotes immune evasion through lipocalin 2. Article Snippet: Jozef P. Bossowski, Ray Pillai, John Kilian, Angela Wong Lau, Mari Nakamura, Ali Rashidfarrokhi, Yuan Hao, Ruxuan Li, Katherine Wu, Takamitsu Hattori, Eliezra Glasser, Akiko Koide, Lidong Wang, Andre L. Moreira, Cristina Hajdu, Sahith Rajalingam, Sarah E. LeBoeuf, Hortense Le, Seungeun Lee, Jin Woo Oh, Cheolyong Joe, Hyemin Kim, Chan-Young Ock, Se-Hoon Lee, Hao Wang, Angana A. H. Patel, Volkan I. Sayin, Aristotelis Tsirigos, Kwok-Kin Wong, Sergei B. Koralov, Mario Pende, Francisco J. Sánchez-Rivera, Diane M. Simeone, Ioannis K. Zervantonakis, Shohei Koide4,9 ✉ & Thales Papagiannakopoulos1,4 ✉ Article Title: Plagl1 and Lrrc58 control mammalian body size by triggering target-directed microRNA degradation of miR-322 and miR-503 Article Snippet: .. MEF trigger site knockout clones were generated in one of two ways: (1) Guide sequences were cloned into Generated:Article Title: The integrated stress response promotes immune evasion through lipocalin 2. Article Snippet: Jozef P. Bossowski, Ray Pillai, John Kilian, Angela Wong Lau, Mari Nakamura, Ali Rashidfarrokhi, Yuan Hao, Ruxuan Li, Katherine Wu, Takamitsu Hattori, Eliezra Glasser, Akiko Koide, Lidong Wang, Andre L. Moreira, Cristina Hajdu, Sahith Rajalingam, Sarah E. LeBoeuf, Hortense Le, Seungeun Lee, Jin Woo Oh, Cheolyong Joe, Hyemin Kim, Chan-Young Ock, Se-Hoon Lee, Hao Wang, Angana A. H. Patel, Volkan I. Sayin, Aristotelis Tsirigos, Kwok-Kin Wong, Sergei B. Koralov, Mario Pende, Francisco J. Sánchez-Rivera, Diane M. Simeone, Ioannis K. Zervantonakis, Shohei Koide4,9 ✉ & Thales Papagiannakopoulos1,4 ✉ Article Title: Plagl1 and Lrrc58 control mammalian body size by triggering target-directed microRNA degradation of miR-322 and miR-503 Article Snippet: .. MEF trigger site knockout clones were generated in one of two ways: (1) Guide sequences were cloned into Transfection:Article Title: The integrated stress response promotes immune evasion through lipocalin 2. Article Snippet: Jozef P. Bossowski, Ray Pillai, John Kilian, Angela Wong Lau, Mari Nakamura, Ali Rashidfarrokhi, Yuan Hao, Ruxuan Li, Katherine Wu, Takamitsu Hattori, Eliezra Glasser, Akiko Koide, Lidong Wang, Andre L. Moreira, Cristina Hajdu, Sahith Rajalingam, Sarah E. LeBoeuf, Hortense Le, Seungeun Lee, Jin Woo Oh, Cheolyong Joe, Hyemin Kim, Chan-Young Ock, Se-Hoon Lee, Hao Wang, Angana A. H. Patel, Volkan I. Sayin, Aristotelis Tsirigos, Kwok-Kin Wong, Sergei B. Koralov, Mario Pende, Francisco J. Sánchez-Rivera, Diane M. Simeone, Ioannis K. Zervantonakis, Shohei Koide4,9 ✉ & Thales Papagiannakopoulos1,4 ✉ Article Title: Plagl1 and Lrrc58 control mammalian body size by triggering target-directed microRNA degradation of miR-322 and miR-503 Article Snippet: .. MEF trigger site knockout clones were generated in one of two ways: (1) Guide sequences were cloned into Expressing:Article Title: The integrated stress response promotes immune evasion through lipocalin 2. Article Snippet: Jozef P. Bossowski, Ray Pillai, John Kilian, Angela Wong Lau, Mari Nakamura, Ali Rashidfarrokhi, Yuan Hao, Ruxuan Li, Katherine Wu, Takamitsu Hattori, Eliezra Glasser, Akiko Koide, Lidong Wang, Andre L. Moreira, Cristina Hajdu, Sahith Rajalingam, Sarah E. LeBoeuf, Hortense Le, Seungeun Lee, Jin Woo Oh, Cheolyong Joe, Hyemin Kim, Chan-Young Ock, Se-Hoon Lee, Hao Wang, Angana A. H. Patel, Volkan I. Sayin, Aristotelis Tsirigos, Kwok-Kin Wong, Sergei B. Koralov, Mario Pende, Francisco J. Sánchez-Rivera, Diane M. Simeone, Ioannis K. Zervantonakis, Shohei Koide4,9 ✉ & Thales Papagiannakopoulos1,4 ✉ Article Title: Plagl1 and Lrrc58 control mammalian body size by triggering target-directed microRNA degradation of miR-322 and miR-503 Article Snippet: .. MEF trigger site knockout clones were generated in one of two ways: (1) Guide sequences were cloned into RNA Expression:Article Title: Generation of functionally competent testicular somatic cells from pluripotent stem cells. Article Snippet: After cleavage at Kpn I and Sac I sites to replace the Rosa homology arm of the pDonor- Rosa26 plasmid (Addgene; no. 37200) and Sox92A- CGFP, each cloned DNA fragment was joined together using an In- Fusion HD cloning kit (Takara Bio, Shiga, Japan) to generate the Sox9- CGFP targeting vector. .. A Cas9 and chimeric guide RNA expression plasmid, Purification:Article Title: Acute Degradation of Pumilio Proteins Uncovers a Biphasic Post-transcriptional Regulatory Hierarchy Controlling Embryonic Stem Cell Fate Decisions Article Snippet: .. The |