Review



scramble control shrna  (OriGene)


Bioz Verified Symbol OriGene is a verified supplier
Bioz Manufacturer Symbol OriGene manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    OriGene scramble control shrna
    <t>TCF7</t> regulates pro−caspase−8 expression in T lymphocytes and is significantly reduced in COPD. ( A ) Immunofluorescence co−staining of control human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Scale bar is 50 μm. ( B ) Immunofluorescence co−staining of COPD human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Note the marked reduction in both TCF7 and caspase−8 signals compared to the control. Scale bar is 50 μm. ( C ) Representative Western blot images of TCF7 (50 kDa), pro−caspase−8 (55 kDa), and internal control β−tubulin (55 kDa) in wild type (WT) and TCF7 knockout (KO) Jurkat T cells. ( D ) Quantitative densitometric analysis of TCF7 protein levels comparing WT and KO groups. ( E ) Quantitative densitometric analysis of pro−caspase−8 protein levels comparing WT and KO groups. ( F ) Representative Western blot images of TCF7 and β−tubulin in primary T lymphocytes isolated from the peripheral blood of healthy donors (Control) and patients with COPD (Model). ( G ) Quantitative densitometric analysis of TCF7 protein levels in human primary T lymphocytes. ( H ) Representative Western blot images of TCF7 and β−tubulin protein levels in Jurkat T cells across four experimental conditions including Control, <t>shRNA,</t> shRNA plus TCF7 Rescue construct, and shRNA plus Empty Vector. ( I ) Quantitative densitometric analysis of TCF7 protein levels across the four experimental rescue groups. ( J ) Representative Western blot images of pro−caspase−8 and β−tubulin protein levels across the same four experimental conditions in Jurkat T cells. ( K ) Quantitative densitometric analysis of pro−caspase−8 protein levels across the four experimental rescue groups. Data in the bar charts are presented as mean ± SD ( n = 4 for primary human cells, n = 3 for cell line experiments). Statistical significance was assessed using Student’s t test with Welch’s correction where appropriate (* p < 0.05, *** p < 0.001, ns indicates not significant).
    Scramble Control Shrna, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 176 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prs+vector/Scrambled+shRNA+control+in+pRS+shRNA+Vector/pmc13206788-418-9-15
    Average 95 stars, based on 176 article reviews
    scramble control shrna - by Bioz Stars, 2026-09
    95/100 stars

    Images

    1) Product Images from "Unfolding Immune Dysregulation in COPD: Identification of a Three-Gene Signature and Functional Validation of TCF7 in Human Lung Tissue and T Lymphocytes"

    Article Title: Unfolding Immune Dysregulation in COPD: Identification of a Three-Gene Signature and Functional Validation of TCF7 in Human Lung Tissue and T Lymphocytes

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms27104231

    TCF7 regulates pro−caspase−8 expression in T lymphocytes and is significantly reduced in COPD. ( A ) Immunofluorescence co−staining of control human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Scale bar is 50 μm. ( B ) Immunofluorescence co−staining of COPD human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Note the marked reduction in both TCF7 and caspase−8 signals compared to the control. Scale bar is 50 μm. ( C ) Representative Western blot images of TCF7 (50 kDa), pro−caspase−8 (55 kDa), and internal control β−tubulin (55 kDa) in wild type (WT) and TCF7 knockout (KO) Jurkat T cells. ( D ) Quantitative densitometric analysis of TCF7 protein levels comparing WT and KO groups. ( E ) Quantitative densitometric analysis of pro−caspase−8 protein levels comparing WT and KO groups. ( F ) Representative Western blot images of TCF7 and β−tubulin in primary T lymphocytes isolated from the peripheral blood of healthy donors (Control) and patients with COPD (Model). ( G ) Quantitative densitometric analysis of TCF7 protein levels in human primary T lymphocytes. ( H ) Representative Western blot images of TCF7 and β−tubulin protein levels in Jurkat T cells across four experimental conditions including Control, shRNA, shRNA plus TCF7 Rescue construct, and shRNA plus Empty Vector. ( I ) Quantitative densitometric analysis of TCF7 protein levels across the four experimental rescue groups. ( J ) Representative Western blot images of pro−caspase−8 and β−tubulin protein levels across the same four experimental conditions in Jurkat T cells. ( K ) Quantitative densitometric analysis of pro−caspase−8 protein levels across the four experimental rescue groups. Data in the bar charts are presented as mean ± SD ( n = 4 for primary human cells, n = 3 for cell line experiments). Statistical significance was assessed using Student’s t test with Welch’s correction where appropriate (* p < 0.05, *** p < 0.001, ns indicates not significant).
    Figure Legend Snippet: TCF7 regulates pro−caspase−8 expression in T lymphocytes and is significantly reduced in COPD. ( A ) Immunofluorescence co−staining of control human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Scale bar is 50 μm. ( B ) Immunofluorescence co−staining of COPD human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Note the marked reduction in both TCF7 and caspase−8 signals compared to the control. Scale bar is 50 μm. ( C ) Representative Western blot images of TCF7 (50 kDa), pro−caspase−8 (55 kDa), and internal control β−tubulin (55 kDa) in wild type (WT) and TCF7 knockout (KO) Jurkat T cells. ( D ) Quantitative densitometric analysis of TCF7 protein levels comparing WT and KO groups. ( E ) Quantitative densitometric analysis of pro−caspase−8 protein levels comparing WT and KO groups. ( F ) Representative Western blot images of TCF7 and β−tubulin in primary T lymphocytes isolated from the peripheral blood of healthy donors (Control) and patients with COPD (Model). ( G ) Quantitative densitometric analysis of TCF7 protein levels in human primary T lymphocytes. ( H ) Representative Western blot images of TCF7 and β−tubulin protein levels in Jurkat T cells across four experimental conditions including Control, shRNA, shRNA plus TCF7 Rescue construct, and shRNA plus Empty Vector. ( I ) Quantitative densitometric analysis of TCF7 protein levels across the four experimental rescue groups. ( J ) Representative Western blot images of pro−caspase−8 and β−tubulin protein levels across the same four experimental conditions in Jurkat T cells. ( K ) Quantitative densitometric analysis of pro−caspase−8 protein levels across the four experimental rescue groups. Data in the bar charts are presented as mean ± SD ( n = 4 for primary human cells, n = 3 for cell line experiments). Statistical significance was assessed using Student’s t test with Welch’s correction where appropriate (* p < 0.05, *** p < 0.001, ns indicates not significant).

    Techniques Used: Expressing, Immunofluorescence, Staining, Control, Western Blot, Knock-Out, Isolation, shRNA, Construct, Plasmid Preparation

    Related Articles

    shRNA:

    Article Title: Enabling Survival of Transplanted Neural Precursor Cells in the Ischemic Brain.
    Article Snippet: .. Lentivirus Production: Human CCR5 29mer shRNA plasmids (pRS_hU6_CCR5shRNA_SV40_Puro) and non-effective 29-mer scrambled shRNA cassette in pRS Vector were obtained from OriGene (CAT#: TR314126, CAT#: TR30012). ..

    Article Title: ISG15 mediates the function of extracellular vesicles in promoting ovarian cancer progression and metastasis
    Article Snippet: Following 48 h of transfection, the cells were treated with 100 μg/mL of G418 (Sigma‐Aldrich) every 2 days for 10 days total to establish a stable cell line. .. To ensure the stable knockdown of ISG15 in the POCC cells, TR127 cells were transfected with pRS vector containing four unique 29mer shRNA constructs from ORIGENE alongside a negative scrambled shRNA for control according to manufacturer's protocol (OriGene Technologies, Inc.). ..

    Article Title: Compositions and methods for treatment of diseases involving CXCL1 function
    Article Snippet: Plasmids with sequence verified human CXCL1 cDNA cloned within pCMV6-Empty vector and plasmid with vector alone (Origene Technologies) were transfected into DU145 cells using Fugene HD transfection reagent (Roche Diagnostics) to create DU145-CXCL1 and DU145-Empty. .. Similarly, CXCL1 short hairpin RNA (shRNA) cloned within pRS vector was transfected into T24 and PC3 cells as well as CXCL1 plasmid scramble (Scr) non-effective shRNA construct within pRS vector (Origene) using Fugene HD. .. Stable transfectants were selected with 1,200 μg/ml of G418 (Life Technologies, Inc., Carlsbad, Calif.) for DU145 clones and 0.25 μg/ml of puromycin (Life Technologies) for T24 and PC3 clones for 14 days and subcloned by limiting dilution in 96-well plates.

    Article Title: Enabling Survival of Transplanted Neural Precursor Cells in the Ischemic Brain
    Article Snippet: .. Human CCR5 29mer shRNA plasmids (pRS_hU6_CCR5shRNA_SV40_Puro) and non‐effective 29‐mer scrambled shRNA cassette in pRS Vector were obtained from OriGene (CAT#: TR314126, CAT#: TR30012). ..

    Article Title: Periodicity, Mixed-Mode Oscillations, and Multiple Timescale in a Phosphoinositide-Rho GTPase Network
    Article Snippet: The following reagents were purchased from commercial sources: Nocodazole, GSK-A1 and Ly294002 from Millipore Sigma. .. E-Syt1 shRNA in pRS vector (Cat # TR710045A, CCAAGTTCACTTGAGGTTAGAATGGCTAT and TR710045B, TTCCTTCGGACGCCGCTTGTTGGTGCTGG), PTEN shRNA in pRS vector (Cat # TR711414A CTTGACCAATGGCTAAGTGAAGACGACAA and TR711414B, ATAGAGCGTGCGGATAATGACAAGGAGTA), Synaptojanin 2 shRNA in pRFP-C-RS vector (cat. no. FI732825, TGTGCCTCTGCGGCAGCACCAGGTGAACT and FI732826, TTGTGGAGACAGAGCAGGCGATTTACATG) were purchased from Origene. ..

    Knockdown:

    Article Title: ISG15 mediates the function of extracellular vesicles in promoting ovarian cancer progression and metastasis
    Article Snippet: Following 48 h of transfection, the cells were treated with 100 μg/mL of G418 (Sigma‐Aldrich) every 2 days for 10 days total to establish a stable cell line. .. To ensure the stable knockdown of ISG15 in the POCC cells, TR127 cells were transfected with pRS vector containing four unique 29mer shRNA constructs from ORIGENE alongside a negative scrambled shRNA for control according to manufacturer's protocol (OriGene Technologies, Inc.). ..

    Transfection:

    Article Title: ISG15 mediates the function of extracellular vesicles in promoting ovarian cancer progression and metastasis
    Article Snippet: Following 48 h of transfection, the cells were treated with 100 μg/mL of G418 (Sigma‐Aldrich) every 2 days for 10 days total to establish a stable cell line. .. To ensure the stable knockdown of ISG15 in the POCC cells, TR127 cells were transfected with pRS vector containing four unique 29mer shRNA constructs from ORIGENE alongside a negative scrambled shRNA for control according to manufacturer's protocol (OriGene Technologies, Inc.). ..

    Article Title: Compositions and methods for treatment of diseases involving CXCL1 function
    Article Snippet: Plasmids with sequence verified human CXCL1 cDNA cloned within pCMV6-Empty vector and plasmid with vector alone (Origene Technologies) were transfected into DU145 cells using Fugene HD transfection reagent (Roche Diagnostics) to create DU145-CXCL1 and DU145-Empty. .. Similarly, CXCL1 short hairpin RNA (shRNA) cloned within pRS vector was transfected into T24 and PC3 cells as well as CXCL1 plasmid scramble (Scr) non-effective shRNA construct within pRS vector (Origene) using Fugene HD. .. Stable transfectants were selected with 1,200 μg/ml of G418 (Life Technologies, Inc., Carlsbad, Calif.) for DU145 clones and 0.25 μg/ml of puromycin (Life Technologies) for T24 and PC3 clones for 14 days and subcloned by limiting dilution in 96-well plates.

    Article Title: Protective effect of mesenchymal stromal cells in diabetic nephropathy: the In vitro and In vivo role of the M-Sec-tunneling nanotubes
    Article Snippet: .. To silence M-Sec, human MSCs were transfected (Lipofectamine 3000 Transfection Reagent, Thermo Fisher Scientific) with a plasmid construct encoding M-Sec-specific sh-RNA (5′-GATCCGACTGCTGGAGGCCACATTCCTGT-3′) or a mock plasmid (5′-GCACTACCAGAGCTAACTCAGATAGTACT-3′) cloned in a pRS vector (ExactHuSH, OriGene Technologies Inc). ..

    Plasmid Preparation:

    Article Title: ISG15 mediates the function of extracellular vesicles in promoting ovarian cancer progression and metastasis
    Article Snippet: Following 48 h of transfection, the cells were treated with 100 μg/mL of G418 (Sigma‐Aldrich) every 2 days for 10 days total to establish a stable cell line. .. To ensure the stable knockdown of ISG15 in the POCC cells, TR127 cells were transfected with pRS vector containing four unique 29mer shRNA constructs from ORIGENE alongside a negative scrambled shRNA for control according to manufacturer's protocol (OriGene Technologies, Inc.). ..

    Article Title: Compositions and methods for treatment of diseases involving CXCL1 function
    Article Snippet: Plasmids with sequence verified human CXCL1 cDNA cloned within pCMV6-Empty vector and plasmid with vector alone (Origene Technologies) were transfected into DU145 cells using Fugene HD transfection reagent (Roche Diagnostics) to create DU145-CXCL1 and DU145-Empty. .. Similarly, CXCL1 short hairpin RNA (shRNA) cloned within pRS vector was transfected into T24 and PC3 cells as well as CXCL1 plasmid scramble (Scr) non-effective shRNA construct within pRS vector (Origene) using Fugene HD. .. Stable transfectants were selected with 1,200 μg/ml of G418 (Life Technologies, Inc., Carlsbad, Calif.) for DU145 clones and 0.25 μg/ml of puromycin (Life Technologies) for T24 and PC3 clones for 14 days and subcloned by limiting dilution in 96-well plates.

    Article Title: ANKRD2 Knockdown as a Therapeutic Strategy in Osteosarcoma: Effects on Proliferation and Drug Response in U2OS and HOS Cells.
    Article Snippet: .. This Sh-RNA was enclosed in a pRS vector (Origene, Origene Technologies GmbH, Herford, Germany, sold in Italy by TEMA Ricerca, Castenaso, Italy). ..

    Article Title: Protective effect of mesenchymal stromal cells in diabetic nephropathy: the In vitro and In vivo role of the M-Sec-tunneling nanotubes
    Article Snippet: .. To silence M-Sec, human MSCs were transfected (Lipofectamine 3000 Transfection Reagent, Thermo Fisher Scientific) with a plasmid construct encoding M-Sec-specific sh-RNA (5′-GATCCGACTGCTGGAGGCCACATTCCTGT-3′) or a mock plasmid (5′-GCACTACCAGAGCTAACTCAGATAGTACT-3′) cloned in a pRS vector (ExactHuSH, OriGene Technologies Inc). ..

    Construct:

    Article Title: ISG15 mediates the function of extracellular vesicles in promoting ovarian cancer progression and metastasis
    Article Snippet: Following 48 h of transfection, the cells were treated with 100 μg/mL of G418 (Sigma‐Aldrich) every 2 days for 10 days total to establish a stable cell line. .. To ensure the stable knockdown of ISG15 in the POCC cells, TR127 cells were transfected with pRS vector containing four unique 29mer shRNA constructs from ORIGENE alongside a negative scrambled shRNA for control according to manufacturer's protocol (OriGene Technologies, Inc.). ..

    Article Title: Compositions and methods for treatment of diseases involving CXCL1 function
    Article Snippet: Plasmids with sequence verified human CXCL1 cDNA cloned within pCMV6-Empty vector and plasmid with vector alone (Origene Technologies) were transfected into DU145 cells using Fugene HD transfection reagent (Roche Diagnostics) to create DU145-CXCL1 and DU145-Empty. .. Similarly, CXCL1 short hairpin RNA (shRNA) cloned within pRS vector was transfected into T24 and PC3 cells as well as CXCL1 plasmid scramble (Scr) non-effective shRNA construct within pRS vector (Origene) using Fugene HD. .. Stable transfectants were selected with 1,200 μg/ml of G418 (Life Technologies, Inc., Carlsbad, Calif.) for DU145 clones and 0.25 μg/ml of puromycin (Life Technologies) for T24 and PC3 clones for 14 days and subcloned by limiting dilution in 96-well plates.

    Article Title: Protective effect of mesenchymal stromal cells in diabetic nephropathy: the In vitro and In vivo role of the M-Sec-tunneling nanotubes
    Article Snippet: .. To silence M-Sec, human MSCs were transfected (Lipofectamine 3000 Transfection Reagent, Thermo Fisher Scientific) with a plasmid construct encoding M-Sec-specific sh-RNA (5′-GATCCGACTGCTGGAGGCCACATTCCTGT-3′) or a mock plasmid (5′-GCACTACCAGAGCTAACTCAGATAGTACT-3′) cloned in a pRS vector (ExactHuSH, OriGene Technologies Inc). ..

    Control:

    Article Title: ISG15 mediates the function of extracellular vesicles in promoting ovarian cancer progression and metastasis
    Article Snippet: Following 48 h of transfection, the cells were treated with 100 μg/mL of G418 (Sigma‐Aldrich) every 2 days for 10 days total to establish a stable cell line. .. To ensure the stable knockdown of ISG15 in the POCC cells, TR127 cells were transfected with pRS vector containing four unique 29mer shRNA constructs from ORIGENE alongside a negative scrambled shRNA for control according to manufacturer's protocol (OriGene Technologies, Inc.). ..



    Similar Products

    86
    Sangon Biotech candidate target proteins ar tic le in pr es s recombinant pcold i expression vectors
    Candidate Target Proteins Ar Tic Le In Pr Es S Recombinant Pcold I Expression Vectors, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prs+vector/expression+lglp+plan+vectors/pm42168698-81-4-19
    Average 86 stars, based on 1 article reviews
    candidate target proteins ar tic le in pr es s recombinant pcold i expression vectors - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    95
    OriGene scramble control shrna
    <t>TCF7</t> regulates pro−caspase−8 expression in T lymphocytes and is significantly reduced in COPD. ( A ) Immunofluorescence co−staining of control human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Scale bar is 50 μm. ( B ) Immunofluorescence co−staining of COPD human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Note the marked reduction in both TCF7 and caspase−8 signals compared to the control. Scale bar is 50 μm. ( C ) Representative Western blot images of TCF7 (50 kDa), pro−caspase−8 (55 kDa), and internal control β−tubulin (55 kDa) in wild type (WT) and TCF7 knockout (KO) Jurkat T cells. ( D ) Quantitative densitometric analysis of TCF7 protein levels comparing WT and KO groups. ( E ) Quantitative densitometric analysis of pro−caspase−8 protein levels comparing WT and KO groups. ( F ) Representative Western blot images of TCF7 and β−tubulin in primary T lymphocytes isolated from the peripheral blood of healthy donors (Control) and patients with COPD (Model). ( G ) Quantitative densitometric analysis of TCF7 protein levels in human primary T lymphocytes. ( H ) Representative Western blot images of TCF7 and β−tubulin protein levels in Jurkat T cells across four experimental conditions including Control, <t>shRNA,</t> shRNA plus TCF7 Rescue construct, and shRNA plus Empty Vector. ( I ) Quantitative densitometric analysis of TCF7 protein levels across the four experimental rescue groups. ( J ) Representative Western blot images of pro−caspase−8 and β−tubulin protein levels across the same four experimental conditions in Jurkat T cells. ( K ) Quantitative densitometric analysis of pro−caspase−8 protein levels across the four experimental rescue groups. Data in the bar charts are presented as mean ± SD ( n = 4 for primary human cells, n = 3 for cell line experiments). Statistical significance was assessed using Student’s t test with Welch’s correction where appropriate (* p < 0.05, *** p < 0.001, ns indicates not significant).
    Scramble Control Shrna, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prs+vector/Scrambled+shRNA+control+in+pRS+shRNA+Vector/pmc13206788-418-9-15
    Average 95 stars, based on 1 article reviews
    scramble control shrna - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    OriGene scramble shrnas
    <t>TCF7</t> regulates pro−caspase−8 expression in T lymphocytes and is significantly reduced in COPD. ( A ) Immunofluorescence co−staining of control human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Scale bar is 50 μm. ( B ) Immunofluorescence co−staining of COPD human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Note the marked reduction in both TCF7 and caspase−8 signals compared to the control. Scale bar is 50 μm. ( C ) Representative Western blot images of TCF7 (50 kDa), pro−caspase−8 (55 kDa), and internal control β−tubulin (55 kDa) in wild type (WT) and TCF7 knockout (KO) Jurkat T cells. ( D ) Quantitative densitometric analysis of TCF7 protein levels comparing WT and KO groups. ( E ) Quantitative densitometric analysis of pro−caspase−8 protein levels comparing WT and KO groups. ( F ) Representative Western blot images of TCF7 and β−tubulin in primary T lymphocytes isolated from the peripheral blood of healthy donors (Control) and patients with COPD (Model). ( G ) Quantitative densitometric analysis of TCF7 protein levels in human primary T lymphocytes. ( H ) Representative Western blot images of TCF7 and β−tubulin protein levels in Jurkat T cells across four experimental conditions including Control, <t>shRNA,</t> shRNA plus TCF7 Rescue construct, and shRNA plus Empty Vector. ( I ) Quantitative densitometric analysis of TCF7 protein levels across the four experimental rescue groups. ( J ) Representative Western blot images of pro−caspase−8 and β−tubulin protein levels across the same four experimental conditions in Jurkat T cells. ( K ) Quantitative densitometric analysis of pro−caspase−8 protein levels across the four experimental rescue groups. Data in the bar charts are presented as mean ± SD ( n = 4 for primary human cells, n = 3 for cell line experiments). Statistical significance was assessed using Student’s t test with Welch’s correction where appropriate (* p < 0.05, *** p < 0.001, ns indicates not significant).
    Scramble Shrnas, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prs+vector/Scrambled+shRNA+control+in+pRS+shRNA+Vector/pm42119389-90-23-25
    Average 95 stars, based on 1 article reviews
    scramble shrnas - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    TaKaRa pr es s vector pcold gst
    <t>TCF7</t> regulates pro−caspase−8 expression in T lymphocytes and is significantly reduced in COPD. ( A ) Immunofluorescence co−staining of control human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Scale bar is 50 μm. ( B ) Immunofluorescence co−staining of COPD human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Note the marked reduction in both TCF7 and caspase−8 signals compared to the control. Scale bar is 50 μm. ( C ) Representative Western blot images of TCF7 (50 kDa), pro−caspase−8 (55 kDa), and internal control β−tubulin (55 kDa) in wild type (WT) and TCF7 knockout (KO) Jurkat T cells. ( D ) Quantitative densitometric analysis of TCF7 protein levels comparing WT and KO groups. ( E ) Quantitative densitometric analysis of pro−caspase−8 protein levels comparing WT and KO groups. ( F ) Representative Western blot images of TCF7 and β−tubulin in primary T lymphocytes isolated from the peripheral blood of healthy donors (Control) and patients with COPD (Model). ( G ) Quantitative densitometric analysis of TCF7 protein levels in human primary T lymphocytes. ( H ) Representative Western blot images of TCF7 and β−tubulin protein levels in Jurkat T cells across four experimental conditions including Control, <t>shRNA,</t> shRNA plus TCF7 Rescue construct, and shRNA plus Empty Vector. ( I ) Quantitative densitometric analysis of TCF7 protein levels across the four experimental rescue groups. ( J ) Representative Western blot images of pro−caspase−8 and β−tubulin protein levels across the same four experimental conditions in Jurkat T cells. ( K ) Quantitative densitometric analysis of pro−caspase−8 protein levels across the four experimental rescue groups. Data in the bar charts are presented as mean ± SD ( n = 4 for primary human cells, n = 3 for cell line experiments). Statistical significance was assessed using Student’s t test with Welch’s correction where appropriate (* p < 0.05, *** p < 0.001, ns indicates not significant).
    Pr Es S Vector Pcold Gst, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prs+vector/pCold+GST+DNA/pm41935318-63-7-13
    Average 95 stars, based on 1 article reviews
    pr es s vector pcold gst - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    94
    OriGene control mock huh 7 cells
    Establishment and validation of Fbxw7 knockdown (FKD) in <t>Huh-7</t> cells. A Immunofluorescence staining demonstrated a marked reduction of Fbxw7 expression in FKD cells ( b ) compared with mock control cells ( a ). Nuclei were counterstained with DAPI. B Western blot analysis confirmed decreased Fbxw7 protein levels in FKD cells, validating the successful establishment of stable Fbxw7-deficient Huh-7 cell lines
    Control Mock Huh 7 Cells, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prs+vector/pRS+shRNA+Vector/pmc13222321-39-0-13
    Average 94 stars, based on 1 article reviews
    control mock huh 7 cells - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    OriGene vector control
    Establishment and validation of Fbxw7 knockdown (FKD) in <t>Huh-7</t> cells. A Immunofluorescence staining demonstrated a marked reduction of Fbxw7 expression in FKD cells ( b ) compared with mock control cells ( a ). Nuclei were counterstained with DAPI. B Western blot analysis confirmed decreased Fbxw7 protein levels in FKD cells, validating the successful establishment of stable Fbxw7-deficient Huh-7 cell lines
    Vector Control, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prs+vector/Negative+shRNA+control+in+pRS+Vector/pm41793535-121-7-10
    Average 94 stars, based on 1 article reviews
    vector control - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    95
    OriGene scramble sirna sicontrol
    a, IFN-βmRNA relative expression. HeLa cells were transfected with siRNAs targeting individual mitochondrial genes or a non-targeting control <t>(siControl),</t> followed by infection with influenza A virus. IFN-β mRNA levels were measured by quantitative PCR (qPCR), using PUM1 as the normalization reference gene. b, Influenza virus PA and HA vRNAs relative expression. HeLa cells were transfected and infected as described above. vRNA levels were assessed by qPCR and normalized to PUM1 mRNA expression. c, Influenza virus production. Viral titers in the supernatant were quantified by plaque assay following infection of <t>siRNA-transfected</t> cells. All data represent the mean ± SEM (a, b) or ± s.d. (c) of three biological replicates. Genes with a fold change > 2 are indicated by patterned bars. Statistical analysis was performed using one-way ANOVA, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
    Scramble Sirna Sicontrol, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prs+vector/Scrambled+shRNA+control+in+pRS+shRNA+Vector/bio_rxiv__64898__2026__02__25__707858-278-102-108
    Average 95 stars, based on 1 article reviews
    scramble sirna sicontrol - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    99
    InvivoGen nampt recombinant lentiviral vectors
    a, IFN-βmRNA relative expression. HeLa cells were transfected with siRNAs targeting individual mitochondrial genes or a non-targeting control <t>(siControl),</t> followed by infection with influenza A virus. IFN-β mRNA levels were measured by quantitative PCR (qPCR), using PUM1 as the normalization reference gene. b, Influenza virus PA and HA vRNAs relative expression. HeLa cells were transfected and infected as described above. vRNA levels were assessed by qPCR and normalized to PUM1 mRNA expression. c, Influenza virus production. Viral titers in the supernatant were quantified by plaque assay following infection of <t>siRNA-transfected</t> cells. All data represent the mean ± SEM (a, b) or ± s.d. (c) of three biological replicates. Genes with a fold change > 2 are indicated by patterned bars. Statistical analysis was performed using one-way ANOVA, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
    Nampt Recombinant Lentiviral Vectors, supplied by InvivoGen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prs+vector/Puromycin/pm41747594-53-0-26
    Average 99 stars, based on 1 article reviews
    nampt recombinant lentiviral vectors - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    95
    PackGene Biotech lnc 379 jo urn al pr e p roo f 20 recombinant aav6
    a, IFN-βmRNA relative expression. HeLa cells were transfected with siRNAs targeting individual mitochondrial genes or a non-targeting control <t>(siControl),</t> followed by infection with influenza A virus. IFN-β mRNA levels were measured by quantitative PCR (qPCR), using PUM1 as the normalization reference gene. b, Influenza virus PA and HA vRNAs relative expression. HeLa cells were transfected and infected as described above. vRNA levels were assessed by qPCR and normalized to PUM1 mRNA expression. c, Influenza virus production. Viral titers in the supernatant were quantified by plaque assay following infection of <t>siRNA-transfected</t> cells. All data represent the mean ± SEM (a, b) or ± s.d. (c) of three biological replicates. Genes with a fold change > 2 are indicated by patterned bars. Statistical analysis was performed using one-way ANOVA, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
    379 Jo Urn Al Pr E P Roo F 20 Recombinant Aav6, supplied by PackGene Biotech lnc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prs+vector/AAV6+Vector+Production/pm41485050-174-0-20
    Average 95 stars, based on 1 article reviews
    379 jo urn al pr e p roo f 20 recombinant aav6 - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    99
    InvivoGen lentiviral vector
    a, IFN-βmRNA relative expression. HeLa cells were transfected with siRNAs targeting individual mitochondrial genes or a non-targeting control <t>(siControl),</t> followed by infection with influenza A virus. IFN-β mRNA levels were measured by quantitative PCR (qPCR), using PUM1 as the normalization reference gene. b, Influenza virus PA and HA vRNAs relative expression. HeLa cells were transfected and infected as described above. vRNA levels were assessed by qPCR and normalized to PUM1 mRNA expression. c, Influenza virus production. Viral titers in the supernatant were quantified by plaque assay following infection of <t>siRNA-transfected</t> cells. All data represent the mean ± SEM (a, b) or ± s.d. (c) of three biological replicates. Genes with a fold change > 2 are indicated by patterned bars. Statistical analysis was performed using one-way ANOVA, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
    Lentiviral Vector, supplied by InvivoGen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prs+vector/Puromycin/pmc12827272-273-12-24
    Average 99 stars, based on 1 article reviews
    lentiviral vector - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    TCF7 regulates pro−caspase−8 expression in T lymphocytes and is significantly reduced in COPD. ( A ) Immunofluorescence co−staining of control human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Scale bar is 50 μm. ( B ) Immunofluorescence co−staining of COPD human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Note the marked reduction in both TCF7 and caspase−8 signals compared to the control. Scale bar is 50 μm. ( C ) Representative Western blot images of TCF7 (50 kDa), pro−caspase−8 (55 kDa), and internal control β−tubulin (55 kDa) in wild type (WT) and TCF7 knockout (KO) Jurkat T cells. ( D ) Quantitative densitometric analysis of TCF7 protein levels comparing WT and KO groups. ( E ) Quantitative densitometric analysis of pro−caspase−8 protein levels comparing WT and KO groups. ( F ) Representative Western blot images of TCF7 and β−tubulin in primary T lymphocytes isolated from the peripheral blood of healthy donors (Control) and patients with COPD (Model). ( G ) Quantitative densitometric analysis of TCF7 protein levels in human primary T lymphocytes. ( H ) Representative Western blot images of TCF7 and β−tubulin protein levels in Jurkat T cells across four experimental conditions including Control, shRNA, shRNA plus TCF7 Rescue construct, and shRNA plus Empty Vector. ( I ) Quantitative densitometric analysis of TCF7 protein levels across the four experimental rescue groups. ( J ) Representative Western blot images of pro−caspase−8 and β−tubulin protein levels across the same four experimental conditions in Jurkat T cells. ( K ) Quantitative densitometric analysis of pro−caspase−8 protein levels across the four experimental rescue groups. Data in the bar charts are presented as mean ± SD ( n = 4 for primary human cells, n = 3 for cell line experiments). Statistical significance was assessed using Student’s t test with Welch’s correction where appropriate (* p < 0.05, *** p < 0.001, ns indicates not significant).

    Journal: International Journal of Molecular Sciences

    Article Title: Unfolding Immune Dysregulation in COPD: Identification of a Three-Gene Signature and Functional Validation of TCF7 in Human Lung Tissue and T Lymphocytes

    doi: 10.3390/ijms27104231

    Figure Lengend Snippet: TCF7 regulates pro−caspase−8 expression in T lymphocytes and is significantly reduced in COPD. ( A ) Immunofluorescence co−staining of control human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Scale bar is 50 μm. ( B ) Immunofluorescence co−staining of COPD human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Note the marked reduction in both TCF7 and caspase−8 signals compared to the control. Scale bar is 50 μm. ( C ) Representative Western blot images of TCF7 (50 kDa), pro−caspase−8 (55 kDa), and internal control β−tubulin (55 kDa) in wild type (WT) and TCF7 knockout (KO) Jurkat T cells. ( D ) Quantitative densitometric analysis of TCF7 protein levels comparing WT and KO groups. ( E ) Quantitative densitometric analysis of pro−caspase−8 protein levels comparing WT and KO groups. ( F ) Representative Western blot images of TCF7 and β−tubulin in primary T lymphocytes isolated from the peripheral blood of healthy donors (Control) and patients with COPD (Model). ( G ) Quantitative densitometric analysis of TCF7 protein levels in human primary T lymphocytes. ( H ) Representative Western blot images of TCF7 and β−tubulin protein levels in Jurkat T cells across four experimental conditions including Control, shRNA, shRNA plus TCF7 Rescue construct, and shRNA plus Empty Vector. ( I ) Quantitative densitometric analysis of TCF7 protein levels across the four experimental rescue groups. ( J ) Representative Western blot images of pro−caspase−8 and β−tubulin protein levels across the same four experimental conditions in Jurkat T cells. ( K ) Quantitative densitometric analysis of pro−caspase−8 protein levels across the four experimental rescue groups. Data in the bar charts are presented as mean ± SD ( n = 4 for primary human cells, n = 3 for cell line experiments). Statistical significance was assessed using Student’s t test with Welch’s correction where appropriate (* p < 0.05, *** p < 0.001, ns indicates not significant).

    Article Snippet: Short hairpin RNA targeting human TCF7 (shRNA) and a scramble control shRNA were purchased from OriGene with Cat.No.TR30004.

    Techniques: Expressing, Immunofluorescence, Staining, Control, Western Blot, Knock-Out, Isolation, shRNA, Construct, Plasmid Preparation

    Establishment and validation of Fbxw7 knockdown (FKD) in Huh-7 cells. A Immunofluorescence staining demonstrated a marked reduction of Fbxw7 expression in FKD cells ( b ) compared with mock control cells ( a ). Nuclei were counterstained with DAPI. B Western blot analysis confirmed decreased Fbxw7 protein levels in FKD cells, validating the successful establishment of stable Fbxw7-deficient Huh-7 cell lines

    Journal: Medical Molecular Morphology

    Article Title: Loss of Fbxw7 disrupts lipid homeostasis and autophagy in hepatocellular carcinoma cells

    doi: 10.1007/s00795-026-00457-3

    Figure Lengend Snippet: Establishment and validation of Fbxw7 knockdown (FKD) in Huh-7 cells. A Immunofluorescence staining demonstrated a marked reduction of Fbxw7 expression in FKD cells ( b ) compared with mock control cells ( a ). Nuclei were counterstained with DAPI. B Western blot analysis confirmed decreased Fbxw7 protein levels in FKD cells, validating the successful establishment of stable Fbxw7-deficient Huh-7 cell lines

    Article Snippet: Control (mock) Huh‐7 cells were generated by transfecting the empty pRS vector (TR20003; OriGene) without shRNA.

    Techniques: Biomarker Discovery, Knockdown, Immunofluorescence, Staining, Expressing, Control, Western Blot

    a, IFN-βmRNA relative expression. HeLa cells were transfected with siRNAs targeting individual mitochondrial genes or a non-targeting control (siControl), followed by infection with influenza A virus. IFN-β mRNA levels were measured by quantitative PCR (qPCR), using PUM1 as the normalization reference gene. b, Influenza virus PA and HA vRNAs relative expression. HeLa cells were transfected and infected as described above. vRNA levels were assessed by qPCR and normalized to PUM1 mRNA expression. c, Influenza virus production. Viral titers in the supernatant were quantified by plaque assay following infection of siRNA-transfected cells. All data represent the mean ± SEM (a, b) or ± s.d. (c) of three biological replicates. Genes with a fold change > 2 are indicated by patterned bars. Statistical analysis was performed using one-way ANOVA, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.

    Journal: bioRxiv

    Article Title: Deep Learning-Driven Discovery of Mitochondrial Factors Modulating Influenza A Virus Infection

    doi: 10.64898/2026.02.25.707858

    Figure Lengend Snippet: a, IFN-βmRNA relative expression. HeLa cells were transfected with siRNAs targeting individual mitochondrial genes or a non-targeting control (siControl), followed by infection with influenza A virus. IFN-β mRNA levels were measured by quantitative PCR (qPCR), using PUM1 as the normalization reference gene. b, Influenza virus PA and HA vRNAs relative expression. HeLa cells were transfected and infected as described above. vRNA levels were assessed by qPCR and normalized to PUM1 mRNA expression. c, Influenza virus production. Viral titers in the supernatant were quantified by plaque assay following infection of siRNA-transfected cells. All data represent the mean ± SEM (a, b) or ± s.d. (c) of three biological replicates. Genes with a fold change > 2 are indicated by patterned bars. Statistical analysis was performed using one-way ANOVA, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.

    Article Snippet: The cells were collected after 48 hours to analyse for knockdown efficiency or used for further experiments. siRNA used: Hsp60 (HSPD1) Human siRNA Oligo Duplex (OriGene, locus ID 3329) AccuTarget Predesigned Human ETHE1 siRNA (Bioneer, locus ID 23474) AccuTarget Predesigned Human GRP75 siRNA (Bioneer, locus ID 3313) LETM1 Human siRNA Oligo Duplex (OriGene, locus ID 3954) AccuTarget Predesigned Human LONP1 siRNA (Bioneer, locus ID 9361) OXA1L Human siRNA Oligo Duplex (OriGene, locus ID 5018) AccuTarget Predesigned Human MPPB siRNA (Bioneer, locus ID 9512) AccuTarget Predesigned Human TIM44 siRNA (Bioneer, locus ID 10469) AccuTarget Predesigned Human SQOR siRNA (Bioneer, locus ID 58472) Non-targeting scramble siRNA (siControl) was purchased from OriGene.

    Techniques: Expressing, Transfection, Control, Infection, Virus, Real-time Polymerase Chain Reaction, Plaque Assay