Review



pp7 stem loops  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc pp7 stem loops
    Pp7 Stem Loops, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pp7+stem/bio_rxiv__64898__2026__01__19__700375-183-32-40?v=Addgene+inc
    Average 93 stars, based on 4 article reviews
    pp7 stem loops - by Bioz Stars, 2026-07
    93/100 stars

    Images



    Similar Products

    93
    Genovis Inc pp7 phage operator stem loop
    Pp7 Phage Operator Stem Loop, supplied by Genovis Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pp7+stem/us12344850-652-62-64?v=Genovis+Inc
    Average 93 stars, based on 1 article reviews
    pp7 phage operator stem loop - by Bioz Stars, 2026-07
    93/100 stars
      Buy from Supplier

    93
    Addgene inc pp7 stem loops
    Pp7 Stem Loops, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pp7+stem/bio_rxiv__64898__2026__01__19__700375-183-32-40?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    pp7 stem loops - by Bioz Stars, 2026-07
    93/100 stars
      Buy from Supplier

    90
    Addgene inc plasmid expressing 24 suntag repeats under an ef1alpha promoter followed by 24 pp7 stem loops
    Plasmid Expressing 24 Suntag Repeats Under An Ef1alpha Promoter Followed By 24 Pp7 Stem Loops, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pp7+stem/bio_rxiv__2024__09__30__615241-277-9-26?v=Addgene+inc
    Average 90 stars, based on 1 article reviews
    plasmid expressing 24 suntag repeats under an ef1alpha promoter followed by 24 pp7 stem loops - by Bioz Stars, 2026-07
    90/100 stars
      Buy from Supplier

    90
    Addgene inc pp7 stem-loops 8×pp7
    Schematic of components and plasmid combinations for typical SunRISER mRNA-labeling experiments (A) mRNA and protein components for SunRISER labeling experiments. (B) Schematics of SunRISER variants SRv.1 (top), SRv.1.1 (center), and SRv.1.2 (bottom) for fluorescence signal amplification. The mRNA transcript (black) is tagged at 3′ UTR with <t>PP7</t> stem loops (blue). In the first stage of signal amplification, each stem loop can be bound by two PCP coat proteins (yellow) fused to a SunTag GCN4 peptide array (orange). In the second stage of signal amplification, GFP (green) is recruited through antibody-peptide-specific binding between scFv (gray) and GCN4 epitopes. (C) Plasmid maps of the SunRISER two-plasmid (2P) variants consisting of detection plasmids (left) and protein plasmids for SRv.1-2P (top), SRv.1.1-2P (center), and SRv.1.2-2P (bottom). Using the indicated plasmids from Addgene, the GOI CDS for SRv.1 (top, left) is CFP and the GOI CDS for SRv.1.1 and SRv.1.2 (center and bottom, left) is mCherry. Although the 2P variants of SunRISER are simpler to work with, SunRISER variants using three plasmids as described previously in can be used as outlined previously and in <xref ref-type=Table 1 . " width="250" height="auto" />
    Pp7 Stem Loops 8×Pp7, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pp7+stem/pmc09405536-79-13-24?v=Addgene+inc
    Average 90 stars, based on 1 article reviews
    pp7 stem-loops 8×pp7 - by Bioz Stars, 2026-07
    90/100 stars
      Buy from Supplier

    90
    Eurofins wildtype or mutant (ggagcagacgatggcgtcgctcc) pp7 stem–loops
    Development of the RNA fluorescence three-hybrid assay (rF3H) for RNA–protein interaction studies. ( A ) Principle of the rF3H assay. Three components for the assay, RNA of interest, protein of interest and an RNA trap, are triply expressed in cells containing lacO array on the genome. Tagged with ms2 stem–loop structures, the RNA of interest is recruited and anchored to the lacO loci by the RNA trap, the protein of interest therefore is enriched at the lacO loci by interacting with the RNA of interest, and the interaction between the protein and RNA can be visualized as co-localization of the fused red and green fluorescent proteins. ( B ) Image examples of <t>pp7</t> RNA-PCP interaction visualized by rF3H. The RNA trap marked by EGFP was anchored at the lacO array and visualized as a nuclear fluorescent spot (EGFP channel, marked by filled arrowhead), and the mCherry labeled PCP (PCP-mCherry) was recruited to the lacO spot specifically in the presence of pp7 RNA (lower panel, marked by filled arrowhead), but neither in the mutant pp7 group nor in the control group (mCherry channel of the upper and middle panels, marked by open arrowhead). Merge channels were enhanced for clarity purposes. Scale bars are 10 μm. ( C ) Quantification of the relative mCherry signal at the lacO array. The presence of pp7 RNA leads to a significant fluorescence enhancement at the lacO spot compared with no RNA or only ms2 RNA condition. Data are presented as mean ± S.D., -RNA, n = 23; +ms2, n = 25; +ms2-pp7, n = 24, +ms2-pp7m, n = 26. *** P < 0.001.
    Wildtype Or Mutant (Ggagcagacgatggcgtcgctcc) Pp7 Stem–Loops, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pp7+stem/pmc08501972-31-21-20?v=Eurofins
    Average 90 stars, based on 1 article reviews
    wildtype or mutant (ggagcagacgatggcgtcgctcc) pp7 stem–loops - by Bioz Stars, 2026-07
    90/100 stars
      Buy from Supplier

    90
    Addgene inc pp7 stem-loops plasmids
    a Schematics of the transcriptional response induced by the MAPK Hog1 upon osmotic stress. Under normal growth conditions, the genomic locus is repressed by histones set in place by the Ino80 complex and Asf1/Rtt109. In addition, H3K4 methylated histones mediated by Set1 contribute to the further repression of the locus (upper panel). When Hog1 is active (lower panel), it accumulates in the nucleus with the transcription factors Msn2/4. Hog1 binds to the transcription factors Hot1 and Sko1, allowing the remodeling of the chromatin by Rpd3 and the SAGA complex. The polymerases can be recruited to the locus and the RSC and SWR complexes evict nucleosomes on the ORF. b Construction of the transcriptional reporter. The promoter of interest (p PROM ) is cloned in front of 24 stem-loops ( 24xPP7sl ). This construct is transformed in yeast and integrated in the GLT1 locus 5′UTR, replacing the endogenous promoter. Upon induction of the promoter of interest, the mRNA stem-loops are transcribed and recognized by the fluorescently-tagged <t>PP7</t> phage coat proteins. c Maximum intensity projections of Z-stacks of microscopy images from the p STL1 -PP7sl reporter system in a 0.2 M NaCl osmotic stress time-lapse experiment. The appearance of bright foci (arrow heads) in the nucleus of the cells denotes the active transcription arising from the promoter. Scale bar represents 5 µm. Representative images from at least three biological replicates. d Dynamics of the p STL1 -PP7sl transcription site intensity (20 brightest pixels in the nucleus minus the median fluorescence of the cell) following hyperosmotic stress. The mean of the population is represented by the solid line. The shaded areas represent the s.e.m. Number of cells for each trace: 0.0 M: 313; 0.1 M: 404; 0.2 M: 229; 0.3 M: 201. e Analysis of one representative single-cell trace. The raw trace (gray) is smoothed with a moving average (dark blue) and normalized by subtracting the intensity of the first time point after the stimulus. Multiple quantitative values can be extracted from this trace (see Methods). Source data are provided for d .
    Pp7 Stem Loops Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pp7+stem/pmc07311541-275-1-15?v=Addgene+inc
    Average 90 stars, based on 1 article reviews
    pp7 stem-loops plasmids - by Bioz Stars, 2026-07
    90/100 stars
      Buy from Supplier

    93
    Addgene inc pp7 stem loop sequence
    Fig. 3. Break-induced transcription initiation. Time-lapse, multiplane, spinning disk confocal microscopy recordings of EX2 reporter transcription dynamics in live cells revealed by the dual labeling of nascent transcripts with MS2-RFP and <t>PP7-GFP</t> in the absence [(A) no TA] or upon [(B and C) +TA] DNA damage. The dual-line plots represent the number (n) of transcripts detected at the transcription site over time. The bar graph in (A) shows the frequency of cells that exhibit a pattern of continuous (Contin.) and suppressed/terminated (Term.) transcription. The bar graph in (B) shows the frequency of cells, where preexisting transcription was sup- pressed in response to TA treatment and either resumes (Resume) or remains silenced (Term.) during the entire imaging period. A representative pattern of transcription resuming is depicted on the images and dual-line plot in (B). (C) Representative images and dual-line plot of a recorded cell where only the PP7-GFP fluorescence is observed after the damage-induced termination and before dual-labeled transcripts are detected. The bar graph depicts the frequency of cells that exhibit a similar uncoupling of the MS2-RFP and PP7-GFP fluorescent signal (Uncoupl.) and those where transcription resumed as illustrated in (B) (Coupl.). (D) Western blot analysis of DNA ligase IV in control (ctrl) or DNA ligase IV small interfering RNA (siRNA)–depleted cells. a-Tubulin and total histone H3 serve as loading controls. The bar graph depicts the frequency of cells that either resume or irreversibly terminate transcription after induction of the DSB in DNA ligase IV–depleted cells. kd, knockdown; RNAi, RNA interference.
    Pp7 Stem Loop Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pp7+stem/pm30662944-174-2-9?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    pp7 stem loop sequence - by Bioz Stars, 2026-07
    93/100 stars
      Buy from Supplier

    Image Search Results


    Schematic of components and plasmid combinations for typical SunRISER mRNA-labeling experiments (A) mRNA and protein components for SunRISER labeling experiments. (B) Schematics of SunRISER variants SRv.1 (top), SRv.1.1 (center), and SRv.1.2 (bottom) for fluorescence signal amplification. The mRNA transcript (black) is tagged at 3′ UTR with PP7 stem loops (blue). In the first stage of signal amplification, each stem loop can be bound by two PCP coat proteins (yellow) fused to a SunTag GCN4 peptide array (orange). In the second stage of signal amplification, GFP (green) is recruited through antibody-peptide-specific binding between scFv (gray) and GCN4 epitopes. (C) Plasmid maps of the SunRISER two-plasmid (2P) variants consisting of detection plasmids (left) and protein plasmids for SRv.1-2P (top), SRv.1.1-2P (center), and SRv.1.2-2P (bottom). Using the indicated plasmids from Addgene, the GOI CDS for SRv.1 (top, left) is CFP and the GOI CDS for SRv.1.1 and SRv.1.2 (center and bottom, left) is mCherry. Although the 2P variants of SunRISER are simpler to work with, SunRISER variants using three plasmids as described previously in can be used as outlined previously and in <xref ref-type=Table 1 . " width="100%" height="100%">

    Journal: STAR Protocols

    Article Title: Label and quantify mRNA molecules in live cell experiments using SunRISER and dNEMO

    doi: 10.1016/j.xpro.2022.101630

    Figure Lengend Snippet: Schematic of components and plasmid combinations for typical SunRISER mRNA-labeling experiments (A) mRNA and protein components for SunRISER labeling experiments. (B) Schematics of SunRISER variants SRv.1 (top), SRv.1.1 (center), and SRv.1.2 (bottom) for fluorescence signal amplification. The mRNA transcript (black) is tagged at 3′ UTR with PP7 stem loops (blue). In the first stage of signal amplification, each stem loop can be bound by two PCP coat proteins (yellow) fused to a SunTag GCN4 peptide array (orange). In the second stage of signal amplification, GFP (green) is recruited through antibody-peptide-specific binding between scFv (gray) and GCN4 epitopes. (C) Plasmid maps of the SunRISER two-plasmid (2P) variants consisting of detection plasmids (left) and protein plasmids for SRv.1-2P (top), SRv.1.1-2P (center), and SRv.1.2-2P (bottom). Using the indicated plasmids from Addgene, the GOI CDS for SRv.1 (top, left) is CFP and the GOI CDS for SRv.1.1 and SRv.1.2 (center and bottom, left) is mCherry. Although the 2P variants of SunRISER are simpler to work with, SunRISER variants using three plasmids as described previously in can be used as outlined previously and in Table 1 .

    Article Snippet: Among the SunRISER plasmid toolkit, we provide 2 different stem-loop array lengths of PP7 stem-loops (8×PP7, 10×PP7), and plasmids for 24×PP7 are also available (Addgene #40652).

    Techniques: Plasmid Preparation, Labeling, Fluorescence, Amplification, Peptide Microarray, Binding Assay

    Development of the RNA fluorescence three-hybrid assay (rF3H) for RNA–protein interaction studies. ( A ) Principle of the rF3H assay. Three components for the assay, RNA of interest, protein of interest and an RNA trap, are triply expressed in cells containing lacO array on the genome. Tagged with ms2 stem–loop structures, the RNA of interest is recruited and anchored to the lacO loci by the RNA trap, the protein of interest therefore is enriched at the lacO loci by interacting with the RNA of interest, and the interaction between the protein and RNA can be visualized as co-localization of the fused red and green fluorescent proteins. ( B ) Image examples of pp7 RNA-PCP interaction visualized by rF3H. The RNA trap marked by EGFP was anchored at the lacO array and visualized as a nuclear fluorescent spot (EGFP channel, marked by filled arrowhead), and the mCherry labeled PCP (PCP-mCherry) was recruited to the lacO spot specifically in the presence of pp7 RNA (lower panel, marked by filled arrowhead), but neither in the mutant pp7 group nor in the control group (mCherry channel of the upper and middle panels, marked by open arrowhead). Merge channels were enhanced for clarity purposes. Scale bars are 10 μm. ( C ) Quantification of the relative mCherry signal at the lacO array. The presence of pp7 RNA leads to a significant fluorescence enhancement at the lacO spot compared with no RNA or only ms2 RNA condition. Data are presented as mean ± S.D., -RNA, n = 23; +ms2, n = 25; +ms2-pp7, n = 24, +ms2-pp7m, n = 26. *** P < 0.001.

    Journal: Nucleic Acids Research

    Article Title: Visualization and characterization of RNA–protein interactions in living cells

    doi: 10.1093/nar/gkab614

    Figure Lengend Snippet: Development of the RNA fluorescence three-hybrid assay (rF3H) for RNA–protein interaction studies. ( A ) Principle of the rF3H assay. Three components for the assay, RNA of interest, protein of interest and an RNA trap, are triply expressed in cells containing lacO array on the genome. Tagged with ms2 stem–loop structures, the RNA of interest is recruited and anchored to the lacO loci by the RNA trap, the protein of interest therefore is enriched at the lacO loci by interacting with the RNA of interest, and the interaction between the protein and RNA can be visualized as co-localization of the fused red and green fluorescent proteins. ( B ) Image examples of pp7 RNA-PCP interaction visualized by rF3H. The RNA trap marked by EGFP was anchored at the lacO array and visualized as a nuclear fluorescent spot (EGFP channel, marked by filled arrowhead), and the mCherry labeled PCP (PCP-mCherry) was recruited to the lacO spot specifically in the presence of pp7 RNA (lower panel, marked by filled arrowhead), but neither in the mutant pp7 group nor in the control group (mCherry channel of the upper and middle panels, marked by open arrowhead). Merge channels were enhanced for clarity purposes. Scale bars are 10 μm. ( C ) Quantification of the relative mCherry signal at the lacO array. The presence of pp7 RNA leads to a significant fluorescence enhancement at the lacO spot compared with no RNA or only ms2 RNA condition. Data are presented as mean ± S.D., -RNA, n = 23; +ms2, n = 25; +ms2-pp7, n = 24, +ms2-pp7m, n = 26. *** P < 0.001.

    Article Snippet: After that, 4 of 6 times ms2 stem–loops were replaced by 4 times of wildtype or mutant (GGAGCAGACGATGGCGTCGCTCC, synthesized by Eurofins) pp7 stem–loops, whole-length NORAD, HOTAIR 1–300 and its shortened fragments, as well as NORAD/HOTAIR 201–300 hybrid fragment, to get the respective ms2 tagged RNA plasmids.

    Techniques: Fluorescence, Hybrid Assay, Labeling, Mutagenesis, Control

    a Schematics of the transcriptional response induced by the MAPK Hog1 upon osmotic stress. Under normal growth conditions, the genomic locus is repressed by histones set in place by the Ino80 complex and Asf1/Rtt109. In addition, H3K4 methylated histones mediated by Set1 contribute to the further repression of the locus (upper panel). When Hog1 is active (lower panel), it accumulates in the nucleus with the transcription factors Msn2/4. Hog1 binds to the transcription factors Hot1 and Sko1, allowing the remodeling of the chromatin by Rpd3 and the SAGA complex. The polymerases can be recruited to the locus and the RSC and SWR complexes evict nucleosomes on the ORF. b Construction of the transcriptional reporter. The promoter of interest (p PROM ) is cloned in front of 24 stem-loops ( 24xPP7sl ). This construct is transformed in yeast and integrated in the GLT1 locus 5′UTR, replacing the endogenous promoter. Upon induction of the promoter of interest, the mRNA stem-loops are transcribed and recognized by the fluorescently-tagged PP7 phage coat proteins. c Maximum intensity projections of Z-stacks of microscopy images from the p STL1 -PP7sl reporter system in a 0.2 M NaCl osmotic stress time-lapse experiment. The appearance of bright foci (arrow heads) in the nucleus of the cells denotes the active transcription arising from the promoter. Scale bar represents 5 µm. Representative images from at least three biological replicates. d Dynamics of the p STL1 -PP7sl transcription site intensity (20 brightest pixels in the nucleus minus the median fluorescence of the cell) following hyperosmotic stress. The mean of the population is represented by the solid line. The shaded areas represent the s.e.m. Number of cells for each trace: 0.0 M: 313; 0.1 M: 404; 0.2 M: 229; 0.3 M: 201. e Analysis of one representative single-cell trace. The raw trace (gray) is smoothed with a moving average (dark blue) and normalized by subtracting the intensity of the first time point after the stimulus. Multiple quantitative values can be extracted from this trace (see Methods). Source data are provided for d .

    Journal: Nature Communications

    Article Title: Single-particle imaging of stress-promoters induction reveals the interplay between MAPK signaling, chromatin and transcription factors

    doi: 10.1038/s41467-020-16943-w

    Figure Lengend Snippet: a Schematics of the transcriptional response induced by the MAPK Hog1 upon osmotic stress. Under normal growth conditions, the genomic locus is repressed by histones set in place by the Ino80 complex and Asf1/Rtt109. In addition, H3K4 methylated histones mediated by Set1 contribute to the further repression of the locus (upper panel). When Hog1 is active (lower panel), it accumulates in the nucleus with the transcription factors Msn2/4. Hog1 binds to the transcription factors Hot1 and Sko1, allowing the remodeling of the chromatin by Rpd3 and the SAGA complex. The polymerases can be recruited to the locus and the RSC and SWR complexes evict nucleosomes on the ORF. b Construction of the transcriptional reporter. The promoter of interest (p PROM ) is cloned in front of 24 stem-loops ( 24xPP7sl ). This construct is transformed in yeast and integrated in the GLT1 locus 5′UTR, replacing the endogenous promoter. Upon induction of the promoter of interest, the mRNA stem-loops are transcribed and recognized by the fluorescently-tagged PP7 phage coat proteins. c Maximum intensity projections of Z-stacks of microscopy images from the p STL1 -PP7sl reporter system in a 0.2 M NaCl osmotic stress time-lapse experiment. The appearance of bright foci (arrow heads) in the nucleus of the cells denotes the active transcription arising from the promoter. Scale bar represents 5 µm. Representative images from at least three biological replicates. d Dynamics of the p STL1 -PP7sl transcription site intensity (20 brightest pixels in the nucleus minus the median fluorescence of the cell) following hyperosmotic stress. The mean of the population is represented by the solid line. The shaded areas represent the s.e.m. Number of cells for each trace: 0.0 M: 313; 0.1 M: 404; 0.2 M: 229; 0.3 M: 201. e Analysis of one representative single-cell trace. The raw trace (gray) is smoothed with a moving average (dark blue) and normalized by subtracting the intensity of the first time point after the stimulus. Multiple quantitative values can be extracted from this trace (see Methods). Source data are provided for d .

    Article Snippet: The PP7 stem-loops plasmids are based on the previously published p POL1 24xPP7sl integrative plasmid (Addgene #35196).

    Techniques: Methylation, Clone Assay, Construct, Transformation Assay, Microscopy, Fluorescence

    a Dynamics of the transcription site intensity from six different promoters following a 0.2 M NaCl stress. The mean of at least 140 cells is represented by the solid line. The shaded areas represent the s.e.m. Number of cells for each trace: p ALD3 : 171; p CTT1 : 140; p STL1 : 229; p GRE2 : 289; p HSP12 : 243; p GPD1 : 335. b Percentage of cells where a PP7 TS site was detected. The light shaded area represents the percentage of PP7 positive cells before the stimulus was added (basal transcription). c The microscopy thumbnails display cells bearing the p GPD1 -PP7sl reporter system, where transcription sites (arrow heads) can be detected before and after the stress of 0.2 M NaCl. Scale bar represents 5 µm. Representative images from at least three biological replicates. d Cumulative distribution function (CDF) of the Start Time for each promoter considering only the cells that induce transcription after time zero. e 10th, 50th and 90th percentiles of the Start Times shown for the two to three replicates measured for each promoter. f Cumulative distribution functions of Start Times for the p STL1 -PP7sl strain in wild type, htz1∆ or gcn5∆ backgrounds. The inset shows the percentage of PP7 positive cells in each background. g Cumulative distribution functions of Start Times for the p STL1 -PP7sl strain grown in glucose or raffinose. The inset shows the percentage of PP7 positive cells, the light blue bar the basal positive PP7 cells. Source data are provided for a , f , and g .

    Journal: Nature Communications

    Article Title: Single-particle imaging of stress-promoters induction reveals the interplay between MAPK signaling, chromatin and transcription factors

    doi: 10.1038/s41467-020-16943-w

    Figure Lengend Snippet: a Dynamics of the transcription site intensity from six different promoters following a 0.2 M NaCl stress. The mean of at least 140 cells is represented by the solid line. The shaded areas represent the s.e.m. Number of cells for each trace: p ALD3 : 171; p CTT1 : 140; p STL1 : 229; p GRE2 : 289; p HSP12 : 243; p GPD1 : 335. b Percentage of cells where a PP7 TS site was detected. The light shaded area represents the percentage of PP7 positive cells before the stimulus was added (basal transcription). c The microscopy thumbnails display cells bearing the p GPD1 -PP7sl reporter system, where transcription sites (arrow heads) can be detected before and after the stress of 0.2 M NaCl. Scale bar represents 5 µm. Representative images from at least three biological replicates. d Cumulative distribution function (CDF) of the Start Time for each promoter considering only the cells that induce transcription after time zero. e 10th, 50th and 90th percentiles of the Start Times shown for the two to three replicates measured for each promoter. f Cumulative distribution functions of Start Times for the p STL1 -PP7sl strain in wild type, htz1∆ or gcn5∆ backgrounds. The inset shows the percentage of PP7 positive cells in each background. g Cumulative distribution functions of Start Times for the p STL1 -PP7sl strain grown in glucose or raffinose. The inset shows the percentage of PP7 positive cells, the light blue bar the basal positive PP7 cells. Source data are provided for a , f , and g .

    Article Snippet: The PP7 stem-loops plasmids are based on the previously published p POL1 24xPP7sl integrative plasmid (Addgene #35196).

    Techniques: Microscopy

    a In Hog1 nuclear relocation traces obtained from single cells, the timing of Hog1 nuclear entry (square), maximum enrichment (circle), start of the decay in nuclear enrichment (diamond) and Hog1 adaptation (triangle) can be identified (upper panel). The median (marker) and 25th to 75th percentiles (lines) for these measurements performed on a population of more than 300 cells are plotted for three different osmotic stresses (central panel). The cumulative distribution functions of Start Times for the p STL1 -PP7sl reporter for these same three concentrations are plotted (lower panel). b Histograms of Start Times following a 0.2 M stress for the five other promoters tested. The vertical dashed line represents the median decay time of Hog1 measured at 0.2 M. The number in the legend indicates the percentage of cells, which have initiated transcription before the median Hog1 decay time. c The population of p STL1 -PP7sl positive cells is split in four quartiles based on their Start Time. The median (circle) and 25th to 75th percentiles (line) of the integral of the PP7 trace is plotted for each quartile of at least 50 cells. Source data are provided for a .

    Journal: Nature Communications

    Article Title: Single-particle imaging of stress-promoters induction reveals the interplay between MAPK signaling, chromatin and transcription factors

    doi: 10.1038/s41467-020-16943-w

    Figure Lengend Snippet: a In Hog1 nuclear relocation traces obtained from single cells, the timing of Hog1 nuclear entry (square), maximum enrichment (circle), start of the decay in nuclear enrichment (diamond) and Hog1 adaptation (triangle) can be identified (upper panel). The median (marker) and 25th to 75th percentiles (lines) for these measurements performed on a population of more than 300 cells are plotted for three different osmotic stresses (central panel). The cumulative distribution functions of Start Times for the p STL1 -PP7sl reporter for these same three concentrations are plotted (lower panel). b Histograms of Start Times following a 0.2 M stress for the five other promoters tested. The vertical dashed line represents the median decay time of Hog1 measured at 0.2 M. The number in the legend indicates the percentage of cells, which have initiated transcription before the median Hog1 decay time. c The population of p STL1 -PP7sl positive cells is split in four quartiles based on their Start Time. The median (circle) and 25th to 75th percentiles (line) of the integral of the PP7 trace is plotted for each quartile of at least 50 cells. Source data are provided for a .

    Article Snippet: The PP7 stem-loops plasmids are based on the previously published p POL1 24xPP7sl integrative plasmid (Addgene #35196).

    Techniques: Marker

    a Violin plots of the trace intensity (maximum of the TS during the transcription period) for the six promoters after stimulation by 0.2 M NaCl. Each dot represents the value calculated from a single cell. The solid line is the median and the dashed line the mean of the population. b Comparison between the trace intensity in stimulated (0.2 M NaCl) and unstimulated conditions (0.0 M) for the three promoters displaying basal expression. c .– f Effects of the deletions of the HOT1 and SKO1 transcription factor genes on p STL1 and p GPD1 dynamics of transcription ( c , the solid lines represent the mean of the population and the shaded areas represent the s.e.m.), cumulative distribution functions of Start Times ( d ), the trace intensity ( e ) and the percentage of responding cells ( f ) for the p STL1 -PP7sl and p GPD1 -PP7sl reporter strains following a 0.2 M NaCl stress for at least 200 cells. For the p STL1 -PP7sl hot1∆ sample, 349 cells were analyzed with only 9 displaying a PP7 TS signal. This low number does not allow to draw a meaningful CDF curve in d . Source data are provided for b and c .

    Journal: Nature Communications

    Article Title: Single-particle imaging of stress-promoters induction reveals the interplay between MAPK signaling, chromatin and transcription factors

    doi: 10.1038/s41467-020-16943-w

    Figure Lengend Snippet: a Violin plots of the trace intensity (maximum of the TS during the transcription period) for the six promoters after stimulation by 0.2 M NaCl. Each dot represents the value calculated from a single cell. The solid line is the median and the dashed line the mean of the population. b Comparison between the trace intensity in stimulated (0.2 M NaCl) and unstimulated conditions (0.0 M) for the three promoters displaying basal expression. c .– f Effects of the deletions of the HOT1 and SKO1 transcription factor genes on p STL1 and p GPD1 dynamics of transcription ( c , the solid lines represent the mean of the population and the shaded areas represent the s.e.m.), cumulative distribution functions of Start Times ( d ), the trace intensity ( e ) and the percentage of responding cells ( f ) for the p STL1 -PP7sl and p GPD1 -PP7sl reporter strains following a 0.2 M NaCl stress for at least 200 cells. For the p STL1 -PP7sl hot1∆ sample, 349 cells were analyzed with only 9 displaying a PP7 TS signal. This low number does not allow to draw a meaningful CDF curve in d . Source data are provided for b and c .

    Article Snippet: The PP7 stem-loops plasmids are based on the previously published p POL1 24xPP7sl integrative plasmid (Addgene #35196).

    Techniques: Expressing

    a Violin plots representing the Transcription Period (time difference between End Time and Start Time) measured for the p STL1 -PP7sl reporter following 0.1, 0.2, and 0.3 M NaCl stresses. Each dot represents the value calculated from a single cell. The solid line is the median and the dashed line the mean of the population. b One minus the cumulative distribution function of End Times for the p STL1 -PP7sl reporter. The vertical dashed lines represent the median adaptation time of Hog1 for the three different stress levels. c Dynamics of the estimated NaCl concentrations in the medium for the pulse, step, and ramp experiment protocols (upper panel, Methods). Corresponding Hog1 relocation dynamics (middle panel) and p STL1 -PP7sl transcription site intensity (lower panel). The mean of at least 180 cells is represented by the solid line. The shaded areas represent the s.e.m. d Cumulative distribution function (CDF) of the Start Time for all cells in the pulse, step, and ramp experiments. The CDF at 15 min represents the fraction of responding cells for each condition. e One minus the cumulative distribution function of End Times only for the responding cells in the pulse, step, and ramp experiments. f Correlation between the Hog1 adaptation time and the PP7 End Time measured in the same cells in the pulse, step, and ramp experiments. The open markers indicate cells where Hog1 has not adapted at the end of the time lapse. Adaptation time is arbitrarily set to 35 min for this sub-population. Source data are provided for c .

    Journal: Nature Communications

    Article Title: Single-particle imaging of stress-promoters induction reveals the interplay between MAPK signaling, chromatin and transcription factors

    doi: 10.1038/s41467-020-16943-w

    Figure Lengend Snippet: a Violin plots representing the Transcription Period (time difference between End Time and Start Time) measured for the p STL1 -PP7sl reporter following 0.1, 0.2, and 0.3 M NaCl stresses. Each dot represents the value calculated from a single cell. The solid line is the median and the dashed line the mean of the population. b One minus the cumulative distribution function of End Times for the p STL1 -PP7sl reporter. The vertical dashed lines represent the median adaptation time of Hog1 for the three different stress levels. c Dynamics of the estimated NaCl concentrations in the medium for the pulse, step, and ramp experiment protocols (upper panel, Methods). Corresponding Hog1 relocation dynamics (middle panel) and p STL1 -PP7sl transcription site intensity (lower panel). The mean of at least 180 cells is represented by the solid line. The shaded areas represent the s.e.m. d Cumulative distribution function (CDF) of the Start Time for all cells in the pulse, step, and ramp experiments. The CDF at 15 min represents the fraction of responding cells for each condition. e One minus the cumulative distribution function of End Times only for the responding cells in the pulse, step, and ramp experiments. f Correlation between the Hog1 adaptation time and the PP7 End Time measured in the same cells in the pulse, step, and ramp experiments. The open markers indicate cells where Hog1 has not adapted at the end of the time lapse. Adaptation time is arbitrarily set to 35 min for this sub-population. Source data are provided for c .

    Article Snippet: The PP7 stem-loops plasmids are based on the previously published p POL1 24xPP7sl integrative plasmid (Addgene #35196).

    Techniques:

    Fig. 3. Break-induced transcription initiation. Time-lapse, multiplane, spinning disk confocal microscopy recordings of EX2 reporter transcription dynamics in live cells revealed by the dual labeling of nascent transcripts with MS2-RFP and PP7-GFP in the absence [(A) no TA] or upon [(B and C) +TA] DNA damage. The dual-line plots represent the number (n) of transcripts detected at the transcription site over time. The bar graph in (A) shows the frequency of cells that exhibit a pattern of continuous (Contin.) and suppressed/terminated (Term.) transcription. The bar graph in (B) shows the frequency of cells, where preexisting transcription was sup- pressed in response to TA treatment and either resumes (Resume) or remains silenced (Term.) during the entire imaging period. A representative pattern of transcription resuming is depicted on the images and dual-line plot in (B). (C) Representative images and dual-line plot of a recorded cell where only the PP7-GFP fluorescence is observed after the damage-induced termination and before dual-labeled transcripts are detected. The bar graph depicts the frequency of cells that exhibit a similar uncoupling of the MS2-RFP and PP7-GFP fluorescent signal (Uncoupl.) and those where transcription resumed as illustrated in (B) (Coupl.). (D) Western blot analysis of DNA ligase IV in control (ctrl) or DNA ligase IV small interfering RNA (siRNA)–depleted cells. a-Tubulin and total histone H3 serve as loading controls. The bar graph depicts the frequency of cells that either resume or irreversibly terminate transcription after induction of the DSB in DNA ligase IV–depleted cells. kd, knockdown; RNAi, RNA interference.

    Journal: Science advances

    Article Title: Single-molecule imaging of transcription at damaged chromatin.

    doi: 10.1126/sciadv.aau1249

    Figure Lengend Snippet: Fig. 3. Break-induced transcription initiation. Time-lapse, multiplane, spinning disk confocal microscopy recordings of EX2 reporter transcription dynamics in live cells revealed by the dual labeling of nascent transcripts with MS2-RFP and PP7-GFP in the absence [(A) no TA] or upon [(B and C) +TA] DNA damage. The dual-line plots represent the number (n) of transcripts detected at the transcription site over time. The bar graph in (A) shows the frequency of cells that exhibit a pattern of continuous (Contin.) and suppressed/terminated (Term.) transcription. The bar graph in (B) shows the frequency of cells, where preexisting transcription was sup- pressed in response to TA treatment and either resumes (Resume) or remains silenced (Term.) during the entire imaging period. A representative pattern of transcription resuming is depicted on the images and dual-line plot in (B). (C) Representative images and dual-line plot of a recorded cell where only the PP7-GFP fluorescence is observed after the damage-induced termination and before dual-labeled transcripts are detected. The bar graph depicts the frequency of cells that exhibit a similar uncoupling of the MS2-RFP and PP7-GFP fluorescent signal (Uncoupl.) and those where transcription resumed as illustrated in (B) (Coupl.). (D) Western blot analysis of DNA ligase IV in control (ctrl) or DNA ligase IV small interfering RNA (siRNA)–depleted cells. a-Tubulin and total histone H3 serve as loading controls. The bar graph depicts the frequency of cells that either resume or irreversibly terminate transcription after induction of the DSB in DNA ligase IV–depleted cells. kd, knockdown; RNAi, RNA interference.

    Article Snippet: The 24 PP7 stem-loop sequence was excised from pCR4-24xPP7SL [Addgene plasmid no. 31864 (28)] by Bam HI and Bgl II digest and inserted into the Bam HI site of pCMV5-24xMS2SL, generating pCMV5-24xMS2SL-24xPP7SL.

    Techniques: Confocal Microscopy, Labeling, Imaging, Fluorescence, Western Blot, Control, Small Interfering RNA, Knockdown