Review



eft 3p  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 92
      Buy from Supplier

    Structured Review

    Addgene inc eft 3p
    Eft 3p, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pms79/pMS79+(eft-3p%3A%3ACas9+%2B+sgRNA)+(Plasmid+%23154839)/pmc11544243-314-20-51
    Average 92 stars, based on 4 article reviews
    eft 3p - by Bioz Stars, 2026-09
    92/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Expansion of the split hygromycin toolkit for transgene insertion in Caenorhabditis elegans
    Article Snippet: pMS59 , Cas9 + guide plasmid targeting ChrI landing pad , eef-1A.1 p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG , , Addgene. .. pMS79 , Cas9 + guide plasmid targeting ChrII landing pad , eef-1A.1 p::Cas9 + U6p::GGACAGTCCTGCCGAGGTGG , , Addgene. .. pMS77 , Cas9 + guide plasmid targeting ChrIII landing pad , eef-1A.1 p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG , , Addgene.



    Similar Products

    eft 3p  (Addgene inc)
    92
    Addgene inc eft 3p
    Eft 3p, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pms79/pMS79+(eft-3p%3A%3ACas9+%2B+sgRNA)+(Plasmid+%23154839)/pmc11544243-314-20-51
    Average 92 stars, based on 1 article reviews
    eft 3p - by Bioz Stars, 2026-09
    92/100 stars
    		  Buy from Supplier
    pms79  (Addgene inc)
    92
    Addgene inc pms79

    Pms79, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pms79/pMS79+(eft-3p%3A%3ACas9+%2B+sgRNA)+(Plasmid+%23154839)/pmc10862133-29-0-19
    Average 92 stars, based on 1 article reviews
    pms79 - by Bioz Stars, 2026-09
    92/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: microPublication Biology

    Article Title: Expansion of the split hygromycin toolkit for transgene insertion in Caenorhabditis elegans

    doi: 10.17912/micropub.biology.001091

    Figure Lengend Snippet:

    Article Snippet: pMS79 , Cas9 + guide plasmid targeting ChrII landing pad , eef-1A.1 p::Cas9 + U6p::GGACAGTCCTGCCGAGGTGG , ​​ ​ , Addgene.

    Techniques: Plasmid Preparation, Generated, Marker, Clone Assay, Expressing