plenticrisprv2 plasmid encoding guide rna targeting cypa (Addgene inc)
Addgene inc is a verified supplier 
98
Structured Review
Addgene inc
plenticrisprv2 plasmid encoding guide rna targeting cypa
Plenticrisprv2 Plasmid Encoding Guide Rna Targeting Cypa, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 15695 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plenticrisprv2/psPAX2+(Plasmid+%2312260)/bio_rxiv__64898__2026__10__07__757322-55-4-19
Average 98 stars, based on 15695 article reviews
Plenticrisprv2 Plasmid Encoding Guide Rna Targeting Cypa, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 15695 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plenticrisprv2/psPAX2+(Plasmid+%2312260)/bio_rxiv__64898__2026__10__07__757322-55-4-19
Average 98 stars, based on 15695 article reviews
plenticrisprv2 plasmid encoding guide rna targeting cypa - by Bioz Stars,
2026-10
98/100 stars
Images
Related Articles
Clone Assay:Article Title: Degraders of the dengue virus capsid protein exhibit differentiated pharmacology relative to capsid inhibitors Article Snippet: To generate plasmids for CRBN knockout, the guide RNA sequences were designed using Benchling, and oligos were synthesized from Integrated DNA Technology (IDT). .. The oligos 5’-caccgCAGGACGCTGCGCACAACAT-3’ and 5’-aaacATGTTGTGCGCAGCGTCCTGc-3’ were cloned into Article Title: Degraders of the dengue virus capsid protein exhibit differentiated pharmacology relative to capsid inhibitors. Article Snippet: To generate plasmids for CRBN knockout, the guide RNA sequences were designed using Benchling, and oligos were synthesized from Integrated DNA Technology (IDT). .. The oligos 5’- caccgCAGGACGCTGCGCACAACAT -3’ and 5’- aaacATGTTGTGCGCAGCGTCCTGc -3’ were cloned into Article Title: The PAXT connection is a modifier of rare codon-enriched protein expression Article Snippet: .. Oligonucleotides encoding these sgRNAs were synthesizedby IntegratedDNATechnologies (IDT) and separately cloned into Article Title: Gα12/13 deficiency attenuates obesity-associated adipose tissue inflammation and promotes energy expenditure Article Snippet: .. Each sgRNAsequences forGna12 (TGTTGTCGAAGATGGTGTCG) and Gna13 (CTTGGATAAACTTGGAGTAC) were cloned into Plasmid Preparation:Article Title: Degraders of the dengue virus capsid protein exhibit differentiated pharmacology relative to capsid inhibitors Article Snippet: To generate plasmids for CRBN knockout, the guide RNA sequences were designed using Benchling, and oligos were synthesized from Integrated DNA Technology (IDT). .. The oligos 5’-caccgCAGGACGCTGCGCACAACAT-3’ and 5’-aaacATGTTGTGCGCAGCGTCCTGc-3’ were cloned into Article Title: In vivo CRISPR/Cas9 screens identify new regulators of B cell activation and plasma cell differentiation Article Snippet: .. LV sgRNA expression vectors were generated using pLentiCRISPRv1 (Addgene plasmid no. 49535) or Article Title: Degraders of the dengue virus capsid protein exhibit differentiated pharmacology relative to capsid inhibitors. Article Snippet: To generate plasmids for CRBN knockout, the guide RNA sequences were designed using Benchling, and oligos were synthesized from Integrated DNA Technology (IDT). .. The oligos 5’- caccgCAGGACGCTGCGCACAACAT -3’ and 5’- aaacATGTTGTGCGCAGCGTCCTGc -3’ were cloned into Article Title: The PAXT connection is a modifier of rare codon-enriched protein expression Article Snippet: .. Oligonucleotides encoding these sgRNAs were synthesizedby IntegratedDNATechnologies (IDT) and separately cloned into Expressing:Article Title: In vivo CRISPR/Cas9 screens identify new regulators of B cell activation and plasma cell differentiation Article Snippet: .. LV sgRNA expression vectors were generated using pLentiCRISPRv1 (Addgene plasmid no. 49535) or Generated:Article Title: In vivo CRISPR/Cas9 screens identify new regulators of B cell activation and plasma cell differentiation Article Snippet: .. LV sgRNA expression vectors were generated using pLentiCRISPRv1 (Addgene plasmid no. 49535) or Article Title: TMEM106B mediates ACE2-independent replication of the SARS-CoV-2 S-E484D variant in airway-derived cell models Article Snippet: .. other:Article Title: In vivo CRISPR/Cas9 screens identify new regulators of B cell activation and plasma cell differentiation. Article Snippet: Finally, the sections were incubated with donkey anti-rabbit IgG (H+L) Alexa Fluor 568 (A10042; Invitrogen) diluted in PBS containing 2 μg/ml antimouse CD16/32 and 1% BSA and mounted with ProLong Diamond Antifade Mountant (Invitrogen). Derivative Assay:Article Title: TMEM106B mediates ACE2-independent replication of the SARS-CoV-2 S-E484D variant in airway-derived cell models Article Snippet: .. |