Review



situ probe templates for slit1a  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 88
      Buy from Supplier

    Structured Review

    Addgene inc situ probe templates for slit1a
    The trajectories of OSNs in <t>slit1a,</t> slit1b, slit2 , or slit3 knockdown embryos were compared to uninjected sibling controls at 72hpf. (A, B) Neither slit2 or slit3 knockdown induced errors in DZ-projecting BacOR130-1 or CZ-projecting BacOR111-7 OSNs. (C) Neither slit1a or slit1b knockdown induced errors in CZ-projecting BacOR111-7 OSNs. (D, E, F) Similar results were obtained when both slit2 and slit3 were knocked down together or when both slit1a and slit1b were knocked down together. Statistical comparisons were performed using a two-tailed Fisher’s Exact test.
    Situ Probe Templates For Slit1a, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+template/Zf+Slit1a+(Plasmid+%2361279)/bio_rxiv__64898__2026__03__19__709608-80-1-6
    Average 88 stars, based on 2 article reviews
    situ probe templates for slit1a - by Bioz Stars, 2026-09
    88/100 stars

    Images

    1) Product Images from "The contribution of Robos to olfactory sensory axon targeting in the olfactory bulb"

    Article Title: The contribution of Robos to olfactory sensory axon targeting in the olfactory bulb

    Journal: bioRxiv

    doi: 10.64898/2026.03.19.709608

    The trajectories of OSNs in slit1a, slit1b, slit2 , or slit3 knockdown embryos were compared to uninjected sibling controls at 72hpf. (A, B) Neither slit2 or slit3 knockdown induced errors in DZ-projecting BacOR130-1 or CZ-projecting BacOR111-7 OSNs. (C) Neither slit1a or slit1b knockdown induced errors in CZ-projecting BacOR111-7 OSNs. (D, E, F) Similar results were obtained when both slit2 and slit3 were knocked down together or when both slit1a and slit1b were knocked down together. Statistical comparisons were performed using a two-tailed Fisher’s Exact test.
    Figure Legend Snippet: The trajectories of OSNs in slit1a, slit1b, slit2 , or slit3 knockdown embryos were compared to uninjected sibling controls at 72hpf. (A, B) Neither slit2 or slit3 knockdown induced errors in DZ-projecting BacOR130-1 or CZ-projecting BacOR111-7 OSNs. (C) Neither slit1a or slit1b knockdown induced errors in CZ-projecting BacOR111-7 OSNs. (D, E, F) Similar results were obtained when both slit2 and slit3 were knocked down together or when both slit1a and slit1b were knocked down together. Statistical comparisons were performed using a two-tailed Fisher’s Exact test.

    Techniques Used: Knockdown, Two Tailed Test

    Fluorescent in situ hybridization was performed at 48 hpf in slit2 F0 knockdown embryos. Hybridization was performed in parallel at the same time as the preparations presented in . Representative 3-µm optical maximum-intensity projections from individual preparations are shown. Upregulation of slit1a and slit3 mRNA in slit2 knockdowns was observed in 3 independent experiments.
    Figure Legend Snippet: Fluorescent in situ hybridization was performed at 48 hpf in slit2 F0 knockdown embryos. Hybridization was performed in parallel at the same time as the preparations presented in . Representative 3-µm optical maximum-intensity projections from individual preparations are shown. Upregulation of slit1a and slit3 mRNA in slit2 knockdowns was observed in 3 independent experiments.

    Techniques Used: In Situ Hybridization, Knockdown, Hybridization

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Impact of essential genes on the success of genome editing experiments generating 3313 new genetically engineered mouse lines.
    Article Snippet: .. PCR‐IVT DNA templates for PCR-IVT were produced using overlapping oligonucleotides in a high-fidelity PCR reaction38 or using a plasmid template (Addgene #4223039) and appropriate primers37. .. PCR amplicons were purified using the Monarch PCR & DNA cleanup kit (New England BioLabs T1030) or the QIAQuick PCR purification kit (Qiagen 28,104) and used as a template for in vitro transcription of the sgRNA with the T7 MEGAshortscriptTM Kit (ThermoFisher AM1354).

    Article Title: Impact of essential genes on the success of genome editing experiments generating 3313 new genetically engineered mouse lines
    Article Snippet: .. DNA templates for PCR-IVT were produced using overlapping oligonucleotides in a high-fidelity PCR reaction or using a plasmid template (Addgene #42230 ) and appropriate primers . .. PCR amplicons were purified using the Monarch PCR & DNA cleanup kit (New England BioLabs T1030) or the QIAQuick PCR purification kit (Qiagen 28,104) and used as a template for in vitro transcription of the sgRNA with the T7 MEGAshortscriptTM Kit (ThermoFisher AM1354).

    Article Title: Jade1 and the HBO1 histone acetyltransferase complex are spatial-selective cofactors of the pluripotency transcription factor Oct4
    Article Snippet: A single base frameshifted version of pFastBac-1 was also generated using the oligos 5′-GATCCATGTCGCATCACCATCACCATCACGAGGCTCGAGGCCATGGTG-3′ and 5′- AATTCACCATGGCCTCGAGCCTCGTGATGGTGATGGTGATGCGACATG-3′. cDNAs encoding WT or S229D Oct4 with C-terminal twin-strep and FLAG-tags were then subcloned into the modified pFastBac-1 vector between the Nco I and Kpn I sites. .. The Ing4 cDNA was amplified using PCR from a plasmid template (Addgene #13289) using 5′-AGGCTCGAGATGGCTGCGGGGATG-3′ and 5′-AGAATGCATTTTCTTCTTCCGTTCTTGG-3′ primers and was cloned into the Xho I and Nsi I sites using the Oct4/pFastBac-1 vector by first excising the Oct4 cDNA using Xho I and Nsi I, preserving the N-terminal His-tag and C-terminal twin-strep tags. ..

    Article Title: Jade1 and the HBO1 histone acetyltransferase complex are spatial-selective cofactors of the pluripotency transcription factor Oct4
    Article Snippet: A single base frameshifted version of pFastBac-1 was also generated using the oligos 5 ′ -GAT CCATGTCGCATCACCATCACCATCACGAGGCTCGAGG CCATGGTG-3 ′ and 5 ′ - AATTCACCATGGCCTCGAGCC TCGTGATGGTGATGGTGATGCGACATG-3 ′ . cDNAs encoding WT or S229D Oct4 with C-terminal twin-strep and FLAG-tags were then subcloned into the modified pFastBac-1 vector between the NcoI and KpnI sites. .. The Ing4 cDNA was amplified using PCR from a plasmid template (Addgene #13289) using 5 ′ -AGGCTCGAGATGGCTGCGGGGATG-3 ′ and 5 ′ -AGAATGCATTTTCTTCTTCCGTTCTTGG-3 ′ primers and was cloned into the XhoI and NsiI sites using the Oct4/pFastBac-1 vector by first excising the Oct4 cDNA using XhoI and NsiI, preserving the N-terminal His-tag and C-terminal twin-strep tags. ..

    Article Title: Inflamed endothelial cells express S1PR1 inhibitor CD69 to induce vascular leak
    Article Snippet: .. For overexpression of human CD69 and CLEC2A (control), the cDNA sequence of each gene were PCR-amplified from a plasmid template (CD69, pSport1-hCD69, and CLEC2A, Addgene #22851) and subcloned in the pCDH-puro vector. ..

    Article Title: Jade1 and the HBO1 complex are spatial-selective cofactors of Oct4
    Article Snippet: A single base frameshifted version of pFastBac-1 was also generated using the oligos 5’-GATCCATGTCGCATCACCATCACCATCACGAGGCTCGAGGCCATGGTG-3’ and 5’-AATTCACCATGGCCTCGAGCCTCGTGATGGTGATGGTGATGCGACATG-3’. cDNAs encoding wild-type or S229D Oct4 with C-terminal twin-strep and FLAG-tags were then subcloned into the modified pFastBac-1 vector between the Nco I and Kpn I sites. .. The Ing4 cDNA was amplified using PCR from a plasmid template (Addgene #13289) using 5’-AGGCTCGAGATGGCTGCGGGGATG-3’ and 5’-AGAATGCATTTTCTTCTTCCGTTCTTGG-3’ primers and was cloned into the Xho I and Nsi I sites using the Oct4/pFastBac-1 vector by first excising the Oct4 cDNA using Xho I and Nsi I, preserving the N-terminal His-tag and C-terminal twin-strep tags. .. HBO1 and hEaf6 gene blocks containing C-terminal twin-strep-tag were synthesized from IDT and cloned into the modified single-base frameshifted pFastBac1 vector using the Xho I and Kpn I sites.

    Article Title: Inflamed endothelial cells express S1PR1 inhibitor CD69 to induce vascular leak.
    Article Snippet: .. Gene overexpression and knockout in HUVEC: For overexpression of human CD69 and CLEC2A (control), the cDNA sequence of each gene were PCR-amplified from a plasmid template (CD69, pSport1-hCD69 and CLEC2A, Addgene #22851) and subcloned in the pCDH-puro vector. ..

    Produced:

    Article Title: Impact of essential genes on the success of genome editing experiments generating 3313 new genetically engineered mouse lines.
    Article Snippet: .. PCR‐IVT DNA templates for PCR-IVT were produced using overlapping oligonucleotides in a high-fidelity PCR reaction38 or using a plasmid template (Addgene #4223039) and appropriate primers37. .. PCR amplicons were purified using the Monarch PCR & DNA cleanup kit (New England BioLabs T1030) or the QIAQuick PCR purification kit (Qiagen 28,104) and used as a template for in vitro transcription of the sgRNA with the T7 MEGAshortscriptTM Kit (ThermoFisher AM1354).

    Article Title: Impact of essential genes on the success of genome editing experiments generating 3313 new genetically engineered mouse lines
    Article Snippet: .. DNA templates for PCR-IVT were produced using overlapping oligonucleotides in a high-fidelity PCR reaction or using a plasmid template (Addgene #42230 ) and appropriate primers . .. PCR amplicons were purified using the Monarch PCR & DNA cleanup kit (New England BioLabs T1030) or the QIAQuick PCR purification kit (Qiagen 28,104) and used as a template for in vitro transcription of the sgRNA with the T7 MEGAshortscriptTM Kit (ThermoFisher AM1354).

    Plasmid Preparation:

    Article Title: Impact of essential genes on the success of genome editing experiments generating 3313 new genetically engineered mouse lines.
    Article Snippet: .. PCR‐IVT DNA templates for PCR-IVT were produced using overlapping oligonucleotides in a high-fidelity PCR reaction38 or using a plasmid template (Addgene #4223039) and appropriate primers37. .. PCR amplicons were purified using the Monarch PCR & DNA cleanup kit (New England BioLabs T1030) or the QIAQuick PCR purification kit (Qiagen 28,104) and used as a template for in vitro transcription of the sgRNA with the T7 MEGAshortscriptTM Kit (ThermoFisher AM1354).

    Article Title: Impact of essential genes on the success of genome editing experiments generating 3313 new genetically engineered mouse lines
    Article Snippet: .. DNA templates for PCR-IVT were produced using overlapping oligonucleotides in a high-fidelity PCR reaction or using a plasmid template (Addgene #42230 ) and appropriate primers . .. PCR amplicons were purified using the Monarch PCR & DNA cleanup kit (New England BioLabs T1030) or the QIAQuick PCR purification kit (Qiagen 28,104) and used as a template for in vitro transcription of the sgRNA with the T7 MEGAshortscriptTM Kit (ThermoFisher AM1354).

    Article Title: Jade1 and the HBO1 histone acetyltransferase complex are spatial-selective cofactors of the pluripotency transcription factor Oct4
    Article Snippet: A single base frameshifted version of pFastBac-1 was also generated using the oligos 5′-GATCCATGTCGCATCACCATCACCATCACGAGGCTCGAGGCCATGGTG-3′ and 5′- AATTCACCATGGCCTCGAGCCTCGTGATGGTGATGGTGATGCGACATG-3′. cDNAs encoding WT or S229D Oct4 with C-terminal twin-strep and FLAG-tags were then subcloned into the modified pFastBac-1 vector between the Nco I and Kpn I sites. .. The Ing4 cDNA was amplified using PCR from a plasmid template (Addgene #13289) using 5′-AGGCTCGAGATGGCTGCGGGGATG-3′ and 5′-AGAATGCATTTTCTTCTTCCGTTCTTGG-3′ primers and was cloned into the Xho I and Nsi I sites using the Oct4/pFastBac-1 vector by first excising the Oct4 cDNA using Xho I and Nsi I, preserving the N-terminal His-tag and C-terminal twin-strep tags. ..

    Article Title: Jade1 and the HBO1 histone acetyltransferase complex are spatial-selective cofactors of the pluripotency transcription factor Oct4
    Article Snippet: A single base frameshifted version of pFastBac-1 was also generated using the oligos 5 ′ -GAT CCATGTCGCATCACCATCACCATCACGAGGCTCGAGG CCATGGTG-3 ′ and 5 ′ - AATTCACCATGGCCTCGAGCC TCGTGATGGTGATGGTGATGCGACATG-3 ′ . cDNAs encoding WT or S229D Oct4 with C-terminal twin-strep and FLAG-tags were then subcloned into the modified pFastBac-1 vector between the NcoI and KpnI sites. .. The Ing4 cDNA was amplified using PCR from a plasmid template (Addgene #13289) using 5 ′ -AGGCTCGAGATGGCTGCGGGGATG-3 ′ and 5 ′ -AGAATGCATTTTCTTCTTCCGTTCTTGG-3 ′ primers and was cloned into the XhoI and NsiI sites using the Oct4/pFastBac-1 vector by first excising the Oct4 cDNA using XhoI and NsiI, preserving the N-terminal His-tag and C-terminal twin-strep tags. ..

    Article Title: Protein translation rate determines neocortical neuron fate
    Article Snippet: Destination vectors were linearized with EcoRI-HF (New England BioLabs). .. Human IRE1α cDNA (NM_001433.3) was amplified from plasmid template [Addgene, #13009 ], using the following oligos: 5’- agattacgctatctgtacaggcATGCCGGCCCGGCGGCTG-3’ and 5’- ggccgctagcccgggtaccgCTTGGTTTGGGAAGCCTGGTCTCCCTGC-3’ and inserted into the modified pRaichu vector . .. Murine eEF2 cDNA (NM_007907.2) was amplified from cDNA library using the following oligos: 5’-gtctcatcattttggcaaagATGCATCATCATCATCATCATGTGAACTTCACAGTAGATC-3’ and 5’-cggccgcgatatcctcgaggCTACAGTTTGTCCAGGAAGTTG-3’ and inserted into pCAGIG vector for simultaneous expression of 6XHis-tagged eEF2 and EGFP.

    Article Title: Inflamed endothelial cells express S1PR1 inhibitor CD69 to induce vascular leak
    Article Snippet: .. For overexpression of human CD69 and CLEC2A (control), the cDNA sequence of each gene were PCR-amplified from a plasmid template (CD69, pSport1-hCD69, and CLEC2A, Addgene #22851) and subcloned in the pCDH-puro vector. ..

    Article Title: Jade1 and the HBO1 complex are spatial-selective cofactors of Oct4
    Article Snippet: A single base frameshifted version of pFastBac-1 was also generated using the oligos 5’-GATCCATGTCGCATCACCATCACCATCACGAGGCTCGAGGCCATGGTG-3’ and 5’-AATTCACCATGGCCTCGAGCCTCGTGATGGTGATGGTGATGCGACATG-3’. cDNAs encoding wild-type or S229D Oct4 with C-terminal twin-strep and FLAG-tags were then subcloned into the modified pFastBac-1 vector between the Nco I and Kpn I sites. .. The Ing4 cDNA was amplified using PCR from a plasmid template (Addgene #13289) using 5’-AGGCTCGAGATGGCTGCGGGGATG-3’ and 5’-AGAATGCATTTTCTTCTTCCGTTCTTGG-3’ primers and was cloned into the Xho I and Nsi I sites using the Oct4/pFastBac-1 vector by first excising the Oct4 cDNA using Xho I and Nsi I, preserving the N-terminal His-tag and C-terminal twin-strep tags. .. HBO1 and hEaf6 gene blocks containing C-terminal twin-strep-tag were synthesized from IDT and cloned into the modified single-base frameshifted pFastBac1 vector using the Xho I and Kpn I sites.

    Article Title: Inflamed endothelial cells express S1PR1 inhibitor CD69 to induce vascular leak.
    Article Snippet: .. Gene overexpression and knockout in HUVEC: For overexpression of human CD69 and CLEC2A (control), the cDNA sequence of each gene were PCR-amplified from a plasmid template (CD69, pSport1-hCD69 and CLEC2A, Addgene #22851) and subcloned in the pCDH-puro vector. ..

    Amplification:

    Article Title: Jade1 and the HBO1 histone acetyltransferase complex are spatial-selective cofactors of the pluripotency transcription factor Oct4
    Article Snippet: A single base frameshifted version of pFastBac-1 was also generated using the oligos 5′-GATCCATGTCGCATCACCATCACCATCACGAGGCTCGAGGCCATGGTG-3′ and 5′- AATTCACCATGGCCTCGAGCCTCGTGATGGTGATGGTGATGCGACATG-3′. cDNAs encoding WT or S229D Oct4 with C-terminal twin-strep and FLAG-tags were then subcloned into the modified pFastBac-1 vector between the Nco I and Kpn I sites. .. The Ing4 cDNA was amplified using PCR from a plasmid template (Addgene #13289) using 5′-AGGCTCGAGATGGCTGCGGGGATG-3′ and 5′-AGAATGCATTTTCTTCTTCCGTTCTTGG-3′ primers and was cloned into the Xho I and Nsi I sites using the Oct4/pFastBac-1 vector by first excising the Oct4 cDNA using Xho I and Nsi I, preserving the N-terminal His-tag and C-terminal twin-strep tags. ..

    Article Title: Jade1 and the HBO1 histone acetyltransferase complex are spatial-selective cofactors of the pluripotency transcription factor Oct4
    Article Snippet: A single base frameshifted version of pFastBac-1 was also generated using the oligos 5 ′ -GAT CCATGTCGCATCACCATCACCATCACGAGGCTCGAGG CCATGGTG-3 ′ and 5 ′ - AATTCACCATGGCCTCGAGCC TCGTGATGGTGATGGTGATGCGACATG-3 ′ . cDNAs encoding WT or S229D Oct4 with C-terminal twin-strep and FLAG-tags were then subcloned into the modified pFastBac-1 vector between the NcoI and KpnI sites. .. The Ing4 cDNA was amplified using PCR from a plasmid template (Addgene #13289) using 5 ′ -AGGCTCGAGATGGCTGCGGGGATG-3 ′ and 5 ′ -AGAATGCATTTTCTTCTTCCGTTCTTGG-3 ′ primers and was cloned into the XhoI and NsiI sites using the Oct4/pFastBac-1 vector by first excising the Oct4 cDNA using XhoI and NsiI, preserving the N-terminal His-tag and C-terminal twin-strep tags. ..

    Article Title: Protein translation rate determines neocortical neuron fate
    Article Snippet: Destination vectors were linearized with EcoRI-HF (New England BioLabs). .. Human IRE1α cDNA (NM_001433.3) was amplified from plasmid template [Addgene, #13009 ], using the following oligos: 5’- agattacgctatctgtacaggcATGCCGGCCCGGCGGCTG-3’ and 5’- ggccgctagcccgggtaccgCTTGGTTTGGGAAGCCTGGTCTCCCTGC-3’ and inserted into the modified pRaichu vector . .. Murine eEF2 cDNA (NM_007907.2) was amplified from cDNA library using the following oligos: 5’-gtctcatcattttggcaaagATGCATCATCATCATCATCATGTGAACTTCACAGTAGATC-3’ and 5’-cggccgcgatatcctcgaggCTACAGTTTGTCCAGGAAGTTG-3’ and inserted into pCAGIG vector for simultaneous expression of 6XHis-tagged eEF2 and EGFP.

    Article Title: Jade1 and the HBO1 complex are spatial-selective cofactors of Oct4
    Article Snippet: A single base frameshifted version of pFastBac-1 was also generated using the oligos 5’-GATCCATGTCGCATCACCATCACCATCACGAGGCTCGAGGCCATGGTG-3’ and 5’-AATTCACCATGGCCTCGAGCCTCGTGATGGTGATGGTGATGCGACATG-3’. cDNAs encoding wild-type or S229D Oct4 with C-terminal twin-strep and FLAG-tags were then subcloned into the modified pFastBac-1 vector between the Nco I and Kpn I sites. .. The Ing4 cDNA was amplified using PCR from a plasmid template (Addgene #13289) using 5’-AGGCTCGAGATGGCTGCGGGGATG-3’ and 5’-AGAATGCATTTTCTTCTTCCGTTCTTGG-3’ primers and was cloned into the Xho I and Nsi I sites using the Oct4/pFastBac-1 vector by first excising the Oct4 cDNA using Xho I and Nsi I, preserving the N-terminal His-tag and C-terminal twin-strep tags. .. HBO1 and hEaf6 gene blocks containing C-terminal twin-strep-tag were synthesized from IDT and cloned into the modified single-base frameshifted pFastBac1 vector using the Xho I and Kpn I sites.

    Clone Assay:

    Article Title: Jade1 and the HBO1 histone acetyltransferase complex are spatial-selective cofactors of the pluripotency transcription factor Oct4
    Article Snippet: A single base frameshifted version of pFastBac-1 was also generated using the oligos 5′-GATCCATGTCGCATCACCATCACCATCACGAGGCTCGAGGCCATGGTG-3′ and 5′- AATTCACCATGGCCTCGAGCCTCGTGATGGTGATGGTGATGCGACATG-3′. cDNAs encoding WT or S229D Oct4 with C-terminal twin-strep and FLAG-tags were then subcloned into the modified pFastBac-1 vector between the Nco I and Kpn I sites. .. The Ing4 cDNA was amplified using PCR from a plasmid template (Addgene #13289) using 5′-AGGCTCGAGATGGCTGCGGGGATG-3′ and 5′-AGAATGCATTTTCTTCTTCCGTTCTTGG-3′ primers and was cloned into the Xho I and Nsi I sites using the Oct4/pFastBac-1 vector by first excising the Oct4 cDNA using Xho I and Nsi I, preserving the N-terminal His-tag and C-terminal twin-strep tags. ..

    Article Title: Jade1 and the HBO1 histone acetyltransferase complex are spatial-selective cofactors of the pluripotency transcription factor Oct4
    Article Snippet: A single base frameshifted version of pFastBac-1 was also generated using the oligos 5 ′ -GAT CCATGTCGCATCACCATCACCATCACGAGGCTCGAGG CCATGGTG-3 ′ and 5 ′ - AATTCACCATGGCCTCGAGCC TCGTGATGGTGATGGTGATGCGACATG-3 ′ . cDNAs encoding WT or S229D Oct4 with C-terminal twin-strep and FLAG-tags were then subcloned into the modified pFastBac-1 vector between the NcoI and KpnI sites. .. The Ing4 cDNA was amplified using PCR from a plasmid template (Addgene #13289) using 5 ′ -AGGCTCGAGATGGCTGCGGGGATG-3 ′ and 5 ′ -AGAATGCATTTTCTTCTTCCGTTCTTGG-3 ′ primers and was cloned into the XhoI and NsiI sites using the Oct4/pFastBac-1 vector by first excising the Oct4 cDNA using XhoI and NsiI, preserving the N-terminal His-tag and C-terminal twin-strep tags. ..

    Article Title: Jade1 and the HBO1 complex are spatial-selective cofactors of Oct4
    Article Snippet: A single base frameshifted version of pFastBac-1 was also generated using the oligos 5’-GATCCATGTCGCATCACCATCACCATCACGAGGCTCGAGGCCATGGTG-3’ and 5’-AATTCACCATGGCCTCGAGCCTCGTGATGGTGATGGTGATGCGACATG-3’. cDNAs encoding wild-type or S229D Oct4 with C-terminal twin-strep and FLAG-tags were then subcloned into the modified pFastBac-1 vector between the Nco I and Kpn I sites. .. The Ing4 cDNA was amplified using PCR from a plasmid template (Addgene #13289) using 5’-AGGCTCGAGATGGCTGCGGGGATG-3’ and 5’-AGAATGCATTTTCTTCTTCCGTTCTTGG-3’ primers and was cloned into the Xho I and Nsi I sites using the Oct4/pFastBac-1 vector by first excising the Oct4 cDNA using Xho I and Nsi I, preserving the N-terminal His-tag and C-terminal twin-strep tags. .. HBO1 and hEaf6 gene blocks containing C-terminal twin-strep-tag were synthesized from IDT and cloned into the modified single-base frameshifted pFastBac1 vector using the Xho I and Kpn I sites.

    Preserving:

    Article Title: Jade1 and the HBO1 histone acetyltransferase complex are spatial-selective cofactors of the pluripotency transcription factor Oct4
    Article Snippet: A single base frameshifted version of pFastBac-1 was also generated using the oligos 5′-GATCCATGTCGCATCACCATCACCATCACGAGGCTCGAGGCCATGGTG-3′ and 5′- AATTCACCATGGCCTCGAGCCTCGTGATGGTGATGGTGATGCGACATG-3′. cDNAs encoding WT or S229D Oct4 with C-terminal twin-strep and FLAG-tags were then subcloned into the modified pFastBac-1 vector between the Nco I and Kpn I sites. .. The Ing4 cDNA was amplified using PCR from a plasmid template (Addgene #13289) using 5′-AGGCTCGAGATGGCTGCGGGGATG-3′ and 5′-AGAATGCATTTTCTTCTTCCGTTCTTGG-3′ primers and was cloned into the Xho I and Nsi I sites using the Oct4/pFastBac-1 vector by first excising the Oct4 cDNA using Xho I and Nsi I, preserving the N-terminal His-tag and C-terminal twin-strep tags. ..

    Article Title: Jade1 and the HBO1 histone acetyltransferase complex are spatial-selective cofactors of the pluripotency transcription factor Oct4
    Article Snippet: A single base frameshifted version of pFastBac-1 was also generated using the oligos 5 ′ -GAT CCATGTCGCATCACCATCACCATCACGAGGCTCGAGG CCATGGTG-3 ′ and 5 ′ - AATTCACCATGGCCTCGAGCC TCGTGATGGTGATGGTGATGCGACATG-3 ′ . cDNAs encoding WT or S229D Oct4 with C-terminal twin-strep and FLAG-tags were then subcloned into the modified pFastBac-1 vector between the NcoI and KpnI sites. .. The Ing4 cDNA was amplified using PCR from a plasmid template (Addgene #13289) using 5 ′ -AGGCTCGAGATGGCTGCGGGGATG-3 ′ and 5 ′ -AGAATGCATTTTCTTCTTCCGTTCTTGG-3 ′ primers and was cloned into the XhoI and NsiI sites using the Oct4/pFastBac-1 vector by first excising the Oct4 cDNA using XhoI and NsiI, preserving the N-terminal His-tag and C-terminal twin-strep tags. ..

    Article Title: Jade1 and the HBO1 complex are spatial-selective cofactors of Oct4
    Article Snippet: A single base frameshifted version of pFastBac-1 was also generated using the oligos 5’-GATCCATGTCGCATCACCATCACCATCACGAGGCTCGAGGCCATGGTG-3’ and 5’-AATTCACCATGGCCTCGAGCCTCGTGATGGTGATGGTGATGCGACATG-3’. cDNAs encoding wild-type or S229D Oct4 with C-terminal twin-strep and FLAG-tags were then subcloned into the modified pFastBac-1 vector between the Nco I and Kpn I sites. .. The Ing4 cDNA was amplified using PCR from a plasmid template (Addgene #13289) using 5’-AGGCTCGAGATGGCTGCGGGGATG-3’ and 5’-AGAATGCATTTTCTTCTTCCGTTCTTGG-3’ primers and was cloned into the Xho I and Nsi I sites using the Oct4/pFastBac-1 vector by first excising the Oct4 cDNA using Xho I and Nsi I, preserving the N-terminal His-tag and C-terminal twin-strep tags. .. HBO1 and hEaf6 gene blocks containing C-terminal twin-strep-tag were synthesized from IDT and cloned into the modified single-base frameshifted pFastBac1 vector using the Xho I and Kpn I sites.

    Modification:

    Article Title: Protein translation rate determines neocortical neuron fate
    Article Snippet: Destination vectors were linearized with EcoRI-HF (New England BioLabs). .. Human IRE1α cDNA (NM_001433.3) was amplified from plasmid template [Addgene, #13009 ], using the following oligos: 5’- agattacgctatctgtacaggcATGCCGGCCCGGCGGCTG-3’ and 5’- ggccgctagcccgggtaccgCTTGGTTTGGGAAGCCTGGTCTCCCTGC-3’ and inserted into the modified pRaichu vector . .. Murine eEF2 cDNA (NM_007907.2) was amplified from cDNA library using the following oligos: 5’-gtctcatcattttggcaaagATGCATCATCATCATCATCATGTGAACTTCACAGTAGATC-3’ and 5’-cggccgcgatatcctcgaggCTACAGTTTGTCCAGGAAGTTG-3’ and inserted into pCAGIG vector for simultaneous expression of 6XHis-tagged eEF2 and EGFP.

    Over Expression:

    Article Title: Inflamed endothelial cells express S1PR1 inhibitor CD69 to induce vascular leak
    Article Snippet: .. For overexpression of human CD69 and CLEC2A (control), the cDNA sequence of each gene were PCR-amplified from a plasmid template (CD69, pSport1-hCD69, and CLEC2A, Addgene #22851) and subcloned in the pCDH-puro vector. ..

    Article Title: Inflamed endothelial cells express S1PR1 inhibitor CD69 to induce vascular leak.
    Article Snippet: .. Gene overexpression and knockout in HUVEC: For overexpression of human CD69 and CLEC2A (control), the cDNA sequence of each gene were PCR-amplified from a plasmid template (CD69, pSport1-hCD69 and CLEC2A, Addgene #22851) and subcloned in the pCDH-puro vector. ..

    Control:

    Article Title: Inflamed endothelial cells express S1PR1 inhibitor CD69 to induce vascular leak
    Article Snippet: .. For overexpression of human CD69 and CLEC2A (control), the cDNA sequence of each gene were PCR-amplified from a plasmid template (CD69, pSport1-hCD69, and CLEC2A, Addgene #22851) and subcloned in the pCDH-puro vector. ..

    Article Title: Inflamed endothelial cells express S1PR1 inhibitor CD69 to induce vascular leak.
    Article Snippet: .. Gene overexpression and knockout in HUVEC: For overexpression of human CD69 and CLEC2A (control), the cDNA sequence of each gene were PCR-amplified from a plasmid template (CD69, pSport1-hCD69 and CLEC2A, Addgene #22851) and subcloned in the pCDH-puro vector. ..

    Sequencing:

    Article Title: Inflamed endothelial cells express S1PR1 inhibitor CD69 to induce vascular leak
    Article Snippet: .. For overexpression of human CD69 and CLEC2A (control), the cDNA sequence of each gene were PCR-amplified from a plasmid template (CD69, pSport1-hCD69, and CLEC2A, Addgene #22851) and subcloned in the pCDH-puro vector. ..

    Article Title: Inflamed endothelial cells express S1PR1 inhibitor CD69 to induce vascular leak.
    Article Snippet: .. Gene overexpression and knockout in HUVEC: For overexpression of human CD69 and CLEC2A (control), the cDNA sequence of each gene were PCR-amplified from a plasmid template (CD69, pSport1-hCD69 and CLEC2A, Addgene #22851) and subcloned in the pCDH-puro vector. ..

    Knock-Out:

    Article Title: Inflamed endothelial cells express S1PR1 inhibitor CD69 to induce vascular leak.
    Article Snippet: .. Gene overexpression and knockout in HUVEC: For overexpression of human CD69 and CLEC2A (control), the cDNA sequence of each gene were PCR-amplified from a plasmid template (CD69, pSport1-hCD69 and CLEC2A, Addgene #22851) and subcloned in the pCDH-puro vector. ..



    Similar Products

    plasmid 376 template  (New England Biolabs)
    99
    New England Biolabs plasmid 376 template
    Plasmid 376 Template, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+template/T7+RNA+Polymerase/pm41889175-166-18-34
    Average 99 stars, based on 1 article reviews
    plasmid 376 template - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    template plasmid pb210pa 1  (System Biosciences Inc)
    86
    System Biosciences Inc template plasmid pb210pa 1
    Template Plasmid Pb210pa 1, supplied by System Biosciences Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+template/piggybac+super+transposase/pm42141022-176-21-24
    Average 86 stars, based on 1 article reviews
    template plasmid pb210pa 1 - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    template dna  (Sino Biological)
    94
    Sino Biological template dna
    Template Dna, supplied by Sino Biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+template/Human+NQO1+Gene+ORF+cDNA+clone+expression+plasmid%2C+C-Flag+tag/pm41913215-65-11-13
    Average 94 stars, based on 1 article reviews
    template dna - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    homology template  (Santa Cruz Biotechnology)
    94
    Santa Cruz Biotechnology homology template
    Homology Template, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+template/Rev-erb%CE%B2+CRISPR%2FCas9+KO+Plasmid/pm41897352-38-26-28
    Average 94 stars, based on 1 article reviews
    homology template - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    situ probe templates for slit1a  (Addgene inc)
    88
    Addgene inc situ probe templates for slit1a
    The trajectories of OSNs in <t>slit1a,</t> slit1b, slit2 , or slit3 knockdown embryos were compared to uninjected sibling controls at 72hpf. (A, B) Neither slit2 or slit3 knockdown induced errors in DZ-projecting BacOR130-1 or CZ-projecting BacOR111-7 OSNs. (C) Neither slit1a or slit1b knockdown induced errors in CZ-projecting BacOR111-7 OSNs. (D, E, F) Similar results were obtained when both slit2 and slit3 were knocked down together or when both slit1a and slit1b were knocked down together. Statistical comparisons were performed using a two-tailed Fisher’s Exact test.
    Situ Probe Templates For Slit1a, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+template/Zf+Slit1a+(Plasmid+%2361279)/bio_rxiv__64898__2026__03__19__709608-80-1-6
    Average 88 stars, based on 1 article reviews
    situ probe templates for slit1a - by Bioz Stars, 2026-09
    88/100 stars
    		  Buy from Supplier
    template plasmid pkd4ble  (Biometra)
    86
    Biometra template plasmid pkd4ble
    The trajectories of OSNs in <t>slit1a,</t> slit1b, slit2 , or slit3 knockdown embryos were compared to uninjected sibling controls at 72hpf. (A, B) Neither slit2 or slit3 knockdown induced errors in DZ-projecting BacOR130-1 or CZ-projecting BacOR111-7 OSNs. (C) Neither slit1a or slit1b knockdown induced errors in CZ-projecting BacOR111-7 OSNs. (D, E, F) Similar results were obtained when both slit2 and slit3 were knocked down together or when both slit1a and slit1b were knocked down together. Statistical comparisons were performed using a two-tailed Fisher’s Exact test.
    Template Plasmid Pkd4ble, supplied by Biometra, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+template/pkd4ble+plasmid+template/bio_rxiv__64898__2026__03__19__712897-193-13-7
    Average 86 stars, based on 1 article reviews
    template plasmid pkd4ble - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    template sp6 ebna1  (Addgene inc)
    94
    Addgene inc template sp6 ebna1
    The trajectories of OSNs in <t>slit1a,</t> slit1b, slit2 , or slit3 knockdown embryos were compared to uninjected sibling controls at 72hpf. (A, B) Neither slit2 or slit3 knockdown induced errors in DZ-projecting BacOR130-1 or CZ-projecting BacOR111-7 OSNs. (C) Neither slit1a or slit1b knockdown induced errors in CZ-projecting BacOR111-7 OSNs. (D, E, F) Similar results were obtained when both slit2 and slit3 were knocked down together or when both slit1a and slit1b were knocked down together. Statistical comparisons were performed using a two-tailed Fisher’s Exact test.
    Template Sp6 Ebna1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+template/pSP6-EBNA(2A%2BDBD)+(Plasmid+%2398749)/bio_rxiv__64898__2026__03__17__712482-84-63-65
    Average 94 stars, based on 1 article reviews
    template sp6 ebna1 - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    circular plasmid donor template  (Twist Bioscience)
    86
    Twist Bioscience circular plasmid donor template
    The trajectories of OSNs in <t>slit1a,</t> slit1b, slit2 , or slit3 knockdown embryos were compared to uninjected sibling controls at 72hpf. (A, B) Neither slit2 or slit3 knockdown induced errors in DZ-projecting BacOR130-1 or CZ-projecting BacOR111-7 OSNs. (C) Neither slit1a or slit1b knockdown induced errors in CZ-projecting BacOR111-7 OSNs. (D, E, F) Similar results were obtained when both slit2 and slit3 were knocked down together or when both slit1a and slit1b were knocked down together. Statistical comparisons were performed using a two-tailed Fisher’s Exact test.
    Circular Plasmid Donor Template, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+template/circular+donor+plasmid+template/bio_rxiv__64898__2026__03__11__711093-137-25-29
    Average 86 stars, based on 1 article reviews
    circular plasmid donor template - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    plasmid templates  (Sangon Biotech)
    86
    Sangon Biotech plasmid templates
    The trajectories of OSNs in <t>slit1a,</t> slit1b, slit2 , or slit3 knockdown embryos were compared to uninjected sibling controls at 72hpf. (A, B) Neither slit2 or slit3 knockdown induced errors in DZ-projecting BacOR130-1 or CZ-projecting BacOR111-7 OSNs. (C) Neither slit1a or slit1b knockdown induced errors in CZ-projecting BacOR111-7 OSNs. (D, E, F) Similar results were obtained when both slit2 and slit3 were knocked down together or when both slit1a and slit1b were knocked down together. Statistical comparisons were performed using a two-tailed Fisher’s Exact test.
    Plasmid Templates, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+template/2591+circrna+fluc+nt+plasmid+templates/pm41818616-60-49-54
    Average 86 stars, based on 1 article reviews
    plasmid templates - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier

    Image Search Results


    The trajectories of OSNs in slit1a, slit1b, slit2 , or slit3 knockdown embryos were compared to uninjected sibling controls at 72hpf. (A, B) Neither slit2 or slit3 knockdown induced errors in DZ-projecting BacOR130-1 or CZ-projecting BacOR111-7 OSNs. (C) Neither slit1a or slit1b knockdown induced errors in CZ-projecting BacOR111-7 OSNs. (D, E, F) Similar results were obtained when both slit2 and slit3 were knocked down together or when both slit1a and slit1b were knocked down together. Statistical comparisons were performed using a two-tailed Fisher’s Exact test.

    Journal: bioRxiv

    Article Title: The contribution of Robos to olfactory sensory axon targeting in the olfactory bulb

    doi: 10.64898/2026.03.19.709608

    Figure Lengend Snippet: The trajectories of OSNs in slit1a, slit1b, slit2 , or slit3 knockdown embryos were compared to uninjected sibling controls at 72hpf. (A, B) Neither slit2 or slit3 knockdown induced errors in DZ-projecting BacOR130-1 or CZ-projecting BacOR111-7 OSNs. (C) Neither slit1a or slit1b knockdown induced errors in CZ-projecting BacOR111-7 OSNs. (D, E, F) Similar results were obtained when both slit2 and slit3 were knocked down together or when both slit1a and slit1b were knocked down together. Statistical comparisons were performed using a two-tailed Fisher’s Exact test.

    Article Snippet: In situ probe templates for slit1a (Addgene plasmid # 61279; http://n2t.net/addgene:61279 ; RRID:Addgene_61279) and slit1b (Addgene plasmid # 61280; http://n2t.net/addgene:61280 ; RRID:Addgene_61280) were a generous gift from Chi–Bin Chien & Lara Hutson ( ).

    Techniques: Knockdown, Two Tailed Test

    Fluorescent in situ hybridization was performed at 48 hpf in slit2 F0 knockdown embryos. Hybridization was performed in parallel at the same time as the preparations presented in . Representative 3-µm optical maximum-intensity projections from individual preparations are shown. Upregulation of slit1a and slit3 mRNA in slit2 knockdowns was observed in 3 independent experiments.

    Journal: bioRxiv

    Article Title: The contribution of Robos to olfactory sensory axon targeting in the olfactory bulb

    doi: 10.64898/2026.03.19.709608

    Figure Lengend Snippet: Fluorescent in situ hybridization was performed at 48 hpf in slit2 F0 knockdown embryos. Hybridization was performed in parallel at the same time as the preparations presented in . Representative 3-µm optical maximum-intensity projections from individual preparations are shown. Upregulation of slit1a and slit3 mRNA in slit2 knockdowns was observed in 3 independent experiments.

    Article Snippet: In situ probe templates for slit1a (Addgene plasmid # 61279; http://n2t.net/addgene:61279 ; RRID:Addgene_61279) and slit1b (Addgene plasmid # 61280; http://n2t.net/addgene:61280 ; RRID:Addgene_61280) were a generous gift from Chi–Bin Chien & Lara Hutson ( ).

    Techniques: In Situ Hybridization, Knockdown, Hybridization