Review




Structured Review

Promega pgl3‐basic luciferase expression vector
A , Alignment of the human, mouse, and rat Ht sequences is shown. Conserved nucleotides are marked with asterisk. The arrow indicates the TSS. B through E , <t>Luciferase</t> assay in SH‐SY5Y cells transfected for 48 hour with <t>pGL3‐Br</t> ( B and D ) or pGL3‐Ht ( C and E ) and cotransfected with siCTL, siDNMT1, siMeCP2, or siREST ( B , C ), or with EV, DNMT1, MeCP2, or REST ( D and E ). * P ≤0.05 vs siCTL or EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). CTL indicates control; DNMT1, DNA‐methyltransferase‐1; EV, empty vector; Ht , heart promoter, MeCP2, methyl‐CpG binding protein 2; NCX1, sodium/calcium exchanger 1; pGL3‐Br, Ncx1 brain promoter construct inserted in pGL3basic; pGL3‐Ht, Ncx1 heart promoter construct inserted in pGL3basic; REST, repressor element 1‐silencing transcription factor; si, small interfering; and TSS, transcription start site.
Pgl3‐Basic Luciferase Expression Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgl3+basic+luciferase+expression+vector/pgl3+basic/pmc11010005-43-21-25
Average 90 stars, based on 1 article reviews
pgl3‐basic luciferase expression vector - by Bioz Stars, 2026-10
90/100 stars

Images

1) Product Images from "Stroke Causes DNA Methylation at Ncx1 Heart Promoter in the Brain Via DNMT1/MeCP2/REST Epigenetic Complex"

Article Title: Stroke Causes DNA Methylation at Ncx1 Heart Promoter in the Brain Via DNMT1/MeCP2/REST Epigenetic Complex

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

doi: 10.1161/JAHA.123.030460

A , Alignment of the human, mouse, and rat Ht sequences is shown. Conserved nucleotides are marked with asterisk. The arrow indicates the TSS. B through E , Luciferase assay in SH‐SY5Y cells transfected for 48 hour with pGL3‐Br ( B and D ) or pGL3‐Ht ( C and E ) and cotransfected with siCTL, siDNMT1, siMeCP2, or siREST ( B , C ), or with EV, DNMT1, MeCP2, or REST ( D and E ). * P ≤0.05 vs siCTL or EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). CTL indicates control; DNMT1, DNA‐methyltransferase‐1; EV, empty vector; Ht , heart promoter, MeCP2, methyl‐CpG binding protein 2; NCX1, sodium/calcium exchanger 1; pGL3‐Br, Ncx1 brain promoter construct inserted in pGL3basic; pGL3‐Ht, Ncx1 heart promoter construct inserted in pGL3basic; REST, repressor element 1‐silencing transcription factor; si, small interfering; and TSS, transcription start site.
Figure Legend Snippet: A , Alignment of the human, mouse, and rat Ht sequences is shown. Conserved nucleotides are marked with asterisk. The arrow indicates the TSS. B through E , Luciferase assay in SH‐SY5Y cells transfected for 48 hour with pGL3‐Br ( B and D ) or pGL3‐Ht ( C and E ) and cotransfected with siCTL, siDNMT1, siMeCP2, or siREST ( B , C ), or with EV, DNMT1, MeCP2, or REST ( D and E ). * P ≤0.05 vs siCTL or EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). CTL indicates control; DNMT1, DNA‐methyltransferase‐1; EV, empty vector; Ht , heart promoter, MeCP2, methyl‐CpG binding protein 2; NCX1, sodium/calcium exchanger 1; pGL3‐Br, Ncx1 brain promoter construct inserted in pGL3basic; pGL3‐Ht, Ncx1 heart promoter construct inserted in pGL3basic; REST, repressor element 1‐silencing transcription factor; si, small interfering; and TSS, transcription start site.

Techniques Used: Luciferase, Transfection, Plasmid Preparation, Binding Assay, Construct

A , Top: JASPAR matrix representation (MA0138.1) of the consensus REST binding site on Ht gene ( Ht ‐RE1). Ht ‐RE1 sequence is represented in International Union of Pure and Applied Chemistry code. Bottom: Partial human genomic Ht sequence containing the predicted REST binding site (underlined). B , Luciferase assay in SH‐SY5Y cells under the following experimental conditions: (1) pGL3basic, (2) pGL3‐Ht+EV, (3) pGL3‐Ht+REST, (4) pGL3‐Ht‐RE1mut+EV, (5) pGL3‐Ht‐RE1mut+REST. * P ≤0.05 vs pGL3Ht+EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). C , ChIP with anti‐REST antibody followed by qPCR of the promoter region containing the RE1 site on the Ht gene in SH‐SY5Y cells transiently transfected with (1) pGL3‐Ht+EV, (2) pGL3‐Ht+REST, (3) pGL3‐Ht+RE1mut+REST. * P ≤0.05 vs pGL3‐Ht+EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). ChIP indicates chromatin immunoprecipitation; CTL, control; DNMT1, DNA‐methyltransferase‐1; EV, empty vector; Ht , heart promoter, MeCP2, methyl‐CpG binding protein 2; NCX1, sodium/calcium exchanger 1; pGL3‐Br, Ncx1 brain promoter construct inserted in pGL3basic; pGL3‐Ht, Ncx1 heart promoter construct inserted in pGL3basic; qRT‐PCR, quantitative real time polymerase chain reaction; RE1, repressor element 1; and REST, repressor element 1‐silencing transcription factor.
Figure Legend Snippet: A , Top: JASPAR matrix representation (MA0138.1) of the consensus REST binding site on Ht gene ( Ht ‐RE1). Ht ‐RE1 sequence is represented in International Union of Pure and Applied Chemistry code. Bottom: Partial human genomic Ht sequence containing the predicted REST binding site (underlined). B , Luciferase assay in SH‐SY5Y cells under the following experimental conditions: (1) pGL3basic, (2) pGL3‐Ht+EV, (3) pGL3‐Ht+REST, (4) pGL3‐Ht‐RE1mut+EV, (5) pGL3‐Ht‐RE1mut+REST. * P ≤0.05 vs pGL3Ht+EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). C , ChIP with anti‐REST antibody followed by qPCR of the promoter region containing the RE1 site on the Ht gene in SH‐SY5Y cells transiently transfected with (1) pGL3‐Ht+EV, (2) pGL3‐Ht+REST, (3) pGL3‐Ht+RE1mut+REST. * P ≤0.05 vs pGL3‐Ht+EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). ChIP indicates chromatin immunoprecipitation; CTL, control; DNMT1, DNA‐methyltransferase‐1; EV, empty vector; Ht , heart promoter, MeCP2, methyl‐CpG binding protein 2; NCX1, sodium/calcium exchanger 1; pGL3‐Br, Ncx1 brain promoter construct inserted in pGL3basic; pGL3‐Ht, Ncx1 heart promoter construct inserted in pGL3basic; qRT‐PCR, quantitative real time polymerase chain reaction; RE1, repressor element 1; and REST, repressor element 1‐silencing transcription factor.

Techniques Used: Binding Assay, Sequencing, Luciferase, Transfection, Chromatin Immunoprecipitation, Plasmid Preparation, Construct, Quantitative RT-PCR, Real-time Polymerase Chain Reaction

Related Articles

Luciferase:

Article Title: A Functional Variant of the Dimethylarginine Dimethylaminohydrolase-2 Gene Is Associated with Insulin Sensitivity
Article Snippet: A 1755 bp fragment of the human DDAH2 gene spanning the promoter region and the first exon, was obtained by polymerase chain reaction (PCR) from a human genomic DNA sample and the variant carrying the rs9267551 C minor allele was generated using the QuickChange Site-Directed Mutagenesis kit (Stratagene, Las Vegas, NV). .. Both fragments were inserted in the pGL3 basic luciferase expression vector (Promega, Madison, WI) and constructs sequence was confirmed by direct sequencing. .. HUVECs were seeded on 12-wells plates cotransfected with 0.8 μg of either pGL3 rs9267551G, pGL3 rs9267551C or an empty pGL3 vector, and 70 ng phRL-Renilla vector, as an internal control of transfection efficiency, per well, using lipofectamine transfection reagents (Invitrogen Co., Carlsbad, CA), according to the manufacturer protocol.

Article Title: Tau accumulation activates STAT1 triggering memory deficits via suppressing NMDA receptor expression
Article Snippet: .. To generate luciferase reporter plasmids of GluN1, GluN2A or GluN2B promoter, PCR fragments ( ) from the mouse genomic DNA were inserted into the BglII and NcoI sites of the pGL3 basic luciferase expression vector (Promega, Madison, WI). .. Mutation of the pGL3-GluN1/GluN2A/GluN2B luciferase plasmid was introduced using the GeneTailor system (Invitrogen).

Article Title: Estradiol Ameliorates Acute Kidney Ischemia-Reperfusion Injury by Inhibiting the TGF-βRI-SMAD Pathway
Article Snippet: .. To generate luciferase reporter plasmids of TGF-βRIpromoter, DNA fragments (predicted ERE sequence: TCAAATTTAGTCTCTGTAGCCTCGGTGC; Mut ERE sequence: TCTTAACTCATGACAGTACGTATCTCGGTGC) were synthesized and inserted into the pGL3 basic luciferase expression vector (Promega, Madison, WI, USA). ..

Article Title: STAT3 ameliorates cognitive deficits by positively regulating the expression of NMDARs in a mouse model of FTDP-17
Article Snippet: .. To generate luciferase reporter plasmids of GluN1, GluN2A or GluN2B promoter, after copied from the mouse genomic DNA, PCR fragments were subcloned into pGL3 basic luciferase expression vector (Promega, Madison, WI) between the BglII and NcoI sites. .. The GeneTailor system (Invitrogen) was used to introduce mutation of the pGL3-GluN1/GluN2A/GluN2B luciferase plasmid.

Article Title: Poly(ADP-ribose) Polymerase 1 Is Indispensable for Transforming Growth Factor-β Induced Smad3 Activation in Vascular Smooth Muscle Cell
Article Snippet: Specific binding was detected with ECL detection reagents (Pierce) and band intensities were quantified as described above. .. A 0.6-kb promoter fragment (spanning from +866 bp to +1523 bp) from the rat TIMP1 gene was cloned by PCR from rat genomic DNA and inserted into the NheI/XhoI cut pGL3 basic luciferase expression vector (Promega) according to the procedure of El-Sayed Akool et al . ..

Article Title: Indoxyl Sulfate Down-Regulates SLCO4C1 Transporter through Up-Regulation of GATA3
Article Snippet: Human quantitative real-time PCR of GATA2 (Hs00231119_m1), GATA3 (Hs00231122_m1), SLCO4C1 (Hs00698884_m1) and GAPDH (Hs99999905_m1) was performed using the TaqMan Gene Expression Assay (Applied Biosystems, Foster City, CA) in accordance with manufacturer's instruction using StepOnePlus real-time PCR system (Applied Biosystems). .. The human 5′ SLCO4C1 promoter region (−129 bp, −504 bp and −3886 bp) were amplified by PCR and inserted into the pGL3 basic luciferase expression vector (Promega, Madison, WI). .. Two micrograms of plasmid and 0.1 μg of Renilla Luciferase Reporter Vector pRL-TK (Promega) were co-transfected into ACHN cells.

Article Title: Complement component 3 (C3) is regulated by TWIST1 and mediates epithelial-mesenchymal transition (EMT)
Article Snippet: .. Generating C3 promoter-luciferase reporter gene construct One thousand two hundred and fifty six nucleotides from the C3 promoter (−1005 to +251) was amplified from human blood genomic DNA (Clontech), using Forward primer containing KpnI restriction enzyme cleavage site (5′- GGG GTA CCG AAT ATG CTG TCA ACA GGG ATG -3′) and reverse primer containing BglII restriction enzyme cleavage site (5′- GGA AGA TCT AAC CAC AAA CAC CCA AAC TCA C -3′), and cloned into the pGL3 basic luciferase expression vector (Promega). .. The QuickChange® IIXL Site-Directed mutagenesis Kit (Stratagene) was used to generate mutant C3 using the C3 luciferase construct as a template and the following primers: forward primer (5′- GCC AGA TAA AAA GCC AGC TC T TTT AGG CGC TGC TCA CTC CTC CC-3’) and reverse primer (5′- GGG AGG AGT GAG CAG CGC CT A AAA GAG CTG GCT TTT TAT CTG GC -3′).

Article Title: STAT3 ameliorates cognitive deficits by positively regulating the expression of NMDARs in a mouse model of FTDP-17
Article Snippet: .. To generate luciferase reporter plasmids of GluN1, GluN2A or GluN2B promoter, after copied from the mouse genomic DNA, PCR fragments were subcloned into pGL3 basic luciferase expression vector (Promega, Madison, WI) between the BglII and NcoI sites. .. The GeneTailor system (Invitrogen) was used to introduce mutation of the pGL3GluN1/GluN2A/GluN2B luciferase plasmid.

Expressing:

Article Title: A Functional Variant of the Dimethylarginine Dimethylaminohydrolase-2 Gene Is Associated with Insulin Sensitivity
Article Snippet: A 1755 bp fragment of the human DDAH2 gene spanning the promoter region and the first exon, was obtained by polymerase chain reaction (PCR) from a human genomic DNA sample and the variant carrying the rs9267551 C minor allele was generated using the QuickChange Site-Directed Mutagenesis kit (Stratagene, Las Vegas, NV). .. Both fragments were inserted in the pGL3 basic luciferase expression vector (Promega, Madison, WI) and constructs sequence was confirmed by direct sequencing. .. HUVECs were seeded on 12-wells plates cotransfected with 0.8 μg of either pGL3 rs9267551G, pGL3 rs9267551C or an empty pGL3 vector, and 70 ng phRL-Renilla vector, as an internal control of transfection efficiency, per well, using lipofectamine transfection reagents (Invitrogen Co., Carlsbad, CA), according to the manufacturer protocol.

Article Title: Tau accumulation activates STAT1 triggering memory deficits via suppressing NMDA receptor expression
Article Snippet: .. To generate luciferase reporter plasmids of GluN1, GluN2A or GluN2B promoter, PCR fragments ( ) from the mouse genomic DNA were inserted into the BglII and NcoI sites of the pGL3 basic luciferase expression vector (Promega, Madison, WI). .. Mutation of the pGL3-GluN1/GluN2A/GluN2B luciferase plasmid was introduced using the GeneTailor system (Invitrogen).

Article Title: Estradiol Ameliorates Acute Kidney Ischemia-Reperfusion Injury by Inhibiting the TGF-βRI-SMAD Pathway
Article Snippet: .. To generate luciferase reporter plasmids of TGF-βRIpromoter, DNA fragments (predicted ERE sequence: TCAAATTTAGTCTCTGTAGCCTCGGTGC; Mut ERE sequence: TCTTAACTCATGACAGTACGTATCTCGGTGC) were synthesized and inserted into the pGL3 basic luciferase expression vector (Promega, Madison, WI, USA). ..

Article Title: STAT3 ameliorates cognitive deficits by positively regulating the expression of NMDARs in a mouse model of FTDP-17
Article Snippet: .. To generate luciferase reporter plasmids of GluN1, GluN2A or GluN2B promoter, after copied from the mouse genomic DNA, PCR fragments were subcloned into pGL3 basic luciferase expression vector (Promega, Madison, WI) between the BglII and NcoI sites. .. The GeneTailor system (Invitrogen) was used to introduce mutation of the pGL3-GluN1/GluN2A/GluN2B luciferase plasmid.

Article Title: Poly(ADP-ribose) Polymerase 1 Is Indispensable for Transforming Growth Factor-β Induced Smad3 Activation in Vascular Smooth Muscle Cell
Article Snippet: Specific binding was detected with ECL detection reagents (Pierce) and band intensities were quantified as described above. .. A 0.6-kb promoter fragment (spanning from +866 bp to +1523 bp) from the rat TIMP1 gene was cloned by PCR from rat genomic DNA and inserted into the NheI/XhoI cut pGL3 basic luciferase expression vector (Promega) according to the procedure of El-Sayed Akool et al . ..

Article Title: Indoxyl Sulfate Down-Regulates SLCO4C1 Transporter through Up-Regulation of GATA3
Article Snippet: Human quantitative real-time PCR of GATA2 (Hs00231119_m1), GATA3 (Hs00231122_m1), SLCO4C1 (Hs00698884_m1) and GAPDH (Hs99999905_m1) was performed using the TaqMan Gene Expression Assay (Applied Biosystems, Foster City, CA) in accordance with manufacturer's instruction using StepOnePlus real-time PCR system (Applied Biosystems). .. The human 5′ SLCO4C1 promoter region (−129 bp, −504 bp and −3886 bp) were amplified by PCR and inserted into the pGL3 basic luciferase expression vector (Promega, Madison, WI). .. Two micrograms of plasmid and 0.1 μg of Renilla Luciferase Reporter Vector pRL-TK (Promega) were co-transfected into ACHN cells.

Article Title: Complement component 3 (C3) is regulated by TWIST1 and mediates epithelial-mesenchymal transition (EMT)
Article Snippet: .. Generating C3 promoter-luciferase reporter gene construct One thousand two hundred and fifty six nucleotides from the C3 promoter (−1005 to +251) was amplified from human blood genomic DNA (Clontech), using Forward primer containing KpnI restriction enzyme cleavage site (5′- GGG GTA CCG AAT ATG CTG TCA ACA GGG ATG -3′) and reverse primer containing BglII restriction enzyme cleavage site (5′- GGA AGA TCT AAC CAC AAA CAC CCA AAC TCA C -3′), and cloned into the pGL3 basic luciferase expression vector (Promega). .. The QuickChange® IIXL Site-Directed mutagenesis Kit (Stratagene) was used to generate mutant C3 using the C3 luciferase construct as a template and the following primers: forward primer (5′- GCC AGA TAA AAA GCC AGC TC T TTT AGG CGC TGC TCA CTC CTC CC-3’) and reverse primer (5′- GGG AGG AGT GAG CAG CGC CT A AAA GAG CTG GCT TTT TAT CTG GC -3′).

Article Title: STAT3 ameliorates cognitive deficits by positively regulating the expression of NMDARs in a mouse model of FTDP-17
Article Snippet: .. To generate luciferase reporter plasmids of GluN1, GluN2A or GluN2B promoter, after copied from the mouse genomic DNA, PCR fragments were subcloned into pGL3 basic luciferase expression vector (Promega, Madison, WI) between the BglII and NcoI sites. .. The GeneTailor system (Invitrogen) was used to introduce mutation of the pGL3GluN1/GluN2A/GluN2B luciferase plasmid.

Plasmid Preparation:

Article Title: A Functional Variant of the Dimethylarginine Dimethylaminohydrolase-2 Gene Is Associated with Insulin Sensitivity
Article Snippet: A 1755 bp fragment of the human DDAH2 gene spanning the promoter region and the first exon, was obtained by polymerase chain reaction (PCR) from a human genomic DNA sample and the variant carrying the rs9267551 C minor allele was generated using the QuickChange Site-Directed Mutagenesis kit (Stratagene, Las Vegas, NV). .. Both fragments were inserted in the pGL3 basic luciferase expression vector (Promega, Madison, WI) and constructs sequence was confirmed by direct sequencing. .. HUVECs were seeded on 12-wells plates cotransfected with 0.8 μg of either pGL3 rs9267551G, pGL3 rs9267551C or an empty pGL3 vector, and 70 ng phRL-Renilla vector, as an internal control of transfection efficiency, per well, using lipofectamine transfection reagents (Invitrogen Co., Carlsbad, CA), according to the manufacturer protocol.

Article Title: Tau accumulation activates STAT1 triggering memory deficits via suppressing NMDA receptor expression
Article Snippet: .. To generate luciferase reporter plasmids of GluN1, GluN2A or GluN2B promoter, PCR fragments ( ) from the mouse genomic DNA were inserted into the BglII and NcoI sites of the pGL3 basic luciferase expression vector (Promega, Madison, WI). .. Mutation of the pGL3-GluN1/GluN2A/GluN2B luciferase plasmid was introduced using the GeneTailor system (Invitrogen).

Article Title: Estradiol Ameliorates Acute Kidney Ischemia-Reperfusion Injury by Inhibiting the TGF-βRI-SMAD Pathway
Article Snippet: .. To generate luciferase reporter plasmids of TGF-βRIpromoter, DNA fragments (predicted ERE sequence: TCAAATTTAGTCTCTGTAGCCTCGGTGC; Mut ERE sequence: TCTTAACTCATGACAGTACGTATCTCGGTGC) were synthesized and inserted into the pGL3 basic luciferase expression vector (Promega, Madison, WI, USA). ..

Article Title: STAT3 ameliorates cognitive deficits by positively regulating the expression of NMDARs in a mouse model of FTDP-17
Article Snippet: .. To generate luciferase reporter plasmids of GluN1, GluN2A or GluN2B promoter, after copied from the mouse genomic DNA, PCR fragments were subcloned into pGL3 basic luciferase expression vector (Promega, Madison, WI) between the BglII and NcoI sites. .. The GeneTailor system (Invitrogen) was used to introduce mutation of the pGL3-GluN1/GluN2A/GluN2B luciferase plasmid.

Article Title: Poly(ADP-ribose) Polymerase 1 Is Indispensable for Transforming Growth Factor-β Induced Smad3 Activation in Vascular Smooth Muscle Cell
Article Snippet: Specific binding was detected with ECL detection reagents (Pierce) and band intensities were quantified as described above. .. A 0.6-kb promoter fragment (spanning from +866 bp to +1523 bp) from the rat TIMP1 gene was cloned by PCR from rat genomic DNA and inserted into the NheI/XhoI cut pGL3 basic luciferase expression vector (Promega) according to the procedure of El-Sayed Akool et al . ..

Article Title: Indoxyl Sulfate Down-Regulates SLCO4C1 Transporter through Up-Regulation of GATA3
Article Snippet: Human quantitative real-time PCR of GATA2 (Hs00231119_m1), GATA3 (Hs00231122_m1), SLCO4C1 (Hs00698884_m1) and GAPDH (Hs99999905_m1) was performed using the TaqMan Gene Expression Assay (Applied Biosystems, Foster City, CA) in accordance with manufacturer's instruction using StepOnePlus real-time PCR system (Applied Biosystems). .. The human 5′ SLCO4C1 promoter region (−129 bp, −504 bp and −3886 bp) were amplified by PCR and inserted into the pGL3 basic luciferase expression vector (Promega, Madison, WI). .. Two micrograms of plasmid and 0.1 μg of Renilla Luciferase Reporter Vector pRL-TK (Promega) were co-transfected into ACHN cells.

Article Title: Complement component 3 (C3) is regulated by TWIST1 and mediates epithelial-mesenchymal transition (EMT)
Article Snippet: .. Generating C3 promoter-luciferase reporter gene construct One thousand two hundred and fifty six nucleotides from the C3 promoter (−1005 to +251) was amplified from human blood genomic DNA (Clontech), using Forward primer containing KpnI restriction enzyme cleavage site (5′- GGG GTA CCG AAT ATG CTG TCA ACA GGG ATG -3′) and reverse primer containing BglII restriction enzyme cleavage site (5′- GGA AGA TCT AAC CAC AAA CAC CCA AAC TCA C -3′), and cloned into the pGL3 basic luciferase expression vector (Promega). .. The QuickChange® IIXL Site-Directed mutagenesis Kit (Stratagene) was used to generate mutant C3 using the C3 luciferase construct as a template and the following primers: forward primer (5′- GCC AGA TAA AAA GCC AGC TC T TTT AGG CGC TGC TCA CTC CTC CC-3’) and reverse primer (5′- GGG AGG AGT GAG CAG CGC CT A AAA GAG CTG GCT TTT TAT CTG GC -3′).

Article Title: STAT3 ameliorates cognitive deficits by positively regulating the expression of NMDARs in a mouse model of FTDP-17
Article Snippet: .. To generate luciferase reporter plasmids of GluN1, GluN2A or GluN2B promoter, after copied from the mouse genomic DNA, PCR fragments were subcloned into pGL3 basic luciferase expression vector (Promega, Madison, WI) between the BglII and NcoI sites. .. The GeneTailor system (Invitrogen) was used to introduce mutation of the pGL3GluN1/GluN2A/GluN2B luciferase plasmid.

Construct:

Article Title: A Functional Variant of the Dimethylarginine Dimethylaminohydrolase-2 Gene Is Associated with Insulin Sensitivity
Article Snippet: A 1755 bp fragment of the human DDAH2 gene spanning the promoter region and the first exon, was obtained by polymerase chain reaction (PCR) from a human genomic DNA sample and the variant carrying the rs9267551 C minor allele was generated using the QuickChange Site-Directed Mutagenesis kit (Stratagene, Las Vegas, NV). .. Both fragments were inserted in the pGL3 basic luciferase expression vector (Promega, Madison, WI) and constructs sequence was confirmed by direct sequencing. .. HUVECs were seeded on 12-wells plates cotransfected with 0.8 μg of either pGL3 rs9267551G, pGL3 rs9267551C or an empty pGL3 vector, and 70 ng phRL-Renilla vector, as an internal control of transfection efficiency, per well, using lipofectamine transfection reagents (Invitrogen Co., Carlsbad, CA), according to the manufacturer protocol.

Article Title: Complement component 3 (C3) is regulated by TWIST1 and mediates epithelial-mesenchymal transition (EMT)
Article Snippet: .. Generating C3 promoter-luciferase reporter gene construct One thousand two hundred and fifty six nucleotides from the C3 promoter (−1005 to +251) was amplified from human blood genomic DNA (Clontech), using Forward primer containing KpnI restriction enzyme cleavage site (5′- GGG GTA CCG AAT ATG CTG TCA ACA GGG ATG -3′) and reverse primer containing BglII restriction enzyme cleavage site (5′- GGA AGA TCT AAC CAC AAA CAC CCA AAC TCA C -3′), and cloned into the pGL3 basic luciferase expression vector (Promega). .. The QuickChange® IIXL Site-Directed mutagenesis Kit (Stratagene) was used to generate mutant C3 using the C3 luciferase construct as a template and the following primers: forward primer (5′- GCC AGA TAA AAA GCC AGC TC T TTT AGG CGC TGC TCA CTC CTC CC-3’) and reverse primer (5′- GGG AGG AGT GAG CAG CGC CT A AAA GAG CTG GCT TTT TAT CTG GC -3′).

Sequencing:

Article Title: A Functional Variant of the Dimethylarginine Dimethylaminohydrolase-2 Gene Is Associated with Insulin Sensitivity
Article Snippet: A 1755 bp fragment of the human DDAH2 gene spanning the promoter region and the first exon, was obtained by polymerase chain reaction (PCR) from a human genomic DNA sample and the variant carrying the rs9267551 C minor allele was generated using the QuickChange Site-Directed Mutagenesis kit (Stratagene, Las Vegas, NV). .. Both fragments were inserted in the pGL3 basic luciferase expression vector (Promega, Madison, WI) and constructs sequence was confirmed by direct sequencing. .. HUVECs were seeded on 12-wells plates cotransfected with 0.8 μg of either pGL3 rs9267551G, pGL3 rs9267551C or an empty pGL3 vector, and 70 ng phRL-Renilla vector, as an internal control of transfection efficiency, per well, using lipofectamine transfection reagents (Invitrogen Co., Carlsbad, CA), according to the manufacturer protocol.

Article Title: Estradiol Ameliorates Acute Kidney Ischemia-Reperfusion Injury by Inhibiting the TGF-βRI-SMAD Pathway
Article Snippet: .. To generate luciferase reporter plasmids of TGF-βRIpromoter, DNA fragments (predicted ERE sequence: TCAAATTTAGTCTCTGTAGCCTCGGTGC; Mut ERE sequence: TCTTAACTCATGACAGTACGTATCTCGGTGC) were synthesized and inserted into the pGL3 basic luciferase expression vector (Promega, Madison, WI, USA). ..

Polymerase Chain Reaction:

Article Title: Tau accumulation activates STAT1 triggering memory deficits via suppressing NMDA receptor expression
Article Snippet: .. To generate luciferase reporter plasmids of GluN1, GluN2A or GluN2B promoter, PCR fragments ( ) from the mouse genomic DNA were inserted into the BglII and NcoI sites of the pGL3 basic luciferase expression vector (Promega, Madison, WI). .. Mutation of the pGL3-GluN1/GluN2A/GluN2B luciferase plasmid was introduced using the GeneTailor system (Invitrogen).

Article Title: STAT3 ameliorates cognitive deficits by positively regulating the expression of NMDARs in a mouse model of FTDP-17
Article Snippet: .. To generate luciferase reporter plasmids of GluN1, GluN2A or GluN2B promoter, after copied from the mouse genomic DNA, PCR fragments were subcloned into pGL3 basic luciferase expression vector (Promega, Madison, WI) between the BglII and NcoI sites. .. The GeneTailor system (Invitrogen) was used to introduce mutation of the pGL3-GluN1/GluN2A/GluN2B luciferase plasmid.

Article Title: Poly(ADP-ribose) Polymerase 1 Is Indispensable for Transforming Growth Factor-β Induced Smad3 Activation in Vascular Smooth Muscle Cell
Article Snippet: Specific binding was detected with ECL detection reagents (Pierce) and band intensities were quantified as described above. .. A 0.6-kb promoter fragment (spanning from +866 bp to +1523 bp) from the rat TIMP1 gene was cloned by PCR from rat genomic DNA and inserted into the NheI/XhoI cut pGL3 basic luciferase expression vector (Promega) according to the procedure of El-Sayed Akool et al . ..

Article Title: Indoxyl Sulfate Down-Regulates SLCO4C1 Transporter through Up-Regulation of GATA3
Article Snippet: Human quantitative real-time PCR of GATA2 (Hs00231119_m1), GATA3 (Hs00231122_m1), SLCO4C1 (Hs00698884_m1) and GAPDH (Hs99999905_m1) was performed using the TaqMan Gene Expression Assay (Applied Biosystems, Foster City, CA) in accordance with manufacturer's instruction using StepOnePlus real-time PCR system (Applied Biosystems). .. The human 5′ SLCO4C1 promoter region (−129 bp, −504 bp and −3886 bp) were amplified by PCR and inserted into the pGL3 basic luciferase expression vector (Promega, Madison, WI). .. Two micrograms of plasmid and 0.1 μg of Renilla Luciferase Reporter Vector pRL-TK (Promega) were co-transfected into ACHN cells.

Article Title: STAT3 ameliorates cognitive deficits by positively regulating the expression of NMDARs in a mouse model of FTDP-17
Article Snippet: .. To generate luciferase reporter plasmids of GluN1, GluN2A or GluN2B promoter, after copied from the mouse genomic DNA, PCR fragments were subcloned into pGL3 basic luciferase expression vector (Promega, Madison, WI) between the BglII and NcoI sites. .. The GeneTailor system (Invitrogen) was used to introduce mutation of the pGL3GluN1/GluN2A/GluN2B luciferase plasmid.

Synthesized:

Article Title: Estradiol Ameliorates Acute Kidney Ischemia-Reperfusion Injury by Inhibiting the TGF-βRI-SMAD Pathway
Article Snippet: .. To generate luciferase reporter plasmids of TGF-βRIpromoter, DNA fragments (predicted ERE sequence: TCAAATTTAGTCTCTGTAGCCTCGGTGC; Mut ERE sequence: TCTTAACTCATGACAGTACGTATCTCGGTGC) were synthesized and inserted into the pGL3 basic luciferase expression vector (Promega, Madison, WI, USA). ..

Clone Assay:

Article Title: Poly(ADP-ribose) Polymerase 1 Is Indispensable for Transforming Growth Factor-β Induced Smad3 Activation in Vascular Smooth Muscle Cell
Article Snippet: Specific binding was detected with ECL detection reagents (Pierce) and band intensities were quantified as described above. .. A 0.6-kb promoter fragment (spanning from +866 bp to +1523 bp) from the rat TIMP1 gene was cloned by PCR from rat genomic DNA and inserted into the NheI/XhoI cut pGL3 basic luciferase expression vector (Promega) according to the procedure of El-Sayed Akool et al . ..

Article Title: Complement component 3 (C3) is regulated by TWIST1 and mediates epithelial-mesenchymal transition (EMT)
Article Snippet: .. Generating C3 promoter-luciferase reporter gene construct One thousand two hundred and fifty six nucleotides from the C3 promoter (−1005 to +251) was amplified from human blood genomic DNA (Clontech), using Forward primer containing KpnI restriction enzyme cleavage site (5′- GGG GTA CCG AAT ATG CTG TCA ACA GGG ATG -3′) and reverse primer containing BglII restriction enzyme cleavage site (5′- GGA AGA TCT AAC CAC AAA CAC CCA AAC TCA C -3′), and cloned into the pGL3 basic luciferase expression vector (Promega). .. The QuickChange® IIXL Site-Directed mutagenesis Kit (Stratagene) was used to generate mutant C3 using the C3 luciferase construct as a template and the following primers: forward primer (5′- GCC AGA TAA AAA GCC AGC TC T TTT AGG CGC TGC TCA CTC CTC CC-3’) and reverse primer (5′- GGG AGG AGT GAG CAG CGC CT A AAA GAG CTG GCT TTT TAT CTG GC -3′).

Amplification:

Article Title: Indoxyl Sulfate Down-Regulates SLCO4C1 Transporter through Up-Regulation of GATA3
Article Snippet: Human quantitative real-time PCR of GATA2 (Hs00231119_m1), GATA3 (Hs00231122_m1), SLCO4C1 (Hs00698884_m1) and GAPDH (Hs99999905_m1) was performed using the TaqMan Gene Expression Assay (Applied Biosystems, Foster City, CA) in accordance with manufacturer's instruction using StepOnePlus real-time PCR system (Applied Biosystems). .. The human 5′ SLCO4C1 promoter region (−129 bp, −504 bp and −3886 bp) were amplified by PCR and inserted into the pGL3 basic luciferase expression vector (Promega, Madison, WI). .. Two micrograms of plasmid and 0.1 μg of Renilla Luciferase Reporter Vector pRL-TK (Promega) were co-transfected into ACHN cells.

Article Title: Complement component 3 (C3) is regulated by TWIST1 and mediates epithelial-mesenchymal transition (EMT)
Article Snippet: .. Generating C3 promoter-luciferase reporter gene construct One thousand two hundred and fifty six nucleotides from the C3 promoter (−1005 to +251) was amplified from human blood genomic DNA (Clontech), using Forward primer containing KpnI restriction enzyme cleavage site (5′- GGG GTA CCG AAT ATG CTG TCA ACA GGG ATG -3′) and reverse primer containing BglII restriction enzyme cleavage site (5′- GGA AGA TCT AAC CAC AAA CAC CCA AAC TCA C -3′), and cloned into the pGL3 basic luciferase expression vector (Promega). .. The QuickChange® IIXL Site-Directed mutagenesis Kit (Stratagene) was used to generate mutant C3 using the C3 luciferase construct as a template and the following primers: forward primer (5′- GCC AGA TAA AAA GCC AGC TC T TTT AGG CGC TGC TCA CTC CTC CC-3’) and reverse primer (5′- GGG AGG AGT GAG CAG CGC CT A AAA GAG CTG GCT TTT TAT CTG GC -3′).



Similar Products

90
Promega pgl3‐basic luciferase expression vector
A , Alignment of the human, mouse, and rat Ht sequences is shown. Conserved nucleotides are marked with asterisk. The arrow indicates the TSS. B through E , <t>Luciferase</t> assay in SH‐SY5Y cells transfected for 48 hour with <t>pGL3‐Br</t> ( B and D ) or pGL3‐Ht ( C and E ) and cotransfected with siCTL, siDNMT1, siMeCP2, or siREST ( B , C ), or with EV, DNMT1, MeCP2, or REST ( D and E ). * P ≤0.05 vs siCTL or EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). CTL indicates control; DNMT1, DNA‐methyltransferase‐1; EV, empty vector; Ht , heart promoter, MeCP2, methyl‐CpG binding protein 2; NCX1, sodium/calcium exchanger 1; pGL3‐Br, Ncx1 brain promoter construct inserted in pGL3basic; pGL3‐Ht, Ncx1 heart promoter construct inserted in pGL3basic; REST, repressor element 1‐silencing transcription factor; si, small interfering; and TSS, transcription start site.
Pgl3‐Basic Luciferase Expression Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgl3+basic+luciferase+expression+vector/pgl3+basic/pmc11010005-43-21-25
Average 90 stars, based on 1 article reviews
pgl3‐basic luciferase expression vector - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Promega luciferase-expressing vector pgl3.basic
A , Alignment of the human, mouse, and rat Ht sequences is shown. Conserved nucleotides are marked with asterisk. The arrow indicates the TSS. B through E , <t>Luciferase</t> assay in SH‐SY5Y cells transfected for 48 hour with <t>pGL3‐Br</t> ( B and D ) or pGL3‐Ht ( C and E ) and cotransfected with siCTL, siDNMT1, siMeCP2, or siREST ( B , C ), or with EV, DNMT1, MeCP2, or REST ( D and E ). * P ≤0.05 vs siCTL or EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). CTL indicates control; DNMT1, DNA‐methyltransferase‐1; EV, empty vector; Ht , heart promoter, MeCP2, methyl‐CpG binding protein 2; NCX1, sodium/calcium exchanger 1; pGL3‐Br, Ncx1 brain promoter construct inserted in pGL3basic; pGL3‐Ht, Ncx1 heart promoter construct inserted in pGL3basic; REST, repressor element 1‐silencing transcription factor; si, small interfering; and TSS, transcription start site.
Luciferase Expressing Vector Pgl3.Basic, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgl3+basic+luciferase+expression+vector/pgl3+basic/pmc10415575-84-16-18
Average 90 stars, based on 1 article reviews
luciferase-expressing vector pgl3.basic - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Promega pgl3 basic luciferase expression vector
A. Quantification of DDAH2 mRNA levels in primary HUVECs naturally carrying the G/G (n = 10) or C/G genotype (n = 5). Total RNA was extracted from confluent cells. cDNA was reverse transcripted and analyzed by quantitative Real-Time PCR technique. Bars represent the means ± SD of two independent experiments carried out in triplicate (* P = 0.008 for G/G HUVECs vs C/G HUVECs); B. Luciferase activity was evaluated in immortalized HUVEC transfected with an empty <t>PGL3</t> luciferase vector (PGL3, light gray bar, n = 21); or a PGL3 vector carrying the rs9267551 G (PGL3G, white bar, n = 21); or a PGL3 vector carrying the rs9267551 C form (PGL3C, black bar, n = 21). Luciferase activity in mock transfected cells (mock, dark gray bar, n = 21) was assessed as a control. (** P = 0.00076 for PGL3G vs. PGL3C).
Pgl3 Basic Luciferase Expression Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgl3+basic+luciferase+expression+vector/pgl3+basic/pmc03338696-46-6-11
Average 90 stars, based on 1 article reviews
pgl3 basic luciferase expression vector - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Promega pgl3-basic firefly luciferase expression vector
A. Quantification of DDAH2 mRNA levels in primary HUVECs naturally carrying the G/G (n = 10) or C/G genotype (n = 5). Total RNA was extracted from confluent cells. cDNA was reverse transcripted and analyzed by quantitative Real-Time PCR technique. Bars represent the means ± SD of two independent experiments carried out in triplicate (* P = 0.008 for G/G HUVECs vs C/G HUVECs); B. Luciferase activity was evaluated in immortalized HUVEC transfected with an empty <t>PGL3</t> luciferase vector (PGL3, light gray bar, n = 21); or a PGL3 vector carrying the rs9267551 G (PGL3G, white bar, n = 21); or a PGL3 vector carrying the rs9267551 C form (PGL3C, black bar, n = 21). Luciferase activity in mock transfected cells (mock, dark gray bar, n = 21) was assessed as a control. (** P = 0.00076 for PGL3G vs. PGL3C).
Pgl3 Basic Firefly Luciferase Expression Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgl3+basic+luciferase+expression+vector/pgl3+basic/pm36293554-293-16-21
Average 90 stars, based on 1 article reviews
pgl3-basic firefly luciferase expression vector - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Promega pgl3-basic luciferase expression vector
A. Quantification of DDAH2 mRNA levels in primary HUVECs naturally carrying the G/G (n = 10) or C/G genotype (n = 5). Total RNA was extracted from confluent cells. cDNA was reverse transcripted and analyzed by quantitative Real-Time PCR technique. Bars represent the means ± SD of two independent experiments carried out in triplicate (* P = 0.008 for G/G HUVECs vs C/G HUVECs); B. Luciferase activity was evaluated in immortalized HUVEC transfected with an empty <t>PGL3</t> luciferase vector (PGL3, light gray bar, n = 21); or a PGL3 vector carrying the rs9267551 G (PGL3G, white bar, n = 21); or a PGL3 vector carrying the rs9267551 C form (PGL3C, black bar, n = 21). Luciferase activity in mock transfected cells (mock, dark gray bar, n = 21) was assessed as a control. (** P = 0.00076 for PGL3G vs. PGL3C).
Pgl3 Basic Luciferase Expression Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgl3+basic+luciferase+expression+vector/pgl3+basic/pmc09303992-180-20-24
Average 90 stars, based on 1 article reviews
pgl3-basic luciferase expression vector - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Promega promoterless luciferase expression vector pgl3-basic
A. Quantification of DDAH2 mRNA levels in primary HUVECs naturally carrying the G/G (n = 10) or C/G genotype (n = 5). Total RNA was extracted from confluent cells. cDNA was reverse transcripted and analyzed by quantitative Real-Time PCR technique. Bars represent the means ± SD of two independent experiments carried out in triplicate (* P = 0.008 for G/G HUVECs vs C/G HUVECs); B. Luciferase activity was evaluated in immortalized HUVEC transfected with an empty <t>PGL3</t> luciferase vector (PGL3, light gray bar, n = 21); or a PGL3 vector carrying the rs9267551 G (PGL3G, white bar, n = 21); or a PGL3 vector carrying the rs9267551 C form (PGL3C, black bar, n = 21). Luciferase activity in mock transfected cells (mock, dark gray bar, n = 21) was assessed as a control. (** P = 0.00076 for PGL3G vs. PGL3C).
Promoterless Luciferase Expression Vector Pgl3 Basic, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgl3+basic+luciferase+expression+vector/pgl3+basic/pm35302184-60-63-68
Average 90 stars, based on 1 article reviews
promoterless luciferase expression vector pgl3-basic - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Promega firefly luciferase expression vector (pgl3-basic vector
A. Quantification of DDAH2 mRNA levels in primary HUVECs naturally carrying the G/G (n = 10) or C/G genotype (n = 5). Total RNA was extracted from confluent cells. cDNA was reverse transcripted and analyzed by quantitative Real-Time PCR technique. Bars represent the means ± SD of two independent experiments carried out in triplicate (* P = 0.008 for G/G HUVECs vs C/G HUVECs); B. Luciferase activity was evaluated in immortalized HUVEC transfected with an empty <t>PGL3</t> luciferase vector (PGL3, light gray bar, n = 21); or a PGL3 vector carrying the rs9267551 G (PGL3G, white bar, n = 21); or a PGL3 vector carrying the rs9267551 C form (PGL3C, black bar, n = 21). Luciferase activity in mock transfected cells (mock, dark gray bar, n = 21) was assessed as a control. (** P = 0.00076 for PGL3G vs. PGL3C).
Firefly Luciferase Expression Vector (Pgl3 Basic Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgl3+basic+luciferase+expression+vector/pgl3+basic/pm32911010-285-34-40
Average 90 stars, based on 1 article reviews
firefly luciferase expression vector (pgl3-basic vector - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

Image Search Results


A , Alignment of the human, mouse, and rat Ht sequences is shown. Conserved nucleotides are marked with asterisk. The arrow indicates the TSS. B through E , Luciferase assay in SH‐SY5Y cells transfected for 48 hour with pGL3‐Br ( B and D ) or pGL3‐Ht ( C and E ) and cotransfected with siCTL, siDNMT1, siMeCP2, or siREST ( B , C ), or with EV, DNMT1, MeCP2, or REST ( D and E ). * P ≤0.05 vs siCTL or EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). CTL indicates control; DNMT1, DNA‐methyltransferase‐1; EV, empty vector; Ht , heart promoter, MeCP2, methyl‐CpG binding protein 2; NCX1, sodium/calcium exchanger 1; pGL3‐Br, Ncx1 brain promoter construct inserted in pGL3basic; pGL3‐Ht, Ncx1 heart promoter construct inserted in pGL3basic; REST, repressor element 1‐silencing transcription factor; si, small interfering; and TSS, transcription start site.

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Stroke Causes DNA Methylation at Ncx1 Heart Promoter in the Brain Via DNMT1/MeCP2/REST Epigenetic Complex

doi: 10.1161/JAHA.123.030460

Figure Lengend Snippet: A , Alignment of the human, mouse, and rat Ht sequences is shown. Conserved nucleotides are marked with asterisk. The arrow indicates the TSS. B through E , Luciferase assay in SH‐SY5Y cells transfected for 48 hour with pGL3‐Br ( B and D ) or pGL3‐Ht ( C and E ) and cotransfected with siCTL, siDNMT1, siMeCP2, or siREST ( B , C ), or with EV, DNMT1, MeCP2, or REST ( D and E ). * P ≤0.05 vs siCTL or EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). CTL indicates control; DNMT1, DNA‐methyltransferase‐1; EV, empty vector; Ht , heart promoter, MeCP2, methyl‐CpG binding protein 2; NCX1, sodium/calcium exchanger 1; pGL3‐Br, Ncx1 brain promoter construct inserted in pGL3basic; pGL3‐Ht, Ncx1 heart promoter construct inserted in pGL3basic; REST, repressor element 1‐silencing transcription factor; si, small interfering; and TSS, transcription start site.

Article Snippet: The PCR product was purified using StrataPrep DNA gel extraction kits (Agilent, Milan, Italy) and cloned into multiple cloning sites of pGL3‐basic luciferase expression vector (Promega, Milan, Italy).

Techniques: Luciferase, Transfection, Plasmid Preparation, Binding Assay, Construct

A , Top: JASPAR matrix representation (MA0138.1) of the consensus REST binding site on Ht gene ( Ht ‐RE1). Ht ‐RE1 sequence is represented in International Union of Pure and Applied Chemistry code. Bottom: Partial human genomic Ht sequence containing the predicted REST binding site (underlined). B , Luciferase assay in SH‐SY5Y cells under the following experimental conditions: (1) pGL3basic, (2) pGL3‐Ht+EV, (3) pGL3‐Ht+REST, (4) pGL3‐Ht‐RE1mut+EV, (5) pGL3‐Ht‐RE1mut+REST. * P ≤0.05 vs pGL3Ht+EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). C , ChIP with anti‐REST antibody followed by qPCR of the promoter region containing the RE1 site on the Ht gene in SH‐SY5Y cells transiently transfected with (1) pGL3‐Ht+EV, (2) pGL3‐Ht+REST, (3) pGL3‐Ht+RE1mut+REST. * P ≤0.05 vs pGL3‐Ht+EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). ChIP indicates chromatin immunoprecipitation; CTL, control; DNMT1, DNA‐methyltransferase‐1; EV, empty vector; Ht , heart promoter, MeCP2, methyl‐CpG binding protein 2; NCX1, sodium/calcium exchanger 1; pGL3‐Br, Ncx1 brain promoter construct inserted in pGL3basic; pGL3‐Ht, Ncx1 heart promoter construct inserted in pGL3basic; qRT‐PCR, quantitative real time polymerase chain reaction; RE1, repressor element 1; and REST, repressor element 1‐silencing transcription factor.

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Stroke Causes DNA Methylation at Ncx1 Heart Promoter in the Brain Via DNMT1/MeCP2/REST Epigenetic Complex

doi: 10.1161/JAHA.123.030460

Figure Lengend Snippet: A , Top: JASPAR matrix representation (MA0138.1) of the consensus REST binding site on Ht gene ( Ht ‐RE1). Ht ‐RE1 sequence is represented in International Union of Pure and Applied Chemistry code. Bottom: Partial human genomic Ht sequence containing the predicted REST binding site (underlined). B , Luciferase assay in SH‐SY5Y cells under the following experimental conditions: (1) pGL3basic, (2) pGL3‐Ht+EV, (3) pGL3‐Ht+REST, (4) pGL3‐Ht‐RE1mut+EV, (5) pGL3‐Ht‐RE1mut+REST. * P ≤0.05 vs pGL3Ht+EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). C , ChIP with anti‐REST antibody followed by qPCR of the promoter region containing the RE1 site on the Ht gene in SH‐SY5Y cells transiently transfected with (1) pGL3‐Ht+EV, (2) pGL3‐Ht+REST, (3) pGL3‐Ht+RE1mut+REST. * P ≤0.05 vs pGL3‐Ht+EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). ChIP indicates chromatin immunoprecipitation; CTL, control; DNMT1, DNA‐methyltransferase‐1; EV, empty vector; Ht , heart promoter, MeCP2, methyl‐CpG binding protein 2; NCX1, sodium/calcium exchanger 1; pGL3‐Br, Ncx1 brain promoter construct inserted in pGL3basic; pGL3‐Ht, Ncx1 heart promoter construct inserted in pGL3basic; qRT‐PCR, quantitative real time polymerase chain reaction; RE1, repressor element 1; and REST, repressor element 1‐silencing transcription factor.

Article Snippet: The PCR product was purified using StrataPrep DNA gel extraction kits (Agilent, Milan, Italy) and cloned into multiple cloning sites of pGL3‐basic luciferase expression vector (Promega, Milan, Italy).

Techniques: Binding Assay, Sequencing, Luciferase, Transfection, Chromatin Immunoprecipitation, Plasmid Preparation, Construct, Quantitative RT-PCR, Real-time Polymerase Chain Reaction

A. Quantification of DDAH2 mRNA levels in primary HUVECs naturally carrying the G/G (n = 10) or C/G genotype (n = 5). Total RNA was extracted from confluent cells. cDNA was reverse transcripted and analyzed by quantitative Real-Time PCR technique. Bars represent the means ± SD of two independent experiments carried out in triplicate (* P = 0.008 for G/G HUVECs vs C/G HUVECs); B. Luciferase activity was evaluated in immortalized HUVEC transfected with an empty PGL3 luciferase vector (PGL3, light gray bar, n = 21); or a PGL3 vector carrying the rs9267551 G (PGL3G, white bar, n = 21); or a PGL3 vector carrying the rs9267551 C form (PGL3C, black bar, n = 21). Luciferase activity in mock transfected cells (mock, dark gray bar, n = 21) was assessed as a control. (** P = 0.00076 for PGL3G vs. PGL3C).

Journal: PLoS ONE

Article Title: A Functional Variant of the Dimethylarginine Dimethylaminohydrolase-2 Gene Is Associated with Insulin Sensitivity

doi: 10.1371/journal.pone.0036224

Figure Lengend Snippet: A. Quantification of DDAH2 mRNA levels in primary HUVECs naturally carrying the G/G (n = 10) or C/G genotype (n = 5). Total RNA was extracted from confluent cells. cDNA was reverse transcripted and analyzed by quantitative Real-Time PCR technique. Bars represent the means ± SD of two independent experiments carried out in triplicate (* P = 0.008 for G/G HUVECs vs C/G HUVECs); B. Luciferase activity was evaluated in immortalized HUVEC transfected with an empty PGL3 luciferase vector (PGL3, light gray bar, n = 21); or a PGL3 vector carrying the rs9267551 G (PGL3G, white bar, n = 21); or a PGL3 vector carrying the rs9267551 C form (PGL3C, black bar, n = 21). Luciferase activity in mock transfected cells (mock, dark gray bar, n = 21) was assessed as a control. (** P = 0.00076 for PGL3G vs. PGL3C).

Article Snippet: Both fragments were inserted in the pGL3 basic luciferase expression vector (Promega, Madison, WI) and constructs sequence was confirmed by direct sequencing.

Techniques: Real-time Polymerase Chain Reaction, Luciferase, Activity Assay, Transfection, Plasmid Preparation