pgel1020 (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
pgel1020
Pgel1020, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pentr+pter/pENTR%2FpTER+shATM+%232+(730-2)+(Plasmid+%2322527)/pmc12043052-11-9-10
Average 93 stars, based on 1 article reviews
Pgel1020, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pentr+pter/pENTR%2FpTER+shATM+%232+(730-2)+(Plasmid+%2322527)/pmc12043052-11-9-10
Average 93 stars, based on 1 article reviews
pgel1020 - by Bioz Stars,
2026-10
93/100 stars
Images
Related Articles
shRNA:Article Title: Sterol-regulated transmembrane protein TMEM86a couples LXR signaling to regulation of lysoplasmalogens in macrophages. Article Snippet: .. Briefly, to silence Tmem86a, four independent shRNA sequences were designed using DSIR (32), cloned into Article Title: The MARCH6-SQLE Axis Controls Endothelial Cholesterol Homeostasis and Angiogenic Sprouting. Article Snippet: .. Generation of lentiviral particles and transduction of cell lines To silence expression ofMARCHF6 two independent shRNA sequences targetingMARCHF6were cloned into Article Title: Sterol-regulated transmembrane protein TMEM86a couples LXR signaling to regulation of lysoplasmalogens in macrophages Article Snippet: .. Briefly, to silence Tmem86a, four independent shRNA sequences were designed using DSIR , cloned into Modification:Article Title: Sterol-regulated transmembrane protein TMEM86a couples LXR signaling to regulation of lysoplasmalogens in macrophages. Article Snippet: .. Briefly, to silence Tmem86a, four independent shRNA sequences were designed using DSIR (32), cloned into Article Title: Sterol-regulated transmembrane protein TMEM86a couples LXR signaling to regulation of lysoplasmalogens in macrophages Article Snippet: .. Briefly, to silence Tmem86a, four independent shRNA sequences were designed using DSIR , cloned into Plasmid Preparation:Article Title: Epstein-Barr Virus LMP1 Promotes Syntenin-1- and Hrs-Induced Extracellular Vesicle Formation for Its Own Secretion To Increase Cell Proliferation and Migration Article Snippet: The following oligonucleotides were used to construct the shRNA vectors directed against Alix, Hrs, TSG101, and Syntentin-1, where the Hrs, TSG101, Syntenin-1, and Alix target sequences were obtained from the Broad Institute GPP Web portal following searches with the corresponding gene names, and the scramble sequence was obtained by inputting the Syntenin-1 sequence into an online shRNA scramble tool through InvivoGen: GATCCCGCATAATCAAGGCACTGTAAAGTGTGCTGTCCTTTACAGTGCCTTGATTATGCTTTTTGGAAA and AGCTTTTCCAAAAAGCATAATCAAGGCACTGTAAAGGACAGCACACTTTACAGTGCCTTGATTATGCGG for Alix, GATCCCTATAGCATACTTGCATCTTTAGTGTGCTGTCCTAAAGATGCAAGTATGCTATATTTTTGGAAA and AGCTTTTCCAAAAATATAGCATACTTGCATCTTTAGGACAGCACACAAAGATGCAAGTATGCTATAGG for Syntenin-1, GATCCCGAGCTTCGCGATCCAAGATAAGTGTGCTGTCCTTATCTTGGATCGCGAAGCTCTTTTTGGAAA and AGCTTTTCCAAAAAGAGCTTCGCGATCCAAGATAAGGACAGCACACTTATCTTGGATCGCGAAGCTCGG for scramble, GATCCCGTACGTCTTCTGTCCCGTAAAGTGTGCTGTCCTTTACGGGACAGAAGACGTACTTTTTGGAAA and AGCTTTTCCAAAAAGTACGTCTTCTGTCCCGTAAAGGACAGCACACTTTACGGGACAGAAGACGTACGG for TSG101, and GATCCCCTCACGTCCGGAGTAACACTAGTGTGCTGTCCTAGTGTTACTCCGGACGTGAGTTTTTGGAAA and AGCTTTTCCAAAAACTCACGTCCGGAGTAACACTAGGACAGCACACTAGTGTTACTCCGGACGTGAGGG for Hrs. .. These oligonucleotides were annealed and ligated using T4 ligase between the BglII/HindIII sites of Article Title: Alix and Syntenin-1 direct amyloid precursor protein trafficking into extracellular vesicles Article Snippet: The control scramble sequence was generated using the Invivogen shRNA scramble tool as previously described (62). .. The oligonucleotides listed below were annealed and ligated using T4 ligase between the Bgl II/Hind III sites of Article Title: Alix and Syntenin-1 direct amyloid precursor protein trafficking into extracellular vesicles Article Snippet: The control scramble sequence was generated using the Invivogen shRNA scramble tool as previously described [ ]. .. The oligonucleotides listed below were annealed and ligated using T4 ligase between the Bgl II/Hind III sites of Transduction:Article Title: The MARCH6-SQLE Axis Controls Endothelial Cholesterol Homeostasis and Angiogenic Sprouting. Article Snippet: .. Generation of lentiviral particles and transduction of cell lines To silence expression ofMARCHF6 two independent shRNA sequences targetingMARCHF6were cloned into Expressing:Article Title: The MARCH6-SQLE Axis Controls Endothelial Cholesterol Homeostasis and Angiogenic Sprouting. Article Snippet: .. Generation of lentiviral particles and transduction of cell lines To silence expression ofMARCHF6 two independent shRNA sequences targetingMARCHF6were cloned into Clone Assay:Article Title: The MARCH6-SQLE Axis Controls Endothelial Cholesterol Homeostasis and Angiogenic Sprouting. Article Snippet: .. Generation of lentiviral particles and transduction of cell lines To silence expression ofMARCHF6 two independent shRNA sequences targetingMARCHF6were cloned into Article Title: Sterol-regulated transmembrane protein TMEM86a couples LXR signaling to regulation of lysoplasmalogens in macrophages Article Snippet: .. Briefly, to silence Tmem86a, four independent shRNA sequences were designed using DSIR , cloned into other:Article Title: Extracellular Vesicles in Disease Pathogenesis and as a Therapeutic Agent Article Snippet: and were cultured in neurobasal A medium (Gibco; A3653401) supplemented with B-27 (Gibco; A3582801), 0.5 mM L-glutamine, and penicillin-streptomycin at 37°C and 5% COz. Article Title: Epstein-Barr Virus LMP1 Promotes Syntenin-1- and Hrs-Induced Extracellular Vesicle Formation for Its Own Secretion To Increase Cell Proliferation and Migration Article Snippet: Lentiviral shRNA constructs (Mission shRNA) for ARF6 (catalog number, TRCN0000380270), SRC (TRCN0000038150), CHMP1A (TRCN0000250119), CHMP2A (TRCN0000122479), CHMP2B (TRCN0000129922), CHMP3 (TRCN0000149440), CHMP4B (TRCN0000180330), CHMP5 (TRCN0000163206), and CHMP6 (TRCN0000151037) were purchased from Sigma-Aldrich. |
