Review



pcdna5 mts tagbfpp2at2a egfp nls p2at2a mcherry pts1  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Addgene inc pcdna5 mts tagbfpp2at2a egfp nls p2at2a mcherry pts1
    Pcdna5 Mts Tagbfpp2at2a Egfp Nls P2at2a Mcherry Pts1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/p2at2a/pcDNA3%2E1+Makona+EBOV+AB'3+(Plasmid+%2387813)/pm41786974-47-16-17
    Average 94 stars, based on 1 article reviews
    pcdna5 mts tagbfpp2at2a egfp nls p2at2a mcherry pts1 - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    Construct:

    Article Title: Loss-of-function mitochondrial DNA polymerase gamma variants cause vascular smooth muscle cells to secrete a diffusible mitogenic factor
    Article Snippet: ® Endo-Free Plasmid DNA Midi Kit Cat #D6915-03 or Promega PureYield Midiprep Cat # PR-A2492). .. To create POLG-expression constructs with self-cleaving nuclear-targeted EGPF, we cloned the POLG (or variants) coding sequences and a P2AT2A (Addgene 87829) sequence 5′ of the EGFP3xNLS on pEGFP-C1 EGFP-3XNLS (Addgene 58468) by Gibson assembly. ..

    Clone Assay:

    Article Title: Loss-of-function mitochondrial DNA polymerase gamma variants cause vascular smooth muscle cells to secrete a diffusible mitogenic factor
    Article Snippet: ® Endo-Free Plasmid DNA Midi Kit Cat #D6915-03 or Promega PureYield Midiprep Cat # PR-A2492). .. To create POLG-expression constructs with self-cleaving nuclear-targeted EGPF, we cloned the POLG (or variants) coding sequences and a P2AT2A (Addgene 87829) sequence 5′ of the EGFP3xNLS on pEGFP-C1 EGFP-3XNLS (Addgene 58468) by Gibson assembly. ..

    Sequencing:

    Article Title: Loss-of-function mitochondrial DNA polymerase gamma variants cause vascular smooth muscle cells to secrete a diffusible mitogenic factor
    Article Snippet: ® Endo-Free Plasmid DNA Midi Kit Cat #D6915-03 or Promega PureYield Midiprep Cat # PR-A2492). .. To create POLG-expression constructs with self-cleaving nuclear-targeted EGPF, we cloned the POLG (or variants) coding sequences and a P2AT2A (Addgene 87829) sequence 5′ of the EGFP3xNLS on pEGFP-C1 EGFP-3XNLS (Addgene 58468) by Gibson assembly. ..

    other:

    Article Title: Loss-of-function mitochondrial DNA polymerase gamma variants cause vascular smooth muscle cells to secrete a diffusible mitogenic factor
    Article Snippet: P2AT2A (Addgene 87,829) , F: GGAGGCAGAAAGCTTGGT R: CTCGGTAGGTCCAGGATTCT , 66.0.



    Similar Products

    94
    Addgene inc pcdna5 mts tagbfpp2at2a egfp nls p2at2a mcherry pts1
    Pcdna5 Mts Tagbfpp2at2a Egfp Nls P2at2a Mcherry Pts1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/p2at2a/pcDNA3%2E1+Makona+EBOV+AB'3+(Plasmid+%2387813)/pm41786974-47-16-17
    Average 94 stars, based on 1 article reviews
    pcdna5 mts tagbfpp2at2a egfp nls p2at2a mcherry pts1 - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Addgene inc pcdna5 mts tagbfp p2at2a egfp nls p2at2a mcherry pts1
    Pcdna5 Mts Tagbfp P2at2a Egfp Nls P2at2a Mcherry Pts1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/p2at2a/pcDNA3%2E1+Makona+EBOV+AB'3+(Plasmid+%2387813)/pmc13049093-43-16-17
    Average 94 stars, based on 1 article reviews
    pcdna5 mts tagbfp p2at2a egfp nls p2at2a mcherry pts1 - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    90
    Addgene inc p2at2a sequence
    P2at2a Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/p2at2a/p2a+sequence/pmc11873068-79-21-29
    Average 90 stars, based on 1 article reviews
    p2at2a sequence - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    93
    Addgene inc p2at2a
    Cloning primers.
    P2at2a, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/p2at2a/pcDNA5-MTS-TagBFP-P2AT2A-EGFP-NLS-P2AT2A-mCherry-PTS1+(Plasmid+%2387829)/pmc11873068-79-18-19
    Average 93 stars, based on 1 article reviews
    p2at2a - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc mcherry
    Co-cultivation of CAFs with chemoresistant OCCC cells recapitulates the chemoresistant niche in vitro (A) Experimental design of the in vitro co-culture system. Cancer spheroid cells and CAFs were derived from surgical specimens of HIF-1α-positive OCCC. The established cancer cells and CAFs were labeled with GFP/Luc2 <t>and</t> <t>mCherry/hRluc,</t> respectively; cultivated either alone or in combination; and subjected to a chemosensitivity assay, scRNA-seq, or drug screening. (B) Bright-phase images (top) and fluorescence images (bottom) of the indicated cells cultivated under organoid conditions for 7 days. Scale bars, 100 μm. (C) Survival of CAFs upon monoculture or co-culture with cancer cells (OVN-48) for 7 days. Cultured cells were grown in the absence or presence of the indicated concentrations of carboplatin, and cell survival was evaluated by measuring hRLuc activity. The data are presented as mean ± SD ( n = 3). p values were determined by Student’s t test. ∗∗∗ p < 0.001. (D) Western blot analyses of cancer cells that were sorted by fluorescence-activated cell sorting (FACS) after incubation under monoculture or co-culture conditions for 3 days. (E) Representative image of immunostaining of HIF-1α and α-SMA in cancer cells and CAFs co-cultured for 3 days. Scale bars, 100 μm. (F) Cancer cell growth (OVN-48) upon monoculture or co-culture with CAFs for 7 days. Cultured cells were grown in the absence or presence of the indicated concentrations of carboplatin, and cancer cell proliferation was evaluated by measuring Luc2 activity ( n = 3). ∗∗∗ p < 0.001. (G) UMAP plot of scRNA-seq data from cancer cells (OVN-48) and CAFs incubated under monoculture and co-culture conditions for 3 days. (H) Violin plots of the signature scores for the cancer subpopulations (Cancer #1–6) grown under the monoculture and co-culture conditions in (G). (I) Violin plots of the indicated signature genes in CAFs grown under the monoculture and co-culture conditions shown in (G). Statistically significant differences are indicated: ∗∗∗ p < 0.001.
    Mcherry, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/p2at2a/pcDNA5-MTS-TagBFP-P2AT2A-EGFP-NLS-P2AT2A-mCherry-PTS1+(Plasmid+%2387829)/pmc11149410-391-25-29
    Average 93 stars, based on 1 article reviews
    mcherry - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc e1320 pcdna5 mts tagbfp p2at2a egfpnls p2at2a mcherry pts1 addgene
    Co-cultivation of CAFs with chemoresistant OCCC cells recapitulates the chemoresistant niche in vitro (A) Experimental design of the in vitro co-culture system. Cancer spheroid cells and CAFs were derived from surgical specimens of HIF-1α-positive OCCC. The established cancer cells and CAFs were labeled with GFP/Luc2 <t>and</t> <t>mCherry/hRluc,</t> respectively; cultivated either alone or in combination; and subjected to a chemosensitivity assay, scRNA-seq, or drug screening. (B) Bright-phase images (top) and fluorescence images (bottom) of the indicated cells cultivated under organoid conditions for 7 days. Scale bars, 100 μm. (C) Survival of CAFs upon monoculture or co-culture with cancer cells (OVN-48) for 7 days. Cultured cells were grown in the absence or presence of the indicated concentrations of carboplatin, and cell survival was evaluated by measuring hRLuc activity. The data are presented as mean ± SD ( n = 3). p values were determined by Student’s t test. ∗∗∗ p < 0.001. (D) Western blot analyses of cancer cells that were sorted by fluorescence-activated cell sorting (FACS) after incubation under monoculture or co-culture conditions for 3 days. (E) Representative image of immunostaining of HIF-1α and α-SMA in cancer cells and CAFs co-cultured for 3 days. Scale bars, 100 μm. (F) Cancer cell growth (OVN-48) upon monoculture or co-culture with CAFs for 7 days. Cultured cells were grown in the absence or presence of the indicated concentrations of carboplatin, and cancer cell proliferation was evaluated by measuring Luc2 activity ( n = 3). ∗∗∗ p < 0.001. (G) UMAP plot of scRNA-seq data from cancer cells (OVN-48) and CAFs incubated under monoculture and co-culture conditions for 3 days. (H) Violin plots of the signature scores for the cancer subpopulations (Cancer #1–6) grown under the monoculture and co-culture conditions in (G). (I) Violin plots of the indicated signature genes in CAFs grown under the monoculture and co-culture conditions shown in (G). Statistically significant differences are indicated: ∗∗∗ p < 0.001.
    E1320 Pcdna5 Mts Tagbfp P2at2a Egfpnls P2at2a Mcherry Pts1 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/p2at2a/pcDNA5-MTS-TagBFP-P2AT2A-EGFP-NLS-P2AT2A-mCherry-PTS1+(Plasmid+%2387829)/pmc11149410__mmc6-241-258-260
    Average 93 stars, based on 1 article reviews
    e1320 pcdna5 mts tagbfp p2at2a egfpnls p2at2a mcherry pts1 addgene - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    Cloning primers.

    Journal: Frontiers in Physiology

    Article Title: Loss-of-function mitochondrial DNA polymerase gamma variants cause vascular smooth muscle cells to secrete a diffusible mitogenic factor

    doi: 10.3389/fphys.2024.1488248

    Figure Lengend Snippet: Cloning primers.

    Article Snippet: To create POLG-expression constructs with self-cleaving nuclear-targeted EGPF, we cloned the POLG (or variants) coding sequences and a P2AT2A (Addgene 87829) sequence 5′ of the EGFP3xNLS on pEGFP-C1 EGFP-3XNLS (Addgene 58468) by Gibson assembly.

    Techniques: Cloning, Sequencing

    Loss-of-function POLG variants minimally affect mitochondrial membrane potential, ROS production, and cellular respiration in A7r5 cells. (A) Example image of A7r5 cells transfected with pPOLG:P2AT2A:EGFP3xNLS labeled with Hoechst 33342 and TMRM (25 nM) and treated with oligomycin (10 µM). The green circle overlays highlight transfected cells, and the white box is zoomed in on the far right. Orange asterisks highlight cells with minimal TMRM staining. Scale bars: 50 µm for composite images and 10 µm for zoomed images. (B) Average TMRM intensity for all 13,210 cells in one of two experimental replicates. ** p < 0.005 for Tukey’s honest significant different test. (C, D) TMRM values in the control-treated well, where each cell was normalized as its TMRM intensity less the mean FCCP value and divided by the difference between the mean of oligomycin- and FCCP-treated wells. Data are compiled from four fields of view in each quadruplicate well in each of two independent experiments. (E) Example distribution of nuclear GFP mean intensity and triple Gaussian fit. Cells with mean intensity higher than mean + (3 x SD) of first Gaussian peak are defined as transfected. Summary statistics of the transfection efficiency are shown below. (F) Representative images of MitoSOX (5 µM) in cultured transfected with WT pPOLG:P2AT2A:EGFP3xNLS treated with antimycin A (1 µM). Green circle overlays represent transfected cells, and the white box is zoomed in on the far right. Scale bars: 50 µm for composite images and 10 µm for zoomed images. (G) MitoSOX intensity was measured using nuclear regions of interest and normalized to the means of control-treated, WT-transfected cells on each of two independent experiments, imaging four fields of view in each quadruplicate well. AA indicates wells treated with antimycin A (1 µM) to stimulate ROS production. ** p < 0.005 for two-sample t -test. (H) Data in (G) are re-plotted by simplified cell ploidy. ** indicates p < 0.005 for Dunnett’s post hoc tests versus 2N. (I) A7r5 oxygen consumption rates per cell in Seahorse XFe Mito Stress Test. Lines show mean plus standard error bands for two independent experiments with 6–8 technical replicates each. Oligomycin (1 µM), FCCP (1 µM), rotenone, and antimycin A (1 µM) were added, as indicated with the arrows. (J) Oxygen consumption rate normalized to POLG separately for GM and DM conditions. One outlier ( > 3) in the GM for non-mitochondrial OCR for NLSGFP (4.283) and one well corresponding to five points in N1098I DM were removed for clarity but not removed from statistical analysis. For each experimental paradigm (TMRM, MitoSOX, and Seahorse), data show the results of two independent experiments, with technical quadruplicate wells for TMRM and MitoSOX and eight technical replicates per Seahorse plate.

    Journal: Frontiers in Physiology

    Article Title: Loss-of-function mitochondrial DNA polymerase gamma variants cause vascular smooth muscle cells to secrete a diffusible mitogenic factor

    doi: 10.3389/fphys.2024.1488248

    Figure Lengend Snippet: Loss-of-function POLG variants minimally affect mitochondrial membrane potential, ROS production, and cellular respiration in A7r5 cells. (A) Example image of A7r5 cells transfected with pPOLG:P2AT2A:EGFP3xNLS labeled with Hoechst 33342 and TMRM (25 nM) and treated with oligomycin (10 µM). The green circle overlays highlight transfected cells, and the white box is zoomed in on the far right. Orange asterisks highlight cells with minimal TMRM staining. Scale bars: 50 µm for composite images and 10 µm for zoomed images. (B) Average TMRM intensity for all 13,210 cells in one of two experimental replicates. ** p < 0.005 for Tukey’s honest significant different test. (C, D) TMRM values in the control-treated well, where each cell was normalized as its TMRM intensity less the mean FCCP value and divided by the difference between the mean of oligomycin- and FCCP-treated wells. Data are compiled from four fields of view in each quadruplicate well in each of two independent experiments. (E) Example distribution of nuclear GFP mean intensity and triple Gaussian fit. Cells with mean intensity higher than mean + (3 x SD) of first Gaussian peak are defined as transfected. Summary statistics of the transfection efficiency are shown below. (F) Representative images of MitoSOX (5 µM) in cultured transfected with WT pPOLG:P2AT2A:EGFP3xNLS treated with antimycin A (1 µM). Green circle overlays represent transfected cells, and the white box is zoomed in on the far right. Scale bars: 50 µm for composite images and 10 µm for zoomed images. (G) MitoSOX intensity was measured using nuclear regions of interest and normalized to the means of control-treated, WT-transfected cells on each of two independent experiments, imaging four fields of view in each quadruplicate well. AA indicates wells treated with antimycin A (1 µM) to stimulate ROS production. ** p < 0.005 for two-sample t -test. (H) Data in (G) are re-plotted by simplified cell ploidy. ** indicates p < 0.005 for Dunnett’s post hoc tests versus 2N. (I) A7r5 oxygen consumption rates per cell in Seahorse XFe Mito Stress Test. Lines show mean plus standard error bands for two independent experiments with 6–8 technical replicates each. Oligomycin (1 µM), FCCP (1 µM), rotenone, and antimycin A (1 µM) were added, as indicated with the arrows. (J) Oxygen consumption rate normalized to POLG separately for GM and DM conditions. One outlier ( > 3) in the GM for non-mitochondrial OCR for NLSGFP (4.283) and one well corresponding to five points in N1098I DM were removed for clarity but not removed from statistical analysis. For each experimental paradigm (TMRM, MitoSOX, and Seahorse), data show the results of two independent experiments, with technical quadruplicate wells for TMRM and MitoSOX and eight technical replicates per Seahorse plate.

    Article Snippet: To create POLG-expression constructs with self-cleaving nuclear-targeted EGPF, we cloned the POLG (or variants) coding sequences and a P2AT2A (Addgene 87829) sequence 5′ of the EGFP3xNLS on pEGFP-C1 EGFP-3XNLS (Addgene 58468) by Gibson assembly.

    Techniques: Membrane, Transfection, Labeling, Staining, Control, Cell Culture, Imaging

    Loss-of-function POLG variants mediate a mitogenic effect via diffusible messenger. (A) Protocol illustration. (B) IncuCyte exemplar images of pPOLG:P2AT2A:EGFP3xNLS-expressing A7r5 (top) and HeLa (bottom) nuclei labeled with SPY650 DNA (3000x dilution) and SiR-DNA (0.5 µM), respectively. HeLa stably express H2B-RFP. (C) Example growth curves normalized to the number of cells in the first frame, with mean banded by standard error for four fields of view. A7r5 are in DM, and HeLa cells are in GM. (D) Effect of POLG variants on final cell density, normalized to the density in WT-transfected cells. ** p < 0.005 for Dunnett’s post hoc tests versus WT, ‡ p < 0.05 for Dunnett’s post hoc test vs. WT for combined GM + DM data. Data show two fields of view in duplicate wells on each of three independent experiments. (E) Illustration of the media transfer protocol. (F) Growth curve of naïve HeLa cells treated with conditioned media from transfected HeLa cells, which were normalized at 26 h when the media was added. (G) Doubling time in hours for WT POLG and variants. * p < 0.05 for Dunnett’s post hoc tests versus WT. Data show the summary of single fields of view imaged in eight duplicate wells (i.e. eight wells per plasmid) on each of three independent experiments.

    Journal: Frontiers in Physiology

    Article Title: Loss-of-function mitochondrial DNA polymerase gamma variants cause vascular smooth muscle cells to secrete a diffusible mitogenic factor

    doi: 10.3389/fphys.2024.1488248

    Figure Lengend Snippet: Loss-of-function POLG variants mediate a mitogenic effect via diffusible messenger. (A) Protocol illustration. (B) IncuCyte exemplar images of pPOLG:P2AT2A:EGFP3xNLS-expressing A7r5 (top) and HeLa (bottom) nuclei labeled with SPY650 DNA (3000x dilution) and SiR-DNA (0.5 µM), respectively. HeLa stably express H2B-RFP. (C) Example growth curves normalized to the number of cells in the first frame, with mean banded by standard error for four fields of view. A7r5 are in DM, and HeLa cells are in GM. (D) Effect of POLG variants on final cell density, normalized to the density in WT-transfected cells. ** p < 0.005 for Dunnett’s post hoc tests versus WT, ‡ p < 0.05 for Dunnett’s post hoc test vs. WT for combined GM + DM data. Data show two fields of view in duplicate wells on each of three independent experiments. (E) Illustration of the media transfer protocol. (F) Growth curve of naïve HeLa cells treated with conditioned media from transfected HeLa cells, which were normalized at 26 h when the media was added. (G) Doubling time in hours for WT POLG and variants. * p < 0.05 for Dunnett’s post hoc tests versus WT. Data show the summary of single fields of view imaged in eight duplicate wells (i.e. eight wells per plasmid) on each of three independent experiments.

    Article Snippet: To create POLG-expression constructs with self-cleaving nuclear-targeted EGPF, we cloned the POLG (or variants) coding sequences and a P2AT2A (Addgene 87829) sequence 5′ of the EGFP3xNLS on pEGFP-C1 EGFP-3XNLS (Addgene 58468) by Gibson assembly.

    Techniques: Expressing, Labeling, Stable Transfection, Transfection, Plasmid Preparation

    Co-cultivation of CAFs with chemoresistant OCCC cells recapitulates the chemoresistant niche in vitro (A) Experimental design of the in vitro co-culture system. Cancer spheroid cells and CAFs were derived from surgical specimens of HIF-1α-positive OCCC. The established cancer cells and CAFs were labeled with GFP/Luc2 and mCherry/hRluc, respectively; cultivated either alone or in combination; and subjected to a chemosensitivity assay, scRNA-seq, or drug screening. (B) Bright-phase images (top) and fluorescence images (bottom) of the indicated cells cultivated under organoid conditions for 7 days. Scale bars, 100 μm. (C) Survival of CAFs upon monoculture or co-culture with cancer cells (OVN-48) for 7 days. Cultured cells were grown in the absence or presence of the indicated concentrations of carboplatin, and cell survival was evaluated by measuring hRLuc activity. The data are presented as mean ± SD ( n = 3). p values were determined by Student’s t test. ∗∗∗ p < 0.001. (D) Western blot analyses of cancer cells that were sorted by fluorescence-activated cell sorting (FACS) after incubation under monoculture or co-culture conditions for 3 days. (E) Representative image of immunostaining of HIF-1α and α-SMA in cancer cells and CAFs co-cultured for 3 days. Scale bars, 100 μm. (F) Cancer cell growth (OVN-48) upon monoculture or co-culture with CAFs for 7 days. Cultured cells were grown in the absence or presence of the indicated concentrations of carboplatin, and cancer cell proliferation was evaluated by measuring Luc2 activity ( n = 3). ∗∗∗ p < 0.001. (G) UMAP plot of scRNA-seq data from cancer cells (OVN-48) and CAFs incubated under monoculture and co-culture conditions for 3 days. (H) Violin plots of the signature scores for the cancer subpopulations (Cancer #1–6) grown under the monoculture and co-culture conditions in (G). (I) Violin plots of the indicated signature genes in CAFs grown under the monoculture and co-culture conditions shown in (G). Statistically significant differences are indicated: ∗∗∗ p < 0.001.

    Journal: Cell Reports Medicine

    Article Title: Targeting PDGF signaling of cancer-associated fibroblasts blocks feedback activation of HIF-1α and tumor progression of clear cell ovarian cancer

    doi: 10.1016/j.xcrm.2024.101532

    Figure Lengend Snippet: Co-cultivation of CAFs with chemoresistant OCCC cells recapitulates the chemoresistant niche in vitro (A) Experimental design of the in vitro co-culture system. Cancer spheroid cells and CAFs were derived from surgical specimens of HIF-1α-positive OCCC. The established cancer cells and CAFs were labeled with GFP/Luc2 and mCherry/hRluc, respectively; cultivated either alone or in combination; and subjected to a chemosensitivity assay, scRNA-seq, or drug screening. (B) Bright-phase images (top) and fluorescence images (bottom) of the indicated cells cultivated under organoid conditions for 7 days. Scale bars, 100 μm. (C) Survival of CAFs upon monoculture or co-culture with cancer cells (OVN-48) for 7 days. Cultured cells were grown in the absence or presence of the indicated concentrations of carboplatin, and cell survival was evaluated by measuring hRLuc activity. The data are presented as mean ± SD ( n = 3). p values were determined by Student’s t test. ∗∗∗ p < 0.001. (D) Western blot analyses of cancer cells that were sorted by fluorescence-activated cell sorting (FACS) after incubation under monoculture or co-culture conditions for 3 days. (E) Representative image of immunostaining of HIF-1α and α-SMA in cancer cells and CAFs co-cultured for 3 days. Scale bars, 100 μm. (F) Cancer cell growth (OVN-48) upon monoculture or co-culture with CAFs for 7 days. Cultured cells were grown in the absence or presence of the indicated concentrations of carboplatin, and cancer cell proliferation was evaluated by measuring Luc2 activity ( n = 3). ∗∗∗ p < 0.001. (G) UMAP plot of scRNA-seq data from cancer cells (OVN-48) and CAFs incubated under monoculture and co-culture conditions for 3 days. (H) Violin plots of the signature scores for the cancer subpopulations (Cancer #1–6) grown under the monoculture and co-culture conditions in (G). (I) Violin plots of the indicated signature genes in CAFs grown under the monoculture and co-culture conditions shown in (G). Statistically significant differences are indicated: ∗∗∗ p < 0.001.

    Article Snippet: To generate the pCDH-hRluc-T2A-mCherry plasmid, the hRluc-T2A-mCherry cassette was first generated by ligating the synthesized T2A sequence with hRluc (PCR-amplified from pGL4.74[hRluc/TK] (Promega, E6921)) and mCherry (PCR-amplified from pcDNA5-MTS-TagBFP-P2AT2A-EGFP-NLS-P2AT2A-mCherry-PTS1 (Addgene, #87829)).

    Techniques: In Vitro, Co-Culture Assay, Derivative Assay, Labeling, Drug discovery, Fluorescence, Cell Culture, Activity Assay, Western Blot, FACS, Incubation, Immunostaining

    Journal: Cell Reports Medicine

    Article Title: Targeting PDGF signaling of cancer-associated fibroblasts blocks feedback activation of HIF-1α and tumor progression of clear cell ovarian cancer

    doi: 10.1016/j.xcrm.2024.101532

    Figure Lengend Snippet:

    Article Snippet: To generate the pCDH-hRluc-T2A-mCherry plasmid, the hRluc-T2A-mCherry cassette was first generated by ligating the synthesized T2A sequence with hRluc (PCR-amplified from pGL4.74[hRluc/TK] (Promega, E6921)) and mCherry (PCR-amplified from pcDNA5-MTS-TagBFP-P2AT2A-EGFP-NLS-P2AT2A-mCherry-PTS1 (Addgene, #87829)).

    Techniques: Plasmid Preparation, Recombinant, Lysis, Cell Recovery, Luciferase, Reporter Assay, In Vitro, Gene Expression, Control, Software