oxacillin mic (ATCC)

ATCC is a verified supplier

ATCC manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

ATCC oxacillin mic
Oxacillin Mic, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 17828 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oxacillin+mic/MIC/fda_document____cdrh_docs_slash_reviews_slash_k091024-49-4-39
Average 99 stars, based on 17828 article reviews

oxacillin mic - by Bioz Stars, 2026-09

99/100 stars

Images

other:

Article Title: The synergistic effect of PDT and oxacillin on clinical isolates of Staphylococcus aureus.
Article Snippet: Background: Staphylococcus aureus is a major pathogen in clinical microbiology.. It is known to cause infections at various body sites and can be life-threatening.. The development of resistance to many well-established antibiotic treatments and the prevalence of methicillinresistant S. aureus (MRAS) among hospital patients and the general community pose challenges in treating the pathogen.

Article Title: Molecular Insights into an Antibiotic Enhancer Action of New Morpholine-Containing 5-Arylideneimidazolones in the Fight against MDR Bacteria
Article Snippet: None of compounds tested here had any influence on the oxacillin MIC in the reference MSSA strain ATCC 25923.

Article Title: A Staphylococcus xylosus Isolate with a New <i>mecC</i> Allotype
Article Snippet: The strains analyzed in this study have metabolic utilization clusters present at orfX, which may reflect the biological niche occu- TABLE 1 Bacterial strains used in this study Species Strain Relevant characteristics Reference S. xylosus S04009 mecC1, bovine mastitis 13 S. xylosus S040010 Bovine mastitis 13 S. xylosus C2a Human skin commensal 13 S. aureus LGA251 mecC, ST425 5 TABLE 2 Overview of Staphyloccocus xylosus isolates screened for mecC No. of isolates screened Relevant characteristics Reference 15 The Netherlands, bovine milk; oxacillin MIC 0.5 g/ml 26 20 Switzerland, bovine milk; oxacillin MIC 0.5 g/ml This work 5 France, various sources 13 3 Switzerland, horse skin; 2 isolates with oxacillin MIC 0.5 g/ml 27 70 United States, bovine milk and streak canals 28 and this work 1 United States, human skin; ATCC 29971 29 1526 aac.asm.org Antimicrobial Agents and Chemotherapy pied by the S. xylosus isolates included in this study.

Article Title:
Article Snippet: MRSA strains with an oxacillin MIC less than or equal to 1 mg/l may be not detected when the inoculum is very low. f. Analytical sensitivity Recovery study Recovery study was performed using one strain of S. aureus (MRSA) ATCC 43300.

Sequencing:

Article Title: A Staphylococcus xylosus Isolate with a New mecC Allotype
Article Snippet: .. The eighth gene in the myo -inositol cluster that is truncated in C2a and intact in S04009 is indicated with shading. table ft1 table-wrap mode="anchored" t5 caption a7 Species Strain Relevant characteristics Reference S. xylosus S04009 mecC1 , bovine mastitis 13 S. xylosus S040010 Bovine mastitis 13 S. xylosus C2a Human skin commensal 13 S. aureus LGA251 mecC , ST425 5 Open in a separate window Bacterial strains used in this study table ft1 table-wrap mode="anchored" t5 caption a7 No. of isolates screened Relevant characteristics Reference 15 The Netherlands, bovine milk; oxacillin MIC ≥ 0.5 μg/ml 26 20 Switzerland, bovine milk; oxacillin MIC ≥ 0.5 μg/ml This work 5 France, various sources 13 3 Switzerland, horse skin; 2 isolates with oxacillin MIC ≥ 0.5 μg/ml 27 70 United States, bovine milk and streak canals 28 and this work 1 United States, human skin; ATCC 29971 29 Open in a separate window Overview of Staphyloccocus xylosus isolates screened for mecC table ft1 table-wrap mode="anchored" t5 caption a7 Primer name Sequence (5′→3′) Target Reference mecC1 + 2_F 5′- AAGTTAATCAAAAATGGGTTCAGC -3′ mecC This work mecC1 + 2_R 5′GGTTGTAATGCTGTACCAGATCC -3′ mecC This work blaZ_XI_F 5′- CGTTTTGCWTATGCTTCCAC -3′ blaZ This work blaZ_XI_R 5′- CKGGTTCTTTTCTAGATGGATG -3′ blaZ This work MecA1 GTA GAA ATG ACT GAA CGT CCG ATA A mecA 30 MecA2 CCA ATT CCA CAT TGT TTC GGT CTA A mecA 30 16SF CCTATAAGACTGGGATAACTTCGGG 16S rDNA 31 16SR CTTTGAGTTTCAACCTTGCGGTCG 16S rDNA 31 Open in a separate window Oligonucleotide primers used in this study The finding that multiple components of the type XI SCC mec are present in contiguous blocks in the chromosome of S. xylosus S04009 suggests that this element may represent the remnants of an ancestral SCC mec element. ..

Comparison:

Article Title: Exposure to oxacillin subinhibitory concentrations and in vitro induction of resistance expression in heteroresistant and non-heteroresistant oxacillin-susceptible mecA -positive Staphylococcus aureus (OS-MRSA)
Article Snippet: .. Some changes in oxacillin MIC and oxacillin zone diameter were also observed for strains used for comparison (SA292 and S. aureus ATCC 25923). ..

Concentration Assay:

Article Title: In vitro antagonistic inhibitory effects of palm seed crude oils and their main constituent, lauric acid, with oxacillin in Staphylococcus aureus
Article Snippet: It induced an increase of MIC in MSSA ATCC 29213 strain up to more than two times. .. A slight increase of oxacillin MIC was also detected in ATCC 29213 strain at a concentration of 0.32 μg/mL of E. guineensis oil. ..

Activity Assay:

Article Title: Phenyl urea based adjuvants for β-lactam antibiotics against methicillin resistant Staphylococcus aureus.
Article Snippet: .. Oxacillin MIC (μg/mL) (fold reduction) Compound ATCC BAA-1556 AH-1263 OX 32 32 1 2 (16) 1 (32) 2 1 (32) 1 (32) 3 4 (8) 8 (4) 4 2 (16) 8 (4) 5 16 (2) 16 (2) 6 32 (-) 32 (-) 7 2 (16) 8 (4) 8 64 (-) 64 (-) 9 2 (16) 2 (16) 10 64 (-) 64 (-) 11 64 (-) 16 (2) 12 32 (-) 32 (-) 13 16 (2) 16 (2) 14 1 (32) 1 (32) 15 16 (2) 16 (2) 16 16 (2) 32 (-) 17 16 (2) 8 (4) 18 8 (4) 8 (4) Next, we expanded the first-generation library to study the impact that varying the identity of the amide head group (R1) has upon activity, by synthesizing compounds 19-28 (Scheme 1)). ..

Review