Review



16s rrna gene nucleotide sequence analysis  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    ATCC 16s rrna gene nucleotide sequence analysis
    16s Rrna Gene Nucleotide Sequence Analysis, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 6380 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nucleotide+sequence+analysis/16S/pm39731612-80-1-63
    Average 99 stars, based on 6380 article reviews
    16s rrna gene nucleotide sequence analysis - by Bioz Stars, 2026-11
    99/100 stars

    Images

    Related Articles

    Sequencing:

    Article Title: Complete Genome Sequence of Lacticaseibacillus rhamnosus DM065, Isolated from the Human Oral Cavity.
    Article Snippet: .. OrthoANI (11) analysis indicated Lacticaseibacillus rhamnosus ATCC 8530 (GenBank accession number CP003094.1) as the closest strain, with 99.87% sequence identity. ..

    Article Title: Arvimicrobium flavum gen. nov., sp. nov., A Novel Genus in the Family Phyllobacteriaceae Isolated From Forest Soil.
    Article Snippet: During the study of microbial diversity of forest soil in the Republic of Korea, a yellow pigment-producing, Gram-stain-negative, rod-shaped, motile bacterium was isolated and designated as strain 1W2T.. This strain grew at temperature of 10–37 °C, at pH of 5.0–9.0, and at NaCl concentration of 0–3.0% (w/v).. The 16S rRNA gene sequencing and genome sequencing revealed that strain 1W2T is a member of the family Phyllobacteriaceae but exhibits low similarity with known genera, suggesting that this strain is a new genus within the family.

    other:

    Article Title: Targeting SUMOylation in ovarian cancer: sensitivity, resistance, and the role of MYC
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Trypsin sequencing grade, modified Sigma Aldrich Cat# 11418025001 Tween-20 Sigma Aldrich Cat# P2287 Uracil Sigma Aldrich Cat# U1128 Vitamin B12 Sigma Aldrich Cat# V6629 Xanthine Sigma Aldrich Cat# X4002 ZM447439 (Aurora Bi) AstraZeneca/Tocris Cat# 2458 Critical commercial assays cobas® DNA Sample Preparation Kit Roche Cat#05985536190 TruSeq® DNA PCR-Free Kit Illumina Inc Cat#20015962 TruSeq® Stranded mRNA Illumina Inc Cat# 20020594 Stranded mRNA Prep Ligation kit Illumina Inc Cat# 20040532 RNeasy Plus Mini Kit Qiagen Cat# 74134 RNeasy Plus Micro Kit Qiagen Cat# 74004 SuperscriptTM III One-Step RT-PCR Platinum Taq HiFi Thermo Fisher Scientific Cat#12574035 Deposited data Code for analysis of RNA sequencing using MYC-resistant housekeeper genes (this study) Zenodo Zenodo DOI: https://doi.org/10.5281/ zenodo.15125928 RNA sequencing of ovarian cancer models (27 published previously) Nelson et al. 202052; Barnes et al. 202148; Coulson-Gilmer et al. 2021.50 EBML-EBI, European Nucleotide Archive EMBL-EBI: E-MTAB-7223; EMBL-EBI: E-MTAB-10801; EMBL-EBI: E-MTAB-11000 RNA sequencing of ovarian cancer models new to this study EBML-EBI, European Nucleotide Archive EMBL-EBI: E-MTAB-14568 RNA sequencing of MYC-Low and MYC-High cells (this study) EBML-EBI, European Nucleotide Archive EMBL-EBI: E-MTAB-14654 Experimental models: Cell lines AAV293T Agilent Technologies Cat# 240073 CAOV3 ATCC Cat# HTB-75; RRID: CVCL_0201 COV318 Sigma Aldrich Cat# 07071903; RRID: CVCL_2419 COV362 Sigma Aldrich Cat# 07071910; RRID: CVCL_2420 Kuramochi JCRB Cell Bank Cat# JCRB0098; RRID: CVCL_1345 NIHOVCAR3 ATCC Cat# HTB-161; RRID: CVCL_0465 OV56 Sigma Aldrich Cat# 96020759; RRID: CVCL_2673 OVISE JCRB Cell Bank Cat# JCRB1043; RRID: CVCL_3116 OVMANA JCRB Cell Bank Cat# JCRB1045; RRID: CVCL_3111 OVSAHO JCRB Cell Bank Cat# JCRB1046; RRID: CVCL_3114 RMG1 JCRB Cell Bank Cat# JCRB0172; RRID: CVCL_1662 RKO Flp-InTM T-RexTM Topham et al., 201539 N/A RKO Flp-InTM T-RexTM FC-MYC Littler et al., 201938 N/A Oligonucleotides siRNAs Horizon Discovery Tables S2 and S3 Primer: XhoI TP53 5′- CACCTCGAGGAGGA GCCGCAGTCAGATCCTA Invitrogen N/A Primer: NotI TP53 3′- CACGCGGCCGCTCACAGTCTG AGTCAGGCCCTTCTGTC Invitrogen N/A (Continued on next page) e3 iScience 28, 112555, June 20, 2025



    Similar Products

    nucleotide sequencing analysis  (Macrogen)
    86
    Macrogen nucleotide sequencing analysis
    Nucleotide Sequencing Analysis, supplied by Macrogen, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nucleotide+sequence+analysis/nucleotide+sequencing/10__63369_slash_ijat__2026__22__2__629___638-40-19-23
    Average 86 stars, based on 1 article reviews
    nucleotide sequencing analysis - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    ns5b nucleotide sequence analysis  (Janssen)
    86
    Janssen ns5b nucleotide sequence analysis
    Ns5b Nucleotide Sequence Analysis, supplied by Janssen, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nucleotide+sequence+analysis/analysis+ns5b+nucleotide+sequence/fda_document____drugsatfda_docs_slash_nda_slash_2013_slash_205123orig1s000micror-82-10-1
    Average 86 stars, based on 1 article reviews
    ns5b nucleotide sequence analysis - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    whole-genome re-sequencing and single-nucleotide variation and insertion-deletion analysis  (Novogene)
    90
    Novogene whole-genome re-sequencing and single-nucleotide variation and insertion-deletion analysis
    Whole Genome Re Sequencing And Single Nucleotide Variation And Insertion Deletion Analysis, supplied by Novogene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nucleotide+sequence+analysis/whole+genome+re+sequencing+and+single+nucleotide+variation+and+insertion+deletion+analyses/pmc12034805-492-20-11
    Average 90 stars, based on 1 article reviews
    whole-genome re-sequencing and single-nucleotide variation and insertion-deletion analysis - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    nucleotide sequence analysis  (Bioedit Company)
    90
    Bioedit Company nucleotide sequence analysis
    Nucleotide Sequence Analysis, supplied by Bioedit Company, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nucleotide+sequence+analysis/nucleotide+composition/10__1016_slash_j__aquaculture__2025__742620-91-1-10
    Average 90 stars, based on 1 article reviews
    nucleotide sequence analysis - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    case b pairwise nucleotide sequence identity analysis  (DNASTAR)
    99
    DNASTAR case b pairwise nucleotide sequence identity analysis
    Case B Pairwise Nucleotide Sequence Identity Analysis, supplied by DNASTAR, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nucleotide+sequence+analysis/MegAlign/pmc11757903-83-15-29
    Average 99 stars, based on 1 article reviews
    case b pairwise nucleotide sequence identity analysis - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    16s rrna gene nucleotide sequence analysis  (ATCC)
    99
    ATCC 16s rrna gene nucleotide sequence analysis
    16s Rrna Gene Nucleotide Sequence Analysis, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nucleotide+sequence+analysis/16S/pm39731612-80-1-63
    Average 99 stars, based on 1 article reviews
    16s rrna gene nucleotide sequence analysis - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    nucleotide sequence analysis  (Biotechnology Information)
    86
    Biotechnology Information nucleotide sequence analysis
    Nucleotide Sequence Analysis, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nucleotide+sequence+analysis/nucleotide+sequence/10__36077_slash_kjas_slash_2024_slash_v16i4__17584-130-4-26
    Average 86 stars, based on 1 article reviews
    nucleotide sequence analysis - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    nucleotide sequence homology comparison analysis  (DNASTAR)
    99
    DNASTAR nucleotide sequence homology comparison analysis
    CTLA4 gene bioinformatic analysis in goats: ( A ) <t>nucleotide</t> sequence homology analysis of CTLA4 gene; and ( B ) phylogenetic tree of CTLA4 gene in different animal species.
    Nucleotide Sequence Homology Comparison Analysis, supplied by DNASTAR, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nucleotide+sequence+analysis/MegAlign/pmc11506940-202-1-13
    Average 99 stars, based on 1 article reviews
    nucleotide sequence homology comparison analysis - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    nucleotide sequence analysis  (Cosmo Genetech Co)
    90
    Cosmo Genetech Co nucleotide sequence analysis
    CTLA4 gene bioinformatic analysis in goats: ( A ) <t>nucleotide</t> sequence homology analysis of CTLA4 gene; and ( B ) phylogenetic tree of CTLA4 gene in different animal species.
    Nucleotide Sequence Analysis, supplied by Cosmo Genetech Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nucleotide+sequence+analysis/nucleotide+sequencing+analyses/pm39336654-35-10-13
    Average 90 stars, based on 1 article reviews
    nucleotide sequence analysis - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    multiple nucleotide sequence alignments and analysis  (PrimerDesign Inc)
    90
    PrimerDesign Inc multiple nucleotide sequence alignments and analysis
    CTLA4 gene bioinformatic analysis in goats: ( A ) <t>nucleotide</t> sequence homology analysis of CTLA4 gene; and ( B ) phylogenetic tree of CTLA4 gene in different animal species.
    Multiple Nucleotide Sequence Alignments And Analysis, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nucleotide+sequence+analysis/dna+sequences/pmc11007384-88-2-0
    Average 90 stars, based on 1 article reviews
    multiple nucleotide sequence alignments and analysis - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    CTLA4 gene bioinformatic analysis in goats: ( A ) nucleotide sequence homology analysis of CTLA4 gene; and ( B ) phylogenetic tree of CTLA4 gene in different animal species.

    Journal: International Journal of Molecular Sciences

    Article Title: The Goat Cytotoxic T Lymphocyte-Associated Antigen-4 Gene: mRNA Expression and Association Analysis of Insertion/Deletion Variants with the Risk of Brucellosis

    doi: 10.3390/ijms252010948

    Figure Lengend Snippet: CTLA4 gene bioinformatic analysis in goats: ( A ) nucleotide sequence homology analysis of CTLA4 gene; and ( B ) phylogenetic tree of CTLA4 gene in different animal species.

    Article Snippet: A nucleotide sequence homology comparison analysis was conducted using MegAlign (version 7.1.0) ( https://www.dnastar.com/ ; accessed on 14 July 2024) [ ], the neighbor-joining method in MEGA (version 7.0.26) ( http://www.megasoftware.net/ ; accessed on 14 July 2024) was utilized to construct the evolutionary tree [ ], the bootstrap test was performed with a repetition rate of 1000-fold and a confidence interval of 95%, and other parameters were kept at their default values.

    Techniques: Sequencing