Review




Structured Review

Musashi Engineering Inc msi2
Msi2, supplied by Musashi Engineering Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/msi2/pm42265580-14-13-11?v=Musashi+Engineering+Inc
Average 86 stars, based on 1 article reviews
msi2 - by Bioz Stars, 2026-08
86/100 stars

Images



Similar Products

86
Musashi Engineering Inc msi2
Msi2, supplied by Musashi Engineering Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/msi2/pm42265580-14-13-11?v=Musashi+Engineering+Inc
Average 86 stars, based on 1 article reviews
msi2 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Twist Bioscience msi2 constructs
(A) Schematic of the tethering-based luciferase reporter assay using <t>λN-GFP-MSI2</t> fusion proteins and a bidirectional luciferase reporter. (B) Domain architecture of tethering constructs used in characterization assays. (C) NanoLuc/Firefly luciferase ratios following expression of the indicated tethering constructs in H295R cells (n = 6), normalized to λN-GFP control (red line). (D) Relative NanoLuc reporter mRNA expression measured by RT-qPCR (n = 3), normalized to λN-GFP control (red line). (E) Schematic of the Musashi binding element (MBE) luciferase reporter constructs targeted by endogenous <t>MSI2.</t> (F) NanoLuc/Firefly luciferase ratios from MBE reporter assays in MSI2 WT and MSI2 KD H295R cells (n = 6), normalized to MSI2 WT cells. Statistical significance was determined using Student’s t-test. *p < 0.05, **p < 0.01, ***p < 0.001.
Msi2 Constructs, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/msi2/bio_rxiv__64898__2026__05__16__725683-199-0-5?v=Twist+Bioscience
Average 86 stars, based on 1 article reviews
msi2 constructs - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

94
MedChemExpress msi2 inhibitor
pBL obtains a progenitor-like, BCR negative program and upregulates <t>MSI2:</t> A. Integration of pReLy (in color) with three pBL samples (in grey). B. BCR/TCR clonotype of pBL single cells. C. Proportion of Ig light chain usage (kappa, IGKC or lambda, IGLC) across pBL and pReLy samples. D. Phylogenetic analysis of Ig heavy chain CDR3 sequences for hyperexpanded BCR clones from pBL_01 and pBL-03, and a representative leading clone from pReLy_07. E . (Left) inferCNV subclustering results of pBLs using the 1 st or 2 nd CNVref as reference. (Right) UMAP distribution of CNV subclones eventually annotated as “Support” (in light green, defined as non-lymphoma cells from lymphoma samples) or “Burkitt” (in dark blue). F. Phylogenetic tree of Burkitt subclones based on CNV accumulation and SNV sharing. G. Key characteristics of CNV sublcones from E. (From top) BCR/TCR clonotype proportion, MYC expression, CNV score (dotted line indicates 0.31), over representation analysis using progenitor B/T marker gene sets, CNVref used, and eventual Burkitt/Support subclone annotation. H. (Top) Three manually curated cell clusters (LZGCB like, Proliferating, and BL dominate) and their composition. Dotplot shows top marker genes of each cell type across these clusters. I. Transcriptome difference between Burkitt cells with (BL BCR+ ) or without (BL BCR- ) functional BCR. J. Gene set enrichment analysis of ranked transcriptome comparing BL BCR- to BL BCR+ against DZGCB and Progenitor B gene sets. K. Venn diagram showing shared upregulated genes across overall Burkitt cells (BL), BL BCR+ and BL BCR- . Expression of top genes shared by BL and BL BCR- was shown as violin plot on the left. L. Representative flow cytometry histograms of <t>MSI2,</t> MYC, Ki67 and γH2AX expression for pReLy_07 and pBL_03.
Msi2 Inhibitor, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/msi2/bio_rxiv__64898__2026__04__21__719850-317-8-13?v=MedChemExpress
Average 94 stars, based on 1 article reviews
msi2 inhibitor - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

86
Genechem knockdown sh msi2
pBL obtains a progenitor-like, BCR negative program and upregulates <t>MSI2:</t> A. Integration of pReLy (in color) with three pBL samples (in grey). B. BCR/TCR clonotype of pBL single cells. C. Proportion of Ig light chain usage (kappa, IGKC or lambda, IGLC) across pBL and pReLy samples. D. Phylogenetic analysis of Ig heavy chain CDR3 sequences for hyperexpanded BCR clones from pBL_01 and pBL-03, and a representative leading clone from pReLy_07. E . (Left) inferCNV subclustering results of pBLs using the 1 st or 2 nd CNVref as reference. (Right) UMAP distribution of CNV subclones eventually annotated as “Support” (in light green, defined as non-lymphoma cells from lymphoma samples) or “Burkitt” (in dark blue). F. Phylogenetic tree of Burkitt subclones based on CNV accumulation and SNV sharing. G. Key characteristics of CNV sublcones from E. (From top) BCR/TCR clonotype proportion, MYC expression, CNV score (dotted line indicates 0.31), over representation analysis using progenitor B/T marker gene sets, CNVref used, and eventual Burkitt/Support subclone annotation. H. (Top) Three manually curated cell clusters (LZGCB like, Proliferating, and BL dominate) and their composition. Dotplot shows top marker genes of each cell type across these clusters. I. Transcriptome difference between Burkitt cells with (BL BCR+ ) or without (BL BCR- ) functional BCR. J. Gene set enrichment analysis of ranked transcriptome comparing BL BCR- to BL BCR+ against DZGCB and Progenitor B gene sets. K. Venn diagram showing shared upregulated genes across overall Burkitt cells (BL), BL BCR+ and BL BCR- . Expression of top genes shared by BL and BL BCR- was shown as violin plot on the left. L. Representative flow cytometry histograms of <t>MSI2,</t> MYC, Ki67 and γH2AX expression for pReLy_07 and pBL_03.
Knockdown Sh Msi2, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/msi2/pmc12930058-315-3-20?v=Genechem
Average 86 stars, based on 1 article reviews
knockdown sh msi2 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

93
Proteintech msi2
<t>MSI2</t> knockdown increased the BTB permeability through suppression of TJ-associated proteins expression. A and B, the expression and overall survival of MSI2 was predicted by GEPIA database. C and D, qRT - PCR and Western Blot assays demonstrated significantly elevated MSI2 mRNA and protein levels in GECs. GAPDH is used as a housekeeping gene in RT-qPCR experiments and as a loading control protein in Western blot assays. (IDVs, integrated densitometry values). Results were represented as mean ± SD (n = 3). ∗∗ p < 0.01 versus AECs group. E and F, the effect of MSI2 on BTB permeability was assessed through TEER measurements and HRP tracer flux. Results were represented as mean ± SD (n = 3). ∗ p < 0.05 and ∗∗ p < 0.01 versus MSI2(−)NC group, ## p < 0.01 versus MSI2(+)NC group. G and H, the expression levels of ZO-1, occludin, and claudin-5 upon MSI2 modulation were examined by qRT-PCR and Western blot assays, housekeeping gene both were GAPDH. Results were represented as mean ± SD (n = 3). ∗∗ p < 0.01 versus MSI2(−)NC group, ## p < 0.01 versus MSI2(+)NC group. I, IF staining was employed to examine MSI2-mediated regulation of ZO-1, occludin, and claudin-5 expression and subcellular localization in GECs. The scale bar represents 50 μm. AECs, astrocyte-co-cultured ECs; BTB, blood-tumor barrier; GEC, glioma co-cultured endothelial cell; MSI2, Musashi RNA-binding protein 2; TJ, tight junction; TEER, transendothelial electrical resistance; HRP, horseradish peroxidase; IF, Immunofluorescence.
Msi2, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/msi2/pmc12930058-313-9-13?v=Proteintech
Average 93 stars, based on 1 article reviews
msi2 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

Image Search Results


(A) Schematic of the tethering-based luciferase reporter assay using λN-GFP-MSI2 fusion proteins and a bidirectional luciferase reporter. (B) Domain architecture of tethering constructs used in characterization assays. (C) NanoLuc/Firefly luciferase ratios following expression of the indicated tethering constructs in H295R cells (n = 6), normalized to λN-GFP control (red line). (D) Relative NanoLuc reporter mRNA expression measured by RT-qPCR (n = 3), normalized to λN-GFP control (red line). (E) Schematic of the Musashi binding element (MBE) luciferase reporter constructs targeted by endogenous MSI2. (F) NanoLuc/Firefly luciferase ratios from MBE reporter assays in MSI2 WT and MSI2 KD H295R cells (n = 6), normalized to MSI2 WT cells. Statistical significance was determined using Student’s t-test. *p < 0.05, **p < 0.01, ***p < 0.001.

Journal: bioRxiv

Article Title: Isoform-Specific Localization Diversifies Human MSI2 Function

doi: 10.64898/2026.05.16.725683

Figure Lengend Snippet: (A) Schematic of the tethering-based luciferase reporter assay using λN-GFP-MSI2 fusion proteins and a bidirectional luciferase reporter. (B) Domain architecture of tethering constructs used in characterization assays. (C) NanoLuc/Firefly luciferase ratios following expression of the indicated tethering constructs in H295R cells (n = 6), normalized to λN-GFP control (red line). (D) Relative NanoLuc reporter mRNA expression measured by RT-qPCR (n = 3), normalized to λN-GFP control (red line). (E) Schematic of the Musashi binding element (MBE) luciferase reporter constructs targeted by endogenous MSI2. (F) NanoLuc/Firefly luciferase ratios from MBE reporter assays in MSI2 WT and MSI2 KD H295R cells (n = 6), normalized to MSI2 WT cells. Statistical significance was determined using Student’s t-test. *p < 0.05, **p < 0.01, ***p < 0.001.

Article Snippet: MSI2 constructs were ordered from Twist Biosciences Corporation with a 5’ flank sequence of CAGGTGTCGGTACCGCGGGCCCGGGATCCA and a 3’ flank sequence of CTGGCTCACAAATACCACTGAGATC for each construct.

Techniques: Luciferase, Reporter Assay, Construct, Expressing, Control, Quantitative RT-PCR, Binding Assay

(A) Schematic representation of MSI2-328 domains and their corresponding amino acid positions. (B,D) Schematics of MSI2 tethering constructs used in the reporter assays. (C,E) NanoLuc/Firefly luciferase ratios in H295R cells expressing the indicated tethering constructs (n = 6), normalized to λN-GFP control (red line). Statistical significance was determined using Student’s t-test relative to λN-GFP. (F) FLAG immunoprecipitation followed by western blot analysis of endogenous PABPC1 binding to FLAG-MSI2 constructs. FLAG-tagged proteins were immunoprecipitated and blots probed for PABPC1. Input samples (0.5%) are shown on the left and immunoprecipitated samples (50%) on the right. (G) NanoLuc/Firefly luciferase ratios in HEK293 cells following PABPC1 knockdown with two independent siRNAs (n = 4), normalized to λN-GFP control (red line). Statistical significance was determined using Student’s t-test relative to scramble siRNA controls for each construct. *p < 0.05, **p < 0.01, ***p < 0.001.

Journal: bioRxiv

Article Title: Isoform-Specific Localization Diversifies Human MSI2 Function

doi: 10.64898/2026.05.16.725683

Figure Lengend Snippet: (A) Schematic representation of MSI2-328 domains and their corresponding amino acid positions. (B,D) Schematics of MSI2 tethering constructs used in the reporter assays. (C,E) NanoLuc/Firefly luciferase ratios in H295R cells expressing the indicated tethering constructs (n = 6), normalized to λN-GFP control (red line). Statistical significance was determined using Student’s t-test relative to λN-GFP. (F) FLAG immunoprecipitation followed by western blot analysis of endogenous PABPC1 binding to FLAG-MSI2 constructs. FLAG-tagged proteins were immunoprecipitated and blots probed for PABPC1. Input samples (0.5%) are shown on the left and immunoprecipitated samples (50%) on the right. (G) NanoLuc/Firefly luciferase ratios in HEK293 cells following PABPC1 knockdown with two independent siRNAs (n = 4), normalized to λN-GFP control (red line). Statistical significance was determined using Student’s t-test relative to scramble siRNA controls for each construct. *p < 0.05, **p < 0.01, ***p < 0.001.

Article Snippet: MSI2 constructs were ordered from Twist Biosciences Corporation with a 5’ flank sequence of CAGGTGTCGGTACCGCGGGCCCGGGATCCA and a 3’ flank sequence of CTGGCTCACAAATACCACTGAGATC for each construct.

Techniques: Construct, Luciferase, Expressing, Control, Immunoprecipitation, Western Blot, Binding Assay, Knockdown

(A) Representative immunofluorescence images for endogenous MSI2 (green) and DAPI (blue) (scale bar, 10 μm). (B) - (C) Representative immunofluorescence images for GFP-tagged tethering MSI2-328 variants and mutants (green) and DAPI (blue), (scale bar, 10 μm).

Journal: bioRxiv

Article Title: Isoform-Specific Localization Diversifies Human MSI2 Function

doi: 10.64898/2026.05.16.725683

Figure Lengend Snippet: (A) Representative immunofluorescence images for endogenous MSI2 (green) and DAPI (blue) (scale bar, 10 μm). (B) - (C) Representative immunofluorescence images for GFP-tagged tethering MSI2-328 variants and mutants (green) and DAPI (blue), (scale bar, 10 μm).

Article Snippet: MSI2 constructs were ordered from Twist Biosciences Corporation with a 5’ flank sequence of CAGGTGTCGGTACCGCGGGCCCGGGATCCA and a 3’ flank sequence of CTGGCTCACAAATACCACTGAGATC for each construct.

Techniques: Immunofluorescence

(A) Schematic representation of MSI2 splice isoforms (MSI2-328 and MSI2-324) with their corresponding Ensembl transcript IDs and amino acid (aa) length. Exons are represented as black boxes, while isoform specific regions are highlighted in blue. (B,E) NanoLuc/Firefly luciferase ratios in H295R cells expressing the indicated tethering constructs, normalized to λN-GFP control. (C) Relative NanoLuc reporter mRNA expression measured by RT-qPCR and normalized to λN-GFP control. (D) Schematic representation of MSI2-324 constructs used for functional assays. Statistical significance was determined using Student’s t-test relative to λN-GFP control. *p < 0.05, **p < 0.01, ***p < 0.001. (F) - (G) Representative immunofluorescence images for GFP-tagged MSI2-324 variants and mutants (green) and DAPI (blue) (scale bar 10 μm).

Journal: bioRxiv

Article Title: Isoform-Specific Localization Diversifies Human MSI2 Function

doi: 10.64898/2026.05.16.725683

Figure Lengend Snippet: (A) Schematic representation of MSI2 splice isoforms (MSI2-328 and MSI2-324) with their corresponding Ensembl transcript IDs and amino acid (aa) length. Exons are represented as black boxes, while isoform specific regions are highlighted in blue. (B,E) NanoLuc/Firefly luciferase ratios in H295R cells expressing the indicated tethering constructs, normalized to λN-GFP control. (C) Relative NanoLuc reporter mRNA expression measured by RT-qPCR and normalized to λN-GFP control. (D) Schematic representation of MSI2-324 constructs used for functional assays. Statistical significance was determined using Student’s t-test relative to λN-GFP control. *p < 0.05, **p < 0.01, ***p < 0.001. (F) - (G) Representative immunofluorescence images for GFP-tagged MSI2-324 variants and mutants (green) and DAPI (blue) (scale bar 10 μm).

Article Snippet: MSI2 constructs were ordered from Twist Biosciences Corporation with a 5’ flank sequence of CAGGTGTCGGTACCGCGGGCCCGGGATCCA and a 3’ flank sequence of CTGGCTCACAAATACCACTGAGATC for each construct.

Techniques: Luciferase, Expressing, Construct, Control, Quantitative RT-PCR, Functional Assay, Immunofluorescence

(A) Heatmap of row-scaled z-scores of averaged protein intensities from EGFP, FLAG-MSI2-324, and FLAG-MSI2-328 immunoprecipitation mass spectrometry datasets clustered using k-means analysis. (B,C) Overrepresentation analysis of proteins enriched within MSI2-328 or MSI2-324 clusters identified in (A), showing significantly enriched Reactome pathways. (D) Volcano plot comparing protein enrichment between FLAG-MSI2-324 and FLAG-MSI2-328 immunoprecipitations. Significance thresholds were set at p < 0.05 and |log2FC| > 1. Translation-associated proteins enriched with MSI2-328 are highlighted in blue, while chromatin-and nuclear-associated proteins enriched with MSI2-324 are highlighted in orange. (E) Barplot of the number of MSI2 CLIP-seq peaks annotated to different transcript regions. (F) Scatter plot comparing enrichment of 6mers in MSI2 CLIP-seq peaks versus background regions for intronic binding sites (y-axis) and 3’ UTR binding sites (x-axis). The 6mers in red were enriched at least 4-fold in either intronic or 3’ UTR binding sites.

Journal: bioRxiv

Article Title: Isoform-Specific Localization Diversifies Human MSI2 Function

doi: 10.64898/2026.05.16.725683

Figure Lengend Snippet: (A) Heatmap of row-scaled z-scores of averaged protein intensities from EGFP, FLAG-MSI2-324, and FLAG-MSI2-328 immunoprecipitation mass spectrometry datasets clustered using k-means analysis. (B,C) Overrepresentation analysis of proteins enriched within MSI2-328 or MSI2-324 clusters identified in (A), showing significantly enriched Reactome pathways. (D) Volcano plot comparing protein enrichment between FLAG-MSI2-324 and FLAG-MSI2-328 immunoprecipitations. Significance thresholds were set at p < 0.05 and |log2FC| > 1. Translation-associated proteins enriched with MSI2-328 are highlighted in blue, while chromatin-and nuclear-associated proteins enriched with MSI2-324 are highlighted in orange. (E) Barplot of the number of MSI2 CLIP-seq peaks annotated to different transcript regions. (F) Scatter plot comparing enrichment of 6mers in MSI2 CLIP-seq peaks versus background regions for intronic binding sites (y-axis) and 3’ UTR binding sites (x-axis). The 6mers in red were enriched at least 4-fold in either intronic or 3’ UTR binding sites.

Article Snippet: MSI2 constructs were ordered from Twist Biosciences Corporation with a 5’ flank sequence of CAGGTGTCGGTACCGCGGGCCCGGGATCCA and a 3’ flank sequence of CTGGCTCACAAATACCACTGAGATC for each construct.

Techniques: Immunoprecipitation, Mass Spectrometry, Protein Enrichment, Binding Assay

(A) Western blot analysis of endogenous MSI2 protein expression across the indicated human cell lines. (B,C) NanoLuc/Firefly luciferase ratios from tethering assays performed in the indicated cell lines using MSI2 isoforms and mutant constructs. Reporter activity was normalized to λN-GFP control. Statistical significance was determined using Student’s t-test. *p < 0.05, **p < 0.01, ***p < 0.001. (D) Stacked bar plot showing the median fraction of splice junction usage from the shared MSI2 exon 11 donor across GTEx tissue types. (E) Boxplots showing percent splice isoform values for the MSI2 exon 11 alternative acceptor event across TCGA cancer cohorts. Each point represents an individual tumor sample. Center lines indicate medians, boxes represent the interquartile range, and whiskers extend to 1.5X the interquartile range.

Journal: bioRxiv

Article Title: Isoform-Specific Localization Diversifies Human MSI2 Function

doi: 10.64898/2026.05.16.725683

Figure Lengend Snippet: (A) Western blot analysis of endogenous MSI2 protein expression across the indicated human cell lines. (B,C) NanoLuc/Firefly luciferase ratios from tethering assays performed in the indicated cell lines using MSI2 isoforms and mutant constructs. Reporter activity was normalized to λN-GFP control. Statistical significance was determined using Student’s t-test. *p < 0.05, **p < 0.01, ***p < 0.001. (D) Stacked bar plot showing the median fraction of splice junction usage from the shared MSI2 exon 11 donor across GTEx tissue types. (E) Boxplots showing percent splice isoform values for the MSI2 exon 11 alternative acceptor event across TCGA cancer cohorts. Each point represents an individual tumor sample. Center lines indicate medians, boxes represent the interquartile range, and whiskers extend to 1.5X the interquartile range.

Article Snippet: MSI2 constructs were ordered from Twist Biosciences Corporation with a 5’ flank sequence of CAGGTGTCGGTACCGCGGGCCCGGGATCCA and a 3’ flank sequence of CTGGCTCACAAATACCACTGAGATC for each construct.

Techniques: Western Blot, Expressing, Luciferase, Mutagenesis, Construct, Activity Assay, Control

pBL obtains a progenitor-like, BCR negative program and upregulates MSI2: A. Integration of pReLy (in color) with three pBL samples (in grey). B. BCR/TCR clonotype of pBL single cells. C. Proportion of Ig light chain usage (kappa, IGKC or lambda, IGLC) across pBL and pReLy samples. D. Phylogenetic analysis of Ig heavy chain CDR3 sequences for hyperexpanded BCR clones from pBL_01 and pBL-03, and a representative leading clone from pReLy_07. E . (Left) inferCNV subclustering results of pBLs using the 1 st or 2 nd CNVref as reference. (Right) UMAP distribution of CNV subclones eventually annotated as “Support” (in light green, defined as non-lymphoma cells from lymphoma samples) or “Burkitt” (in dark blue). F. Phylogenetic tree of Burkitt subclones based on CNV accumulation and SNV sharing. G. Key characteristics of CNV sublcones from E. (From top) BCR/TCR clonotype proportion, MYC expression, CNV score (dotted line indicates 0.31), over representation analysis using progenitor B/T marker gene sets, CNVref used, and eventual Burkitt/Support subclone annotation. H. (Top) Three manually curated cell clusters (LZGCB like, Proliferating, and BL dominate) and their composition. Dotplot shows top marker genes of each cell type across these clusters. I. Transcriptome difference between Burkitt cells with (BL BCR+ ) or without (BL BCR- ) functional BCR. J. Gene set enrichment analysis of ranked transcriptome comparing BL BCR- to BL BCR+ against DZGCB and Progenitor B gene sets. K. Venn diagram showing shared upregulated genes across overall Burkitt cells (BL), BL BCR+ and BL BCR- . Expression of top genes shared by BL and BL BCR- was shown as violin plot on the left. L. Representative flow cytometry histograms of MSI2, MYC, Ki67 and γH2AX expression for pReLy_07 and pBL_03.

Journal: bioRxiv

Article Title: Single cell analysis reveals molecular traits of pediatric lymphoma resistant subclones

doi: 10.64898/2026.04.21.719850

Figure Lengend Snippet: pBL obtains a progenitor-like, BCR negative program and upregulates MSI2: A. Integration of pReLy (in color) with three pBL samples (in grey). B. BCR/TCR clonotype of pBL single cells. C. Proportion of Ig light chain usage (kappa, IGKC or lambda, IGLC) across pBL and pReLy samples. D. Phylogenetic analysis of Ig heavy chain CDR3 sequences for hyperexpanded BCR clones from pBL_01 and pBL-03, and a representative leading clone from pReLy_07. E . (Left) inferCNV subclustering results of pBLs using the 1 st or 2 nd CNVref as reference. (Right) UMAP distribution of CNV subclones eventually annotated as “Support” (in light green, defined as non-lymphoma cells from lymphoma samples) or “Burkitt” (in dark blue). F. Phylogenetic tree of Burkitt subclones based on CNV accumulation and SNV sharing. G. Key characteristics of CNV sublcones from E. (From top) BCR/TCR clonotype proportion, MYC expression, CNV score (dotted line indicates 0.31), over representation analysis using progenitor B/T marker gene sets, CNVref used, and eventual Burkitt/Support subclone annotation. H. (Top) Three manually curated cell clusters (LZGCB like, Proliferating, and BL dominate) and their composition. Dotplot shows top marker genes of each cell type across these clusters. I. Transcriptome difference between Burkitt cells with (BL BCR+ ) or without (BL BCR- ) functional BCR. J. Gene set enrichment analysis of ranked transcriptome comparing BL BCR- to BL BCR+ against DZGCB and Progenitor B gene sets. K. Venn diagram showing shared upregulated genes across overall Burkitt cells (BL), BL BCR+ and BL BCR- . Expression of top genes shared by BL and BL BCR- was shown as violin plot on the left. L. Representative flow cytometry histograms of MSI2, MYC, Ki67 and γH2AX expression for pReLy_07 and pBL_03.

Article Snippet: Starting from day 10, 10 mg/Kg mouse of MSI2 inhibitor (Ro 08-2750; #HY-108466, MedChemExpress) or DMSO control were injected intratumorally every two days.

Techniques: Clone Assay, Expressing, Marker, Functional Assay, Flow Cytometry

Identification of progenitor-like, TCR negative pTLBL compartment: A. Integration of pReLy (in color) with pTLBL samples (in grey). B. BCR/TCR clonotype of pTLBL single cells C . (Left) inferCNV subclustering results of pTLBLs using the 1 st or 2 nd CNVref as reference. (Right) UMAP distribution of CNV subclones eventually annotated as “Support” (in light green) or “TLBL” (in orange red). D. Key characteristics of CNV sublcones from C. (From top) BCR/TCR clonotype proportion, CNV score (dotted line indicates 0.19), over representation analysis using progenitor B/T marker gene sets, CNVref used, and eventual TLBL/Support subclone annotation. E. Phylogenetic tree of pTLBL subclones based on CNV accumulation and SNV sharing F. Contour plot of TCR status (TCR_pos, Pre_TCR and TCR_neg) distribution of pTLBL single cells and their composition of manually curated cell clusters (Proliferating, TLBL_niche and Prog_like). G. Top marker genes of pTLBL (by TCR status), Support and Reactive cells across manually curated cell clusters in F . H. MSI2 expression across all cell compartments. I. Enrichment analysis of bone marrow progenitor-like cells (BMP) related to TLBL TCR- and TLBL TCR+ cells. J. (left) Cancer type composition of all lymphoid origin cell lines on the Dependency Map (DepMap 2025 Q2). Cell lines annotated as precursor BALL and TALL (based on Expasy Cellosaurus) shown in colors. (right) MSI2 expression and dependency score by precursor status. K. Survival curve of closely related T cell lymphoma types by MSI2 expression level.

Journal: bioRxiv

Article Title: Single cell analysis reveals molecular traits of pediatric lymphoma resistant subclones

doi: 10.64898/2026.04.21.719850

Figure Lengend Snippet: Identification of progenitor-like, TCR negative pTLBL compartment: A. Integration of pReLy (in color) with pTLBL samples (in grey). B. BCR/TCR clonotype of pTLBL single cells C . (Left) inferCNV subclustering results of pTLBLs using the 1 st or 2 nd CNVref as reference. (Right) UMAP distribution of CNV subclones eventually annotated as “Support” (in light green) or “TLBL” (in orange red). D. Key characteristics of CNV sublcones from C. (From top) BCR/TCR clonotype proportion, CNV score (dotted line indicates 0.19), over representation analysis using progenitor B/T marker gene sets, CNVref used, and eventual TLBL/Support subclone annotation. E. Phylogenetic tree of pTLBL subclones based on CNV accumulation and SNV sharing F. Contour plot of TCR status (TCR_pos, Pre_TCR and TCR_neg) distribution of pTLBL single cells and their composition of manually curated cell clusters (Proliferating, TLBL_niche and Prog_like). G. Top marker genes of pTLBL (by TCR status), Support and Reactive cells across manually curated cell clusters in F . H. MSI2 expression across all cell compartments. I. Enrichment analysis of bone marrow progenitor-like cells (BMP) related to TLBL TCR- and TLBL TCR+ cells. J. (left) Cancer type composition of all lymphoid origin cell lines on the Dependency Map (DepMap 2025 Q2). Cell lines annotated as precursor BALL and TALL (based on Expasy Cellosaurus) shown in colors. (right) MSI2 expression and dependency score by precursor status. K. Survival curve of closely related T cell lymphoma types by MSI2 expression level.

Article Snippet: Starting from day 10, 10 mg/Kg mouse of MSI2 inhibitor (Ro 08-2750; #HY-108466, MedChemExpress) or DMSO control were injected intratumorally every two days.

Techniques: Marker, Expressing

Progenitor-like lymphoma cells are potentially chemoresistance: A. Integration of all cancerous pBL single cells. BCR status shown in color. B. Expression level of genes involved/targeted by R-CHOP regiment (killing) or related to chemoresistance (resist) in cancerous pBL single cells samples. C. Integration of all cancerous pTLBL single cells. TCR status shown in color. D. Expression level of genes involved/targeted by CHOP regiment (killing) or related to chemoresistance (resist) in cancerous pTLBL samples. E. (Left) expression correlation between TUBB and other genes in pBL. Top positive (in blue) and negative (in red) correlated genes were highlighted together with MSI2 . (Right) top enriched terms (gene ontology biological process, GOBP; WikiPathway, WikiPath) for top 300 genes negatively correlated with TUBB expression. F. Highlighted gene expression negatively correlated with TUBB . G. Same as E. but for pTLBL. H. Same as in F. but referred to pTLBL cancerous cells. I. Apoptosis assay for Raji, SUP-T1 and Jurkat cell lines upon MSI2 inhibitor treatment. Cells were incubated for 48h at designated concentrations. J. Schematics of NSG xenograft model utilizing Raji cell line. MSI2 inhibitor was administered intratumorally every 2 days starting from day 10. Experiment end point is represented by tumour reaching 1cm3. K. Tumor volume evaluated at each time point. Statistical analysis performed utilizing 2 way Anova - Šídák’s multiple comparisons test (untill D24). L. Percentage of survival with and without MSI2 inhibitor treatment referred to J. , curve comparison analyzed with Logrank (Mantel-Cox) test.

Journal: bioRxiv

Article Title: Single cell analysis reveals molecular traits of pediatric lymphoma resistant subclones

doi: 10.64898/2026.04.21.719850

Figure Lengend Snippet: Progenitor-like lymphoma cells are potentially chemoresistance: A. Integration of all cancerous pBL single cells. BCR status shown in color. B. Expression level of genes involved/targeted by R-CHOP regiment (killing) or related to chemoresistance (resist) in cancerous pBL single cells samples. C. Integration of all cancerous pTLBL single cells. TCR status shown in color. D. Expression level of genes involved/targeted by CHOP regiment (killing) or related to chemoresistance (resist) in cancerous pTLBL samples. E. (Left) expression correlation between TUBB and other genes in pBL. Top positive (in blue) and negative (in red) correlated genes were highlighted together with MSI2 . (Right) top enriched terms (gene ontology biological process, GOBP; WikiPathway, WikiPath) for top 300 genes negatively correlated with TUBB expression. F. Highlighted gene expression negatively correlated with TUBB . G. Same as E. but for pTLBL. H. Same as in F. but referred to pTLBL cancerous cells. I. Apoptosis assay for Raji, SUP-T1 and Jurkat cell lines upon MSI2 inhibitor treatment. Cells were incubated for 48h at designated concentrations. J. Schematics of NSG xenograft model utilizing Raji cell line. MSI2 inhibitor was administered intratumorally every 2 days starting from day 10. Experiment end point is represented by tumour reaching 1cm3. K. Tumor volume evaluated at each time point. Statistical analysis performed utilizing 2 way Anova - Šídák’s multiple comparisons test (untill D24). L. Percentage of survival with and without MSI2 inhibitor treatment referred to J. , curve comparison analyzed with Logrank (Mantel-Cox) test.

Article Snippet: Starting from day 10, 10 mg/Kg mouse of MSI2 inhibitor (Ro 08-2750; #HY-108466, MedChemExpress) or DMSO control were injected intratumorally every two days.

Techniques: Expressing, Gene Expression, Apoptosis Assay, Incubation, Comparison

MSI2 knockdown increased the BTB permeability through suppression of TJ-associated proteins expression. A and B, the expression and overall survival of MSI2 was predicted by GEPIA database. C and D, qRT - PCR and Western Blot assays demonstrated significantly elevated MSI2 mRNA and protein levels in GECs. GAPDH is used as a housekeeping gene in RT-qPCR experiments and as a loading control protein in Western blot assays. (IDVs, integrated densitometry values). Results were represented as mean ± SD (n = 3). ∗∗ p < 0.01 versus AECs group. E and F, the effect of MSI2 on BTB permeability was assessed through TEER measurements and HRP tracer flux. Results were represented as mean ± SD (n = 3). ∗ p < 0.05 and ∗∗ p < 0.01 versus MSI2(−)NC group, ## p < 0.01 versus MSI2(+)NC group. G and H, the expression levels of ZO-1, occludin, and claudin-5 upon MSI2 modulation were examined by qRT-PCR and Western blot assays, housekeeping gene both were GAPDH. Results were represented as mean ± SD (n = 3). ∗∗ p < 0.01 versus MSI2(−)NC group, ## p < 0.01 versus MSI2(+)NC group. I, IF staining was employed to examine MSI2-mediated regulation of ZO-1, occludin, and claudin-5 expression and subcellular localization in GECs. The scale bar represents 50 μm. AECs, astrocyte-co-cultured ECs; BTB, blood-tumor barrier; GEC, glioma co-cultured endothelial cell; MSI2, Musashi RNA-binding protein 2; TJ, tight junction; TEER, transendothelial electrical resistance; HRP, horseradish peroxidase; IF, Immunofluorescence.

Journal: The Journal of Biological Chemistry

Article Title: The RNA-binding protein MSI2 controls blood-tumor barrier permeability via LINC00667-Mediated IRF6 mRNA decay

doi: 10.1016/j.jbc.2026.111208

Figure Lengend Snippet: MSI2 knockdown increased the BTB permeability through suppression of TJ-associated proteins expression. A and B, the expression and overall survival of MSI2 was predicted by GEPIA database. C and D, qRT - PCR and Western Blot assays demonstrated significantly elevated MSI2 mRNA and protein levels in GECs. GAPDH is used as a housekeeping gene in RT-qPCR experiments and as a loading control protein in Western blot assays. (IDVs, integrated densitometry values). Results were represented as mean ± SD (n = 3). ∗∗ p < 0.01 versus AECs group. E and F, the effect of MSI2 on BTB permeability was assessed through TEER measurements and HRP tracer flux. Results were represented as mean ± SD (n = 3). ∗ p < 0.05 and ∗∗ p < 0.01 versus MSI2(−)NC group, ## p < 0.01 versus MSI2(+)NC group. G and H, the expression levels of ZO-1, occludin, and claudin-5 upon MSI2 modulation were examined by qRT-PCR and Western blot assays, housekeeping gene both were GAPDH. Results were represented as mean ± SD (n = 3). ∗∗ p < 0.01 versus MSI2(−)NC group, ## p < 0.01 versus MSI2(+)NC group. I, IF staining was employed to examine MSI2-mediated regulation of ZO-1, occludin, and claudin-5 expression and subcellular localization in GECs. The scale bar represents 50 μm. AECs, astrocyte-co-cultured ECs; BTB, blood-tumor barrier; GEC, glioma co-cultured endothelial cell; MSI2, Musashi RNA-binding protein 2; TJ, tight junction; TEER, transendothelial electrical resistance; HRP, horseradish peroxidase; IF, Immunofluorescence.

Article Snippet: The dilutions for other primary antibodies were as follows: MSI2 (1:2000 dilution, 10770-1-AP, Proteintech), IRF6 (1:2000, A3209, ABclonal), STAU1 (1:2000, 14225-1-AP, Proteintech), GAPDH (1:10,000, 60,004-1-lg, Proteintech).

Techniques: Knockdown, Permeability, Expressing, Quantitative RT-PCR, Western Blot, Control, Staining, Cell Culture, RNA Binding Assay, Immunofluorescence

MSI2 bound and stabilized the expression of LINC00667. A, the interaction between MSI2 and LINC00667 was analyzed by RIP, with LINC00667 enrichment quantified by qRT-PCR. Results were represented as mean ± SD (n = 3). ∗∗ p < 0.01 versus anti-IgG group. B, the presence of MSI2 and GAPDH in LINC00667-containing ribonucleoprotein complexes, purified via RNA pull-down assay, was verified by Western blot. C, the influence of MSI2 on LINC00667 expression levels in GECs was evaluated by qRT-PCR assay, housekeeping gene was GAPDH. Data were represented as mean ± SD (n = 3). ∗∗ p < 0.01 versus MSI2(−)NC group, ## p < 0.01 versus MSI2(+)NC group. D, LINC00667 mRNA stability in GECs following MSI2 knockdown was evaluated using actinomycin D-mediated transcriptional inhibition assay. Data were represented as mean ± SD (n = 3). E, nascent RNA capture assay was employed to assess MSI2 knockdown effects on newly synthesized LINC00667 transcripts in GECs. GEC, glioma co-cultured endothelial cell; MSI2, Musashi RNA-binding protein 2; LINC00667, long intergenic nonprotein coding RNA 667; IF, Immunofluorescence.

Journal: The Journal of Biological Chemistry

Article Title: The RNA-binding protein MSI2 controls blood-tumor barrier permeability via LINC00667-Mediated IRF6 mRNA decay

doi: 10.1016/j.jbc.2026.111208

Figure Lengend Snippet: MSI2 bound and stabilized the expression of LINC00667. A, the interaction between MSI2 and LINC00667 was analyzed by RIP, with LINC00667 enrichment quantified by qRT-PCR. Results were represented as mean ± SD (n = 3). ∗∗ p < 0.01 versus anti-IgG group. B, the presence of MSI2 and GAPDH in LINC00667-containing ribonucleoprotein complexes, purified via RNA pull-down assay, was verified by Western blot. C, the influence of MSI2 on LINC00667 expression levels in GECs was evaluated by qRT-PCR assay, housekeeping gene was GAPDH. Data were represented as mean ± SD (n = 3). ∗∗ p < 0.01 versus MSI2(−)NC group, ## p < 0.01 versus MSI2(+)NC group. D, LINC00667 mRNA stability in GECs following MSI2 knockdown was evaluated using actinomycin D-mediated transcriptional inhibition assay. Data were represented as mean ± SD (n = 3). E, nascent RNA capture assay was employed to assess MSI2 knockdown effects on newly synthesized LINC00667 transcripts in GECs. GEC, glioma co-cultured endothelial cell; MSI2, Musashi RNA-binding protein 2; LINC00667, long intergenic nonprotein coding RNA 667; IF, Immunofluorescence.

Article Snippet: The dilutions for other primary antibodies were as follows: MSI2 (1:2000 dilution, 10770-1-AP, Proteintech), IRF6 (1:2000, A3209, ABclonal), STAU1 (1:2000, 14225-1-AP, Proteintech), GAPDH (1:10,000, 60,004-1-lg, Proteintech).

Techniques: Expressing, Quantitative RT-PCR, Purification, Pull Down Assay, Western Blot, Knockdown, Inhibition, Synthesized, Cell Culture, RNA Binding Assay, Immunofluorescence

MSI2 knockdown enhanced BTB permeability by reducing LINC00667 stability. A and B, the impact of LINC00667 over-expression on BTB permeability was assessed through TEER measurements and HRP tracer flux in MSI2-knockdown cells. Data were represented as mean ± SD (n = 3). ∗ p < 0.05 and ∗∗ p < 0.01 versus MSI2(−)NC + LINC00667(+)NC group, # p < 0.05 and ## p < 0.01 versus MSI2(−) + LINC00667(+)NC group. C and D, the impact of LINC00667 over-expression on TJ-associated proteins expression was analyzed through qRT-PCR and Western blot assays in MSI2-knockdown cells, housekeeping gene both were GAPDH. Data were represented as mean ± SD (n = 3). ∗∗ p < 0.01 versus MSI2(−)NC + LINC00667(+)NC group, ## p < 0.01 versus MSI2(−) + LINC00667(+)NC group. E, IF assay was conducted to evaluate changes in the expression and subcellular localization of TJ-associated proteins resulting from LINC00667 over-expression in MSI2-knockdown cells. The scale bar represents 50 μm. BTB, blood-tumor barrier; MSI2, Musashi RNA-binding protein 2; LINC00667, long intergenic nonprotein coding RNA 667; TJ, tight junction; TEER, transendothelial electrical resistance; HRP, horseradish peroxidase.

Journal: The Journal of Biological Chemistry

Article Title: The RNA-binding protein MSI2 controls blood-tumor barrier permeability via LINC00667-Mediated IRF6 mRNA decay

doi: 10.1016/j.jbc.2026.111208

Figure Lengend Snippet: MSI2 knockdown enhanced BTB permeability by reducing LINC00667 stability. A and B, the impact of LINC00667 over-expression on BTB permeability was assessed through TEER measurements and HRP tracer flux in MSI2-knockdown cells. Data were represented as mean ± SD (n = 3). ∗ p < 0.05 and ∗∗ p < 0.01 versus MSI2(−)NC + LINC00667(+)NC group, # p < 0.05 and ## p < 0.01 versus MSI2(−) + LINC00667(+)NC group. C and D, the impact of LINC00667 over-expression on TJ-associated proteins expression was analyzed through qRT-PCR and Western blot assays in MSI2-knockdown cells, housekeeping gene both were GAPDH. Data were represented as mean ± SD (n = 3). ∗∗ p < 0.01 versus MSI2(−)NC + LINC00667(+)NC group, ## p < 0.01 versus MSI2(−) + LINC00667(+)NC group. E, IF assay was conducted to evaluate changes in the expression and subcellular localization of TJ-associated proteins resulting from LINC00667 over-expression in MSI2-knockdown cells. The scale bar represents 50 μm. BTB, blood-tumor barrier; MSI2, Musashi RNA-binding protein 2; LINC00667, long intergenic nonprotein coding RNA 667; TJ, tight junction; TEER, transendothelial electrical resistance; HRP, horseradish peroxidase.

Article Snippet: The dilutions for other primary antibodies were as follows: MSI2 (1:2000 dilution, 10770-1-AP, Proteintech), IRF6 (1:2000, A3209, ABclonal), STAU1 (1:2000, 14225-1-AP, Proteintech), GAPDH (1:10,000, 60,004-1-lg, Proteintech).

Techniques: Knockdown, Permeability, Over Expression, Expressing, Quantitative RT-PCR, Western Blot, RNA Binding Assay

The individual or combined application of MSI2 knockdown, LINC00667 knockdown, and IRF6 over-expression promoted Dox penetration through the BTB, subsequently inducing glioblastoma cell apoptosis. A, dox penetration through the BTB model in vitro was quantified by spectrophotometer. Data were represented as mean ± SD (n = 3, each).∗ p < 0.05 and ∗∗ p < 0.01 versus NC group. B, the percentage of apoptotic U251 cells was measured using flow cytometry. Data were represented as mean ± SD (n = 3). ∗ p < 0.05 and ∗∗ p < 0.01 versus Control group, ## p < 0.01 versus Dox group, αα P < 0.01 versus Dox + MSI2(−), ββ P < 0.01 versus Dox + LINC00667(−), ℇℇ P < 0.01 versus Dox + IRF6(+). Q1-lower left: Annexin V-/PI-, Q1-lower right: Annexin V+/PI-, Q1-upper right: Annexin V+/PI+, Q1-UL: Annexin V-/PI+. Apoptotic cell (%) = Q1-lower right + Q1-uper right. C, working model illustrating the proposed mechanism by which the MSI2/LINC00667/IRF6 signaling cascade regulates BTB integrity through the Staufen1-mediated mRNA decay pathway. BTB, blood-tumor barrier; MSI2, Musashi RNA-binding protein 2; LINC00667, long intergenic nonprotein coding RNA 667; IRF6, interferon regulatory factor 6; Dox, doxorubicin

Journal: The Journal of Biological Chemistry

Article Title: The RNA-binding protein MSI2 controls blood-tumor barrier permeability via LINC00667-Mediated IRF6 mRNA decay

doi: 10.1016/j.jbc.2026.111208

Figure Lengend Snippet: The individual or combined application of MSI2 knockdown, LINC00667 knockdown, and IRF6 over-expression promoted Dox penetration through the BTB, subsequently inducing glioblastoma cell apoptosis. A, dox penetration through the BTB model in vitro was quantified by spectrophotometer. Data were represented as mean ± SD (n = 3, each).∗ p < 0.05 and ∗∗ p < 0.01 versus NC group. B, the percentage of apoptotic U251 cells was measured using flow cytometry. Data were represented as mean ± SD (n = 3). ∗ p < 0.05 and ∗∗ p < 0.01 versus Control group, ## p < 0.01 versus Dox group, αα P < 0.01 versus Dox + MSI2(−), ββ P < 0.01 versus Dox + LINC00667(−), ℇℇ P < 0.01 versus Dox + IRF6(+). Q1-lower left: Annexin V-/PI-, Q1-lower right: Annexin V+/PI-, Q1-upper right: Annexin V+/PI+, Q1-UL: Annexin V-/PI+. Apoptotic cell (%) = Q1-lower right + Q1-uper right. C, working model illustrating the proposed mechanism by which the MSI2/LINC00667/IRF6 signaling cascade regulates BTB integrity through the Staufen1-mediated mRNA decay pathway. BTB, blood-tumor barrier; MSI2, Musashi RNA-binding protein 2; LINC00667, long intergenic nonprotein coding RNA 667; IRF6, interferon regulatory factor 6; Dox, doxorubicin

Article Snippet: The dilutions for other primary antibodies were as follows: MSI2 (1:2000 dilution, 10770-1-AP, Proteintech), IRF6 (1:2000, A3209, ABclonal), STAU1 (1:2000, 14225-1-AP, Proteintech), GAPDH (1:10,000, 60,004-1-lg, Proteintech).

Techniques: Knockdown, Over Expression, In Vitro, Spectrophotometry, Flow Cytometry, Control, RNA Binding Assay