Review



large ifc plate fluidigm 100 5761  (fluidigm)


Bioz Verified Symbol fluidigm is a verified supplier
Bioz Manufacturer Symbol fluidigm manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    fluidigm large ifc plate fluidigm 100 5761
    Large Ifc Plate Fluidigm 100 5761, supplied by fluidigm, used in various techniques. Bioz Stars score: 92/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mrna+seq+fluidigm/C1+Single-Cell+mRNA+Seq+IFC/pmc12004274-158-44-47
    Average 92 stars, based on 10 article reviews
    large ifc plate fluidigm 100 5761 - by Bioz Stars, 2026-09
    92/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: Thrombopoietin Metabolically Primes Hematopoietic Stem Cells to Megakaryocyte-Lineage Differentiation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD16/32 [93] eBioscience / Biolegend 14-0161 / 101320; RRID: AB_312800/AB_467132 CD16/32 [93], AF700 eBioscience 56-0161-82; RRID: AB_493994 CD4 [RM4-5], PerCp-Cy5.5 Biolegend 100540; RRID: AB_2563022 CD8a [53-6.7], PerCp-Cy5.5 Biolegend 100734; RRID: AB_893427 Gr-1 [RB6-8C5], PerCp-Cy5.5 Biolegend 108428; RRID: AB_893561 Mac-1 [M1/70], PerCp-Cy5.5 Biolegend 101228; RRID: AB_893233 B220 [RA3-6B2], PerCp-Cy5.5 Biolegend 103236; RRID: AB_893356 Ter-119 [TER-119], PerCp-Cy5.5 Biolegend 116228; RRID: AB_893638 c-Kit [2B8], APC-Cy7 Biolegend 105826; RRID: AB_1626280 Sca-1 [D7], PE-Cy7 Biolegend 108114; RIID: AB_493597 Sca-1 [D7], APC-Cy7 Biolegend 108126; RRID: AB_10639725 CD150 [TC15-12F12.2], APC Biolegend 115910; RRID: AB_493461 CD150 [TC15-12F12.2], PE Biolegend 115904; RRID: AB_313682 CD150 [TC15-12F12.2], PEcy7 Biolegend 115914; RRID: AB_439796 CD48 [HM48-1], AF700 Biolegend 103426; RRID: AB_10612754 CD45.1 [A20], PE Biolegend 110708; RRID: AB_313496 CD45.1 [A20], AF700 Biolegend 110724; RRID: AB_493732 CD45.2 [104], APC-Cy7 Biolegend 109824; RRID: AB_830788 CD8a [53-6.7], PE-Cy7 Biolegend 100722; RRID: AB_312760 Gr-1 [RB6-8C5], APC BD 553129; RRID: AB_2314614 Mac-1 [M1/70], APC Biolegend 101212; RRID: AB_312794 B220 [RA3-6B2], PECy7 BD 552772; RRID: AB_394458 c-Kit [2B8], BV421 Biolegend 105828; RRID: AB_10898120 Flt-3 [A2F10.1], APC eBioscience 17-1351-80; RRID: AB_10596653 Flt-3 [A2F10.1], PE Biolegend 135305; RRID: AB_1877217 CD41 [MWReg30], PE BD 558040; RRID: AB_397004 CD41 [MWReg30], APC Invitrogen 17-0411-82; RRID: AB_1603238 IL-7Ra [A7R34], PE eBioscience 12-1271-81; RRID: AB_465845 IL-7Ra [A7R34], BV510 Biolegend 135033; RRID: AB_2564576 Endoglin [MJ7/18] Biolegend 120410; RRID: AB_1027702 CD9 [KMC8], BV421 BD Horizon 564235; RRID: AB_395032 CD34 [RAM34], FITC eBioscience 11-034-85; RRID: AB_465020 Mpl [AMM2], Biotin IBL 10403 Ki67 [SolA15], PE eBioscience 12-5698-82; RRID: AB_11150954 AnnexinV, PE Life Technologies A35111 pSTAT3 (S727)[49] BD Phosflow 558557 GRIM19 [6E1BH7] Abcam ab110240; RRID: AB_303811 TOMM20 Abcam Ab186734; RRID: AB_2043078 pAMPKa (Thr172) [40H9] CST 2535; RRID: AB_331250 CD41-143Nd [MWreg30] Fluidigm 3143009B SOCS3 [516919] R&D MAB5696; RRID: AB_2193299 pStat5 (Y694)-147Sm [47] Fluidigm 3147012A SOCS1 [4H1] ThermoScientific 37-4100; RRID: AB_10890785 (Continued on next page) e1 Cell Reports 25, 1772–1785.e1–e6, November 13, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER anti-biotin-150Nd Fluidigm 3150008B pAkt (S473) 152Sm [D9E] Fluidigm 3152005A pStat1 (Y701)- 153Eu [58D6] Fluidigm 3153003A CD48-154Sm [HM48-1] Fluidigm 3154004B p38 (T180/Y182)- 156Gd [D3F9] Fluidigm 3156002A pStat3 (Y705)- 158Gd [4] Fluidigm 3158005A pMAPKAPK2 (T334)- 159Tb [27B7] Fluidigm 3159010A pJak2 (Tyr1008) [D4A8] CST 8082S; RRID: AB_10949104 Tie2 [TEK4] Biolegend 124002; RRID: AB_961175 mTOR (phospho S2448) [EPR426(2)] Abcam ab109268; RRID: AB_297588 EPCR [eBio1560] eBioscience 16-2012-83; RRID: AB_657692 CD150 167Er [TC15-12F12.2] Fluidigm 3167004B CD61 [2C9.G2] Biolegend 104302; RRID: AB_313079 Ly-6A/E (Sca-1)- 169Tm [D7] Fluidigm 3169015B pERK 1/2 (T202/Y204)- 171Yb [D13.14.4E] Fluidigm 3171010A CD117 (ckit)- 173Yb [2B8] Fluidigm 3173004B pStat3 (S727) [ab30647] Abcam ab86430; RRID: AB_779085 Pgc1a Abcam ab54481; RRID: AB_881987 Chemicals, Peptides, and Recombinant Proteins Romiplostim Kyowa Kirin n/a MitotrackerTM Green FM ThermoScientific M7514 TMRE Enzo 52309 CellROX ThermoScientific C10448 recombinant human Thpo (PEG-rHuMGDF) Kyowa Kirin n/a Filgrastim Kyowa Kirin n/a antimycin Sigma A8674 rotenone Abcam ab143145 oligomycin Abcam ab141829 FCCP Abcam ab120081 KPT-330 Cayman chemical 18127 murine recombinant SCF Peprotech 250-03 murine recombinant Thpo Peprotech 315-14 cisplatin (Cell-ID Cisplatin) Fluidigm 201198 Critical Commercial Assays CellTiter-Glo 2.0 Assay kit Promega G9241 MegaCult Stem cell Technologies 04960 MethoCult Stem cell Technologies M3234 LIVE/DEAD Viability/cytotoxicity Kit Life Technologies MP03224 SMARTer Ultra Low RNA Kit for Fluidigm C1 system Clonetech 634936 Illumina Nextera XT DNA Sample Preparation Kit Illumina FC-131-1096/FC-131-1002 C1 Single-cell Auto Prep Reagent kit for mRNA-seq Fluidigm 100-6201 Superscript VILO Invitrogen 11754250 RNeasy Mini Kit QIAGEN 74106 IntraPrep reagents Beckman Coulter IM2389 Maxpar antibody labeling kit Fluidigm 201300 MaxPar Fix I buffer Fluidigm 201065 Maxpar Cell Staining Buffer Fluidigm 201068 Cell-ID Intercalator-Ir Fluidigm 201192A Maxpar Fix and Perm Buffer Fluidigm 201057 (Continued on next page) Cell Reports 25, 1772–1785.e1–e6, November 13, 2018 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited Data RNA-seq: Thrombopoietin metabolically primes hematopoietic stem cells to megakaryocyte lineage differentiation This paper GEO: GSE121001 Experimental Models: Organisms/Strains Mouse: Thpo / Toshio Suda Lab n/a Mouse: UBC-GFP (C57BL/6-Tg(UBC-GFP)30Scha/J) Jackson laboratory 004353 Mouse: CD45.1 Jackson laboratory 002014 Mouse: Mito-Dendra2 (Gt(ROSA)26Sortm1.1(CAG-COX8A/ Dendra2)Dcc) Jackson laboratory 018385 Mouse: (Fucci) GMNN-mAG mice (B6.Cg-Tg(FucciS/G2/M)#474Bsi RIKEN RBRC02704 Oligonucleotides Taqman primer: Ppargc1a Thermo Fisher Scientific Mm01208835_m1 Taqman primer: Tfam Thermo Fisher Scientific Mm00447485_m1 Taqman primer: Nrf1 Thermo Fisher Scientific Mm01135606_m1 Taqman primer: Sdhb Thermo Fisher Scientific Mm00458272_m1 Taqman primer: Sdhc Thermo Fisher Scientific Mm00481172_m1 Taqman primer: Atp5a Thermo Fisher Scientific Mm00431960_m1 Taqman primer: Cox5a Thermo Fisher Scientific Mm00432638_m1 Taqman primer: Cyc1 Thermo Fisher Scientific Mm00470540_m1 Taqman primer: Ndufa13 Thermo Fisher Scientific Mm00445751_m1 Taqman primer: B2m Thermo Fisher Scientific Mm03003532_u1 Taqman primer: Bax Thermo Fisher Scientific Mm00432051_m1 Taqman primer: Bak1 Thermo Fisher Scientific Mm00432045_m1 Taqman primer: Bcl2 Thermo Fisher Scientific Mm00477631_m1 Taqman primer: Prdx1 Thermo Fisher Scientific Mm01621996_s1 Taqman primer: Prdx3 Thermo Fisher Scientific Mm00545848_m1 Taqman primer: Gpx1 Thermo Fisher Scientific Mm00656767_g1 Taqman primer: Gpx4 Thermo Fisher Scientific Mm00515041_m1 Taqman primer: Txn2 Thermo Fisher Scientific Mm00444931_m1 Software and Algorithms FlowJo 10.1 Tree Star n/a QuantStudioTM Design and Analysis Software 1.3.1 Thermo Fisher Scientific n/a Agilent Seahorse Wave Desktop Agilent n/a R R Foundation version 3.3.2 Rtsne package version 0.13 Cufflinks version 2.2.1 PANTHER release 20160715 GSEA Broad institute Version 2.0.13 NIS elements Nikon n/a ImageJ n/a Cytobank. n/a flowCore n/a flowViz n/a flowUtils n/a

    Article Title: Dissecting Cell Lineage Specification and Sex Fate Determination in Gonadal Somatic Cells Using Single-Cell Transcriptomics.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Polyclonal Antibody Thermo Fisher Scientific Cat# A10262, RRID:AB_2534023 Human COUP-TF II/NR2F2 Antibody Perseus Proteomics Cat# PP-H7147-00, RRID:AB_2155627 Rabbit anti-FOXL2 Gift from Dagmar Wilhelm N/A Chemicals, Peptides, and Recombinant Proteins Trypsin-EDTA (0.05%), phenol red Thermo Fisher Scientific 25300054 DPBS, no calcium, no magnesium Thermo Fisher Scientific 14190144 Fetal bovine serum Thermo Fisher Scientific 26140087 Critical Commercial Assays C1 IFC for mRNA-seq (5-10 mM) Fluidigm 1005759 C1 Single-Cell Auto Prep Kit for mRNA Seq Fluidigm 100-6209 C1 Single-Cell Auto Prep Reagent Kit for mRNA Seq Fluidigm 100-6201 SMARTer Ultra Low RNA Kit for the Fluidigm C1 System Fluidigm 634833 Nextera XT DNA Sample Preparation Kit Illumina FC-131-1096 Nextera XT DNA Sample Preparation Index Kits A-D Illumina FC-131-2001-4 Agencourt AMPure XP beads Beckman Coulter A63880 Qubit dsDNA High Sensitivity Life Technologies Q32854 Agilent High Sensitivity DNA Kit Reagents Agilent 5067-4626 Deposited Data Raw data, normalized counts matrix for XY data GEO GSE97519 Raw data, normalized counts matrix for XX data GEO GSE119766 Scripts for analysis GitHub https://github.com/IStevant/mouse-gonad-scRNA-seq Experimental Models: Organisms/Strains Mus musculus: CD-1 Charles River Strain code 022 Mus musculus: CD-1-Tg(Nr5a1-GFP) Stallings et al., 2002 N/A Oligonucleotides Primers for sex genotyping McFarlane et al., 2013 N/A Software and Algorithms Gem mapper (version 1.7.1) Marco-Sola et al., 2012 N/A SamTools (version 0.1.19) Li et al., 2009 http://www.htslib.org/ R (version 3.4.3) N/A https://www.R-project.org/ FactoMineR Lê et al., 2008 http://factominer.free.fr/ Destiny Angerer et al., 2016 https://github.com/theislab/destiny Slingshot Street et al., 2018 https://github.com/kstreet13/slingshot Monocle2 Qiu et al., 2017 https://github.com/cole-trapnell-lab/monocle-release Ggplot2 Wickham, 2009 https://ggplot2.tidyverse.org/ Pheatmap N/A https://github.com/raivokolde/pheatmap ..

    Article Title: Multiomics Investigation Revealing the Characteristics of HIV-1-Infected Cells In Vivo.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies PerCP/Cy5.5-conjugated anti-CD45 antibody Biolegend Cat# 368504; RRID: AB_2566352 PE-conjugated anti-CD3 antibody BD Biosciences Cat# 555333; RRID: AB_395740 APC-conjugated anti-CD8 antibody Dako Cat# C722701; RRID: AB_578594 APC-conjugated anti-CXCL13 antibody Thermo Fisher Scientific Cat# MA5-23629; RRID: AB_2610225 APC-conjugated anti-CXCR5 antibody BioLegend Cat# 35908; RRID: AB_2561817 Anti-HIV-1 p24 antibody Virostat Cat# 1951 Anti-Vif antibody NIH AIDS Reagent Program Cat# 6459 Anti-Vpr antibody (clone 8D1) Cosmo Bio Cat# NCG-M01 Anti-Vpu antibody NIH AIDS Reagent Program Cat# 969 Anti-Env antibody NIH AIDS Reagent Program Cat# 12559 Anti-Nef antibody (clone 3D12) Thermo Fisher Scientific Cat# MA1-71501; RRID: AB_962113 Anti-PR antibody (clone 1696) Thermo Fisher Scientific Cat# MA1-19015; RRID: AB_1075640 Anti-RT antibody NIH AIDS Reagent Program Cat# 11338 Anti-IN antibody (clone IN-2) Abcam Cat# ab66645; RRID: AB_1139533 Anti-GFP antibody Sigma-Aldrich Cat# G6795; RRID: AB_563117 Anti-alpha-Tubulin antibody Sigma-Aldrich Cat# T9026; RRID: AB_477593 Bacterial and Virus Strains HIV1-GFP (strain NLSCFV3-GFP) (Miura et al., 2001) N/A HIV-1 (strain NLSCFV3) (Suzuki et al., 1999) N/A Biological Samples Human CD34+ hematopoietic stem cells UCLA CFAR Gene and Cellular Therapy Core Facility https://www.uclahealth.org/ aidsinstitute/cfar/gene-and-cellulartherapy-core Human PBMCs This study N/A Chemicals, Peptides, and Recombinant Proteins Dulbecco’s modified Eagle’s medium Sigma-Aldrich Cat# D6046-500ML RPMI 1640 Sigma-Aldrich Cat# R8758-500ML Fetal calf serum (FCS) Sigma-Aldrich Cat# 172012-500ML Penicillin streptomycin Sigma-Aldrich Cat# P4333-100ML L-glutamate Thermo Fisher Scientific Cat# 25030081 Ficoll-Paque GE Healthcare Cat# 17-1440-03 Phytohemagglutinin (PHA) Sigma-Aldrich Cat# 11082132001 Phorbol 12-myristate 13-acetate (PMA) Sigma-Aldrich Cat# P-8139 Ionomycin Sigma-Aldrich Cat# I-0634 Nelfinavir Sigma-Aldrich Cat# PZ0013 Blasticidin Invivogen Cat# ant-bl-1 Recombinant CXCL13 Funakoshi Cat# 801-CX-025 EcoRI Takara Cat# 1040A BamHI Takara Cat# 1010A ddPCR Supermix for probes Bio-Rad Cat# 1863010 NEBNext Ultra II End Repair/dA-Tailing module New England BioLabs Cat# E7546 NEBNext Ultra II ligation module New England BioLabs Cat# E7595 Agencourt AMPure XP Beckman Coulter Cat# A63880 C1 single-cell Auto Prep Reagent kit for mRNA Seq Fluidigm Cat# 100-6201 (Continued on next page) e1 Cell Reports 32, 107887, July 14, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER Short linker for LM-PCR: 50-p-GAT CGG AAG AGC GAA AAA AAA AAA AA-30 (Satou et al., 2017) N/A Primer (B3) for 1st LM-PCR: 50-GCT TGC CTT GAG TGC TTC AAG TAG TGT G-30 (Satou et al., 2017) N/A Primer (B4) for 1st LM-PCR: 50-TCATGATCAATG GGACGATCA-30 (Satou et al., 2017) N/A Primer (P5B5) for 2nd LM-PCR: 50-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACG TGC CCG TCT GTT GTG TGA CTC TGG-30 (Satou et al., 2017) N/A Primer (P7) for 2nd LM-PCR: 50-CAA GCA GAA GAC GGC ATA CGA GAT-30 (Satou et al., 2017) N/A Sequencing primer for LM-PCR (‘Read1’ targeting HIV-1): 50-ATC CCT CAG ACC CTT TTA GTC AGT GTG GAA AAT CTC-30 (Satou et al., 2017) N/A Sequencing primer for LM-PCR (‘Read20 targeting human genome): 50-CGG TCT CGG CAT TCC TGC TGA ACC GCT CTT CCG ATC T-30 (Satou et al., 2017) N/A Sequencing primer for LM-PCR (‘Index1’ targeting adaptor): 50-GAT CGG AAG AGC GGT TCA GCA GGA ATG CCG AGA CCG-30 (Satou et al., 2017) N/A Oligonucleotide for dRNA-Seq (polyT1): 50-ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT NNN NNN ANN CNN TNN GNN ANN CNN TTT TTT TTT TTT TTV-30 IDT N/A Oligonucleotide for dRNA-Seq (polyT2): 50-ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT NNN NNN TNN GNN ANN CNN TNN GNN TTT TTT TTT TTT TTV-30 IDT N/A Oligonucleotide for dRNA-Seq (polyT3): 50-ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT NNN NNN GNN TNN CNN ANN GNN ANN TTT TTT TTT TTT TTV-30 IDT N/A Oligonucleotide for dRNA-Seq (polyT4): 50-ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT NNN NNN CNN ANN GNN TNN CNN TNN TTT TTT TTT TTT TTV-30 IDT N/A Oligonucleotide for dRNA-Seq (TS-Oligo; [ ], RNA): 50-AAG CAG TGG TAT CAA CGC [AGA GUA CAU GGG]-30 Hokkaido System Science Co. N/A Oligonucleotide for dRNA-Seq (PCR primer 1; XXXXXXXX, index): 50-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACX XXX XXX ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT-30 IDT N/A Oligonucleotide for dRNA-Seq (PCR primer 2; XXXXXXXX, index): 50-CAA GCA GAA GAC GGC ATA CGAGAT XXX XXX XTG ACT GGAGTT CAG ACG TGT GCT CTT CCG ATC TAA GCA GTG GTA TCA ACG CAG AGT ACA TGG G-30 IDT N/A Primer for CXCR5 cloning: CXCR5_F1, 50-CGG GGA GCC TCT CAA CAT AA-30 This study N/A Primer for CXCR5 cloning: CXCR5_R1, 50-CCC TTA GGA TCC CAG CTC CT-30 This study N/A Primer for CXCR5 cloning: CXCR5_F2, 50-AGA GAG AAT TCC CAC CAT GAA CTA CCC GCT AAC GCT-30 This study N/A (Continued on next page) e3 Cell Reports 32, 107887, July 14, 2020

    Article Title: Single-Cell Transcriptome Analysis Reveals Estrogen Signaling Coordinately Augments One-Carbon, Polyamine, and Purine Synthesis in Breast Cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins 17b-estradiol (E2) Sigma Cat# 50-28-2 Critical Commercial Assays RNeasy Mini Kit QIAGEN Cat# 74106 SMARTer Ultra Low RNA Kit Clontech Cat# 634936 C1 Single-Cell mRNA Seq IFC Fluidigm Cat# 100-6041 C1 Single-Cell Reagent Kit for mRNA Seq Fluidigm Cat# 100-6201 C1 Single-Cell mRNA Seq HT IFC Fluidigm Cat# 101-4982 C1 Single-Cell mRNA Seq HT Reagent Kit v2 Fluidigm Cat# 101-3473 Nextera XT Sample Prep Kit Illumina Cat# FC-131-1096 Nextera XT DNA Sample Preparation Index Kit Illumina Cat# FC-131-1002 KAPA Library Quantification Kit KAPA Biosystems Cat# KR0405 Nextera XT Index Kit v2 Illumina Cat# FC-131-2001(set A) and FC-131-2002(set B). ddPCR Supermix for Probes (no dUTP) BioRad Cat# 186-3024 ddPCR Droplet Reader Oil BioRad Cat# 186-3004 DG8 Cartridges and Gaskets BioRad Cat# 186-4007 ddPCR 96-Well PCR Plates BioRad Cat# 12001925 RNAscope Multiplex Fluorescent v2 Kit ACDbio Cat# 323110 Cell apoptosis kit ThermoFisher Cat# V13245 MTT ThermoFisher Cat# M6494 Deposited Data Raw and analyzed data This paper GEO: GSE107864, GSE119455 Genome reference UCSC hg19 UCSC http://hgdownload.soe.ucsc.edu/goldenPath/ hg19/bigZips/ Gene annotation reference Gencode V18 Gencode database https://www.gencodegenes.org/18.html ERa ChIP-seq data Ross-Innes et al., 2012 GEO: GSE32222 Experimental Models: Cell Lines Human: MCF7 ATCC ATCC HTB-22 Human: T47D ATCC ATCC HTB-133 Oligonucleotides Primer sets and probes used in droplet digital PCR (Table S2) This paper N/A DsiRNAs used for knockdown assays (Table S3) This paper N/A Software and Algorithms Tophat v2.0.6 Kim et al., 2013 https://ccb.jhu.edu/software/tophat/index.shtml Cufflink v2.0.2 Trapnell et al., 2012 http://cole-trapnell-lab.github.io/cufflinks FastQC v0.11.5 https://www.bioinformatics. babraham.ac.uk/projects/fastqc/ https://www.bioinformatics.babraham.ac.uk/ projects/download.html#fastqc RSeQC v2.6.4 Wang et al., 2012 http://rseqc.sourceforge.net/ SIBER (OOMPA v2.1.0) Tong et al., 2013 http://bioinformatics.mdanderson.org/main/ OOMPA:Overview bc-GenExMiner 4.0 Jézéquel et al., 2012 http://bcgenex.centregauducheau.fr/BC-GEM/ GEM-Accueil.php?js=1 DAVID website v6.8 Huang et al., 2009 https://david.ncifcrf.gov/ GSEA software (MSigDB 6.2) Subramanian et al., 2005 http://software.broadinstitute.org/gsea/index.jsp Cell Reports 25, 2285–2298.e1–e4, November 20, 2018 e1 ..

    Sample Prep:

    Article Title: Thrombopoietin Metabolically Primes Hematopoietic Stem Cells to Megakaryocyte-Lineage Differentiation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD16/32 [93] eBioscience / Biolegend 14-0161 / 101320; RRID: AB_312800/AB_467132 CD16/32 [93], AF700 eBioscience 56-0161-82; RRID: AB_493994 CD4 [RM4-5], PerCp-Cy5.5 Biolegend 100540; RRID: AB_2563022 CD8a [53-6.7], PerCp-Cy5.5 Biolegend 100734; RRID: AB_893427 Gr-1 [RB6-8C5], PerCp-Cy5.5 Biolegend 108428; RRID: AB_893561 Mac-1 [M1/70], PerCp-Cy5.5 Biolegend 101228; RRID: AB_893233 B220 [RA3-6B2], PerCp-Cy5.5 Biolegend 103236; RRID: AB_893356 Ter-119 [TER-119], PerCp-Cy5.5 Biolegend 116228; RRID: AB_893638 c-Kit [2B8], APC-Cy7 Biolegend 105826; RRID: AB_1626280 Sca-1 [D7], PE-Cy7 Biolegend 108114; RIID: AB_493597 Sca-1 [D7], APC-Cy7 Biolegend 108126; RRID: AB_10639725 CD150 [TC15-12F12.2], APC Biolegend 115910; RRID: AB_493461 CD150 [TC15-12F12.2], PE Biolegend 115904; RRID: AB_313682 CD150 [TC15-12F12.2], PEcy7 Biolegend 115914; RRID: AB_439796 CD48 [HM48-1], AF700 Biolegend 103426; RRID: AB_10612754 CD45.1 [A20], PE Biolegend 110708; RRID: AB_313496 CD45.1 [A20], AF700 Biolegend 110724; RRID: AB_493732 CD45.2 [104], APC-Cy7 Biolegend 109824; RRID: AB_830788 CD8a [53-6.7], PE-Cy7 Biolegend 100722; RRID: AB_312760 Gr-1 [RB6-8C5], APC BD 553129; RRID: AB_2314614 Mac-1 [M1/70], APC Biolegend 101212; RRID: AB_312794 B220 [RA3-6B2], PECy7 BD 552772; RRID: AB_394458 c-Kit [2B8], BV421 Biolegend 105828; RRID: AB_10898120 Flt-3 [A2F10.1], APC eBioscience 17-1351-80; RRID: AB_10596653 Flt-3 [A2F10.1], PE Biolegend 135305; RRID: AB_1877217 CD41 [MWReg30], PE BD 558040; RRID: AB_397004 CD41 [MWReg30], APC Invitrogen 17-0411-82; RRID: AB_1603238 IL-7Ra [A7R34], PE eBioscience 12-1271-81; RRID: AB_465845 IL-7Ra [A7R34], BV510 Biolegend 135033; RRID: AB_2564576 Endoglin [MJ7/18] Biolegend 120410; RRID: AB_1027702 CD9 [KMC8], BV421 BD Horizon 564235; RRID: AB_395032 CD34 [RAM34], FITC eBioscience 11-034-85; RRID: AB_465020 Mpl [AMM2], Biotin IBL 10403 Ki67 [SolA15], PE eBioscience 12-5698-82; RRID: AB_11150954 AnnexinV, PE Life Technologies A35111 pSTAT3 (S727)[49] BD Phosflow 558557 GRIM19 [6E1BH7] Abcam ab110240; RRID: AB_303811 TOMM20 Abcam Ab186734; RRID: AB_2043078 pAMPKa (Thr172) [40H9] CST 2535; RRID: AB_331250 CD41-143Nd [MWreg30] Fluidigm 3143009B SOCS3 [516919] R&D MAB5696; RRID: AB_2193299 pStat5 (Y694)-147Sm [47] Fluidigm 3147012A SOCS1 [4H1] ThermoScientific 37-4100; RRID: AB_10890785 (Continued on next page) e1 Cell Reports 25, 1772–1785.e1–e6, November 13, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER anti-biotin-150Nd Fluidigm 3150008B pAkt (S473) 152Sm [D9E] Fluidigm 3152005A pStat1 (Y701)- 153Eu [58D6] Fluidigm 3153003A CD48-154Sm [HM48-1] Fluidigm 3154004B p38 (T180/Y182)- 156Gd [D3F9] Fluidigm 3156002A pStat3 (Y705)- 158Gd [4] Fluidigm 3158005A pMAPKAPK2 (T334)- 159Tb [27B7] Fluidigm 3159010A pJak2 (Tyr1008) [D4A8] CST 8082S; RRID: AB_10949104 Tie2 [TEK4] Biolegend 124002; RRID: AB_961175 mTOR (phospho S2448) [EPR426(2)] Abcam ab109268; RRID: AB_297588 EPCR [eBio1560] eBioscience 16-2012-83; RRID: AB_657692 CD150 167Er [TC15-12F12.2] Fluidigm 3167004B CD61 [2C9.G2] Biolegend 104302; RRID: AB_313079 Ly-6A/E (Sca-1)- 169Tm [D7] Fluidigm 3169015B pERK 1/2 (T202/Y204)- 171Yb [D13.14.4E] Fluidigm 3171010A CD117 (ckit)- 173Yb [2B8] Fluidigm 3173004B pStat3 (S727) [ab30647] Abcam ab86430; RRID: AB_779085 Pgc1a Abcam ab54481; RRID: AB_881987 Chemicals, Peptides, and Recombinant Proteins Romiplostim Kyowa Kirin n/a MitotrackerTM Green FM ThermoScientific M7514 TMRE Enzo 52309 CellROX ThermoScientific C10448 recombinant human Thpo (PEG-rHuMGDF) Kyowa Kirin n/a Filgrastim Kyowa Kirin n/a antimycin Sigma A8674 rotenone Abcam ab143145 oligomycin Abcam ab141829 FCCP Abcam ab120081 KPT-330 Cayman chemical 18127 murine recombinant SCF Peprotech 250-03 murine recombinant Thpo Peprotech 315-14 cisplatin (Cell-ID Cisplatin) Fluidigm 201198 Critical Commercial Assays CellTiter-Glo 2.0 Assay kit Promega G9241 MegaCult Stem cell Technologies 04960 MethoCult Stem cell Technologies M3234 LIVE/DEAD Viability/cytotoxicity Kit Life Technologies MP03224 SMARTer Ultra Low RNA Kit for Fluidigm C1 system Clonetech 634936 Illumina Nextera XT DNA Sample Preparation Kit Illumina FC-131-1096/FC-131-1002 C1 Single-cell Auto Prep Reagent kit for mRNA-seq Fluidigm 100-6201 Superscript VILO Invitrogen 11754250 RNeasy Mini Kit QIAGEN 74106 IntraPrep reagents Beckman Coulter IM2389 Maxpar antibody labeling kit Fluidigm 201300 MaxPar Fix I buffer Fluidigm 201065 Maxpar Cell Staining Buffer Fluidigm 201068 Cell-ID Intercalator-Ir Fluidigm 201192A Maxpar Fix and Perm Buffer Fluidigm 201057 (Continued on next page) Cell Reports 25, 1772–1785.e1–e6, November 13, 2018 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited Data RNA-seq: Thrombopoietin metabolically primes hematopoietic stem cells to megakaryocyte lineage differentiation This paper GEO: GSE121001 Experimental Models: Organisms/Strains Mouse: Thpo / Toshio Suda Lab n/a Mouse: UBC-GFP (C57BL/6-Tg(UBC-GFP)30Scha/J) Jackson laboratory 004353 Mouse: CD45.1 Jackson laboratory 002014 Mouse: Mito-Dendra2 (Gt(ROSA)26Sortm1.1(CAG-COX8A/ Dendra2)Dcc) Jackson laboratory 018385 Mouse: (Fucci) GMNN-mAG mice (B6.Cg-Tg(FucciS/G2/M)#474Bsi RIKEN RBRC02704 Oligonucleotides Taqman primer: Ppargc1a Thermo Fisher Scientific Mm01208835_m1 Taqman primer: Tfam Thermo Fisher Scientific Mm00447485_m1 Taqman primer: Nrf1 Thermo Fisher Scientific Mm01135606_m1 Taqman primer: Sdhb Thermo Fisher Scientific Mm00458272_m1 Taqman primer: Sdhc Thermo Fisher Scientific Mm00481172_m1 Taqman primer: Atp5a Thermo Fisher Scientific Mm00431960_m1 Taqman primer: Cox5a Thermo Fisher Scientific Mm00432638_m1 Taqman primer: Cyc1 Thermo Fisher Scientific Mm00470540_m1 Taqman primer: Ndufa13 Thermo Fisher Scientific Mm00445751_m1 Taqman primer: B2m Thermo Fisher Scientific Mm03003532_u1 Taqman primer: Bax Thermo Fisher Scientific Mm00432051_m1 Taqman primer: Bak1 Thermo Fisher Scientific Mm00432045_m1 Taqman primer: Bcl2 Thermo Fisher Scientific Mm00477631_m1 Taqman primer: Prdx1 Thermo Fisher Scientific Mm01621996_s1 Taqman primer: Prdx3 Thermo Fisher Scientific Mm00545848_m1 Taqman primer: Gpx1 Thermo Fisher Scientific Mm00656767_g1 Taqman primer: Gpx4 Thermo Fisher Scientific Mm00515041_m1 Taqman primer: Txn2 Thermo Fisher Scientific Mm00444931_m1 Software and Algorithms FlowJo 10.1 Tree Star n/a QuantStudioTM Design and Analysis Software 1.3.1 Thermo Fisher Scientific n/a Agilent Seahorse Wave Desktop Agilent n/a R R Foundation version 3.3.2 Rtsne package version 0.13 Cufflinks version 2.2.1 PANTHER release 20160715 GSEA Broad institute Version 2.0.13 NIS elements Nikon n/a ImageJ n/a Cytobank. n/a flowCore n/a flowViz n/a flowUtils n/a

    Article Title: Dissecting Cell Lineage Specification and Sex Fate Determination in Gonadal Somatic Cells Using Single-Cell Transcriptomics.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Polyclonal Antibody Thermo Fisher Scientific Cat# A10262, RRID:AB_2534023 Human COUP-TF II/NR2F2 Antibody Perseus Proteomics Cat# PP-H7147-00, RRID:AB_2155627 Rabbit anti-FOXL2 Gift from Dagmar Wilhelm N/A Chemicals, Peptides, and Recombinant Proteins Trypsin-EDTA (0.05%), phenol red Thermo Fisher Scientific 25300054 DPBS, no calcium, no magnesium Thermo Fisher Scientific 14190144 Fetal bovine serum Thermo Fisher Scientific 26140087 Critical Commercial Assays C1 IFC for mRNA-seq (5-10 mM) Fluidigm 1005759 C1 Single-Cell Auto Prep Kit for mRNA Seq Fluidigm 100-6209 C1 Single-Cell Auto Prep Reagent Kit for mRNA Seq Fluidigm 100-6201 SMARTer Ultra Low RNA Kit for the Fluidigm C1 System Fluidigm 634833 Nextera XT DNA Sample Preparation Kit Illumina FC-131-1096 Nextera XT DNA Sample Preparation Index Kits A-D Illumina FC-131-2001-4 Agencourt AMPure XP beads Beckman Coulter A63880 Qubit dsDNA High Sensitivity Life Technologies Q32854 Agilent High Sensitivity DNA Kit Reagents Agilent 5067-4626 Deposited Data Raw data, normalized counts matrix for XY data GEO GSE97519 Raw data, normalized counts matrix for XX data GEO GSE119766 Scripts for analysis GitHub https://github.com/IStevant/mouse-gonad-scRNA-seq Experimental Models: Organisms/Strains Mus musculus: CD-1 Charles River Strain code 022 Mus musculus: CD-1-Tg(Nr5a1-GFP) Stallings et al., 2002 N/A Oligonucleotides Primers for sex genotyping McFarlane et al., 2013 N/A Software and Algorithms Gem mapper (version 1.7.1) Marco-Sola et al., 2012 N/A SamTools (version 0.1.19) Li et al., 2009 http://www.htslib.org/ R (version 3.4.3) N/A https://www.R-project.org/ FactoMineR Lê et al., 2008 http://factominer.free.fr/ Destiny Angerer et al., 2016 https://github.com/theislab/destiny Slingshot Street et al., 2018 https://github.com/kstreet13/slingshot Monocle2 Qiu et al., 2017 https://github.com/cole-trapnell-lab/monocle-release Ggplot2 Wickham, 2009 https://ggplot2.tidyverse.org/ Pheatmap N/A https://github.com/raivokolde/pheatmap ..

    Article Title: Single-Cell Transcriptome Analysis Reveals Estrogen Signaling Coordinately Augments One-Carbon, Polyamine, and Purine Synthesis in Breast Cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins 17b-estradiol (E2) Sigma Cat# 50-28-2 Critical Commercial Assays RNeasy Mini Kit QIAGEN Cat# 74106 SMARTer Ultra Low RNA Kit Clontech Cat# 634936 C1 Single-Cell mRNA Seq IFC Fluidigm Cat# 100-6041 C1 Single-Cell Reagent Kit for mRNA Seq Fluidigm Cat# 100-6201 C1 Single-Cell mRNA Seq HT IFC Fluidigm Cat# 101-4982 C1 Single-Cell mRNA Seq HT Reagent Kit v2 Fluidigm Cat# 101-3473 Nextera XT Sample Prep Kit Illumina Cat# FC-131-1096 Nextera XT DNA Sample Preparation Index Kit Illumina Cat# FC-131-1002 KAPA Library Quantification Kit KAPA Biosystems Cat# KR0405 Nextera XT Index Kit v2 Illumina Cat# FC-131-2001(set A) and FC-131-2002(set B). ddPCR Supermix for Probes (no dUTP) BioRad Cat# 186-3024 ddPCR Droplet Reader Oil BioRad Cat# 186-3004 DG8 Cartridges and Gaskets BioRad Cat# 186-4007 ddPCR 96-Well PCR Plates BioRad Cat# 12001925 RNAscope Multiplex Fluorescent v2 Kit ACDbio Cat# 323110 Cell apoptosis kit ThermoFisher Cat# V13245 MTT ThermoFisher Cat# M6494 Deposited Data Raw and analyzed data This paper GEO: GSE107864, GSE119455 Genome reference UCSC hg19 UCSC http://hgdownload.soe.ucsc.edu/goldenPath/ hg19/bigZips/ Gene annotation reference Gencode V18 Gencode database https://www.gencodegenes.org/18.html ERa ChIP-seq data Ross-Innes et al., 2012 GEO: GSE32222 Experimental Models: Cell Lines Human: MCF7 ATCC ATCC HTB-22 Human: T47D ATCC ATCC HTB-133 Oligonucleotides Primer sets and probes used in droplet digital PCR (Table S2) This paper N/A DsiRNAs used for knockdown assays (Table S3) This paper N/A Software and Algorithms Tophat v2.0.6 Kim et al., 2013 https://ccb.jhu.edu/software/tophat/index.shtml Cufflink v2.0.2 Trapnell et al., 2012 http://cole-trapnell-lab.github.io/cufflinks FastQC v0.11.5 https://www.bioinformatics. babraham.ac.uk/projects/fastqc/ https://www.bioinformatics.babraham.ac.uk/ projects/download.html#fastqc RSeQC v2.6.4 Wang et al., 2012 http://rseqc.sourceforge.net/ SIBER (OOMPA v2.1.0) Tong et al., 2013 http://bioinformatics.mdanderson.org/main/ OOMPA:Overview bc-GenExMiner 4.0 Jézéquel et al., 2012 http://bcgenex.centregauducheau.fr/BC-GEM/ GEM-Accueil.php?js=1 DAVID website v6.8 Huang et al., 2009 https://david.ncifcrf.gov/ GSEA software (MSigDB 6.2) Subramanian et al., 2005 http://software.broadinstitute.org/gsea/index.jsp Cell Reports 25, 2285–2298.e1–e4, November 20, 2018 e1 ..

    Article Title: Single cell analyses identify a highly regenerative and homogenous human CD34+ hematopoietic stem cell population
    Article Snippet: CD11c APC BD Biosciences B-ly6 CD14 FITC BD Biosciences M5E2 CD15 FITC BD Biosciences HI98 CD19 APC-eFluor780 Thermo Fisher Scientific/eBioscience HIB19 CD19 FITC BD Biosciences HIB19 CD33 PE BD Biosciences WM53 CD33 PE-Cy7 Thermo Fisher Scientific/eBioscience WM53 CD34 FITC BD Biosciences 581 CD34 PerCp BD Biosciences 8G12 CD38 PE-Cy7 Thermo Fisher Scientific/eBioscience HB7 CD38 APC-eFluor780 Thermo Fisher Scientific/eBioscience HB7 CD45 FITC BD Biosciences HI30 CD45 PerCp BD Biosciences HI30 CD45 APC BD Biosciences HI30 CD45RA FITC BD Biosciences HI100 CD45RA PE-Cy7 Thermo Fisher Scientific/eBioscience HI100 CD49f PE BD Biosciences GoH3 CD49f AlexaFluor 647 BD Biosciences GoH3 CD56 PE BD Biosciences B159 CD90 PerCp-eFluor710 Thermo Fisher Scientific/eBioscience 5E10 CD90 APC Thermo Fisher Scientific/eBioscience 5E10 CD90 BV605 BD Biosciences 5E10 CD93/C1qRp Biotin Biolegend VIMD2 CD133 PE Miltenyi Biotec AC133 CD143 APC BD Biosciences BB9 CD201/EPCR PE BD Biosciences RCR-252 CD201/EPCR APC BD Biosciences RCR-252 CD201/EPCR PE Biolegend RCR-401 CD201/EPCR APC Biolegend RCR-401 CD201/EPCR APC Thermo Fisher Scientific/eBioscience RCR-227 Chemicals and Recombinant Proteins for Cell Culture and in vivo Experiments Ficoll-Paque GE Healthcare Life Sciences 17-1440-02 EasySep CD34+ Selection Kit II StemCell Technologies 17856 EasySep Mouse/Human Chimera Enrichment kit StemCell Technologies 19849 StemSep Human Progenitor Enrichment Kit StemCell Technologies 14056 Collagen Solution StemCell Technologies 04902 alpha-Minimum Essential media with nucleosides (MEM) Thermo Fisher Scientific/Gibco 22571038 MyeloCultTM H5100 StemCell Technologies 05150 StemSpanTM SFEM II StemCell Technologies 09605 IL2 Peprotech 200-02 IL7 Peprotech 200-07 IL15 Peprotech 200-15 FLT3L Peprotech 300-19 G-CSF Peprotech 300-23 SCF Peprotech 300-07 TPO Peprotech 300-18 Immune Globulin Intravenous (IVIG; human) Bio Products Laboratory (BPL) Gammaplex 5% Betamox 150 mg/ml suspension for injection Norbrook Betamox LA 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) Merck/Sigma-Aldrich D8417 CellTraceTM Violet staining kit Thermo Fisher Scientific C34557 TMRE (tetramethylrhodamine ethyl ester) BD Biosciences 564696 CellTitre-Glow 2.0 kit Promega G9241 Click-&-Go Plus 488 OPP Protein Synthesis Assay Kit Clickchemistrytools 1493 Saponin Merck-Sigma 47036 .. 96-well skirted FrameStar PCR plates 4titude 4ti-0960 TrixonX-100 solution Merck/Sigma-Aldrich 93443 RNAse inhibitor Thermo Fisher Scientific/Ambion AM2682 KAPA Stranded with RiboErase RNA-seq kit KAPA Biosystems KK8483 Kapa Dual-Indexed Adapters KAPA Biosystems KK8720 RNeasy Plus Micro Kit Qiagen 74034 Agencourt AMPure XP beads Beckman Coulter A63880 NexteraTM XT DNA Sample Prep Kit Illumina FC-1311096 C1TM Single-Cell Reagent Kit for mRNA Seq Fluidigm 100-6201 Ethidium homodimer-1 Thermo Fisher Scientific/Invitrogen E1169 Calcein AM Thermo Fisher Scientific/Invitrogen C3099 SMART-Seq v4 Ultra Low Input RNA Kit for C1 System Takara 635026 .. FACSDiva v. 8.0.1.1 BD Biosciences N/A FlowJo v 9.96 and 10.6.2 FlowJo, LLC N/A Extreme Limiting Dilution Analysis (ELDA) Hu and Smyth (2009) http://bioinf. wehi.edu.au /software/el da/index.ht ml Prism 8.4.2 GraphPad Software N/A Adobe Illustrator 26.0.3 Adobe Inc. N/A DeSeq2 V1.28.1 Love et al., 2014 https://bioco nductor.org/ packages/re lease/bioc/h tml/DESeq2 .html GSEA 4.1.0 Subramanian et al., 2005 www.gseamsigdb.org/ gsea/index.j sp STAR_2.4 Dobin et al., 2013 https://githu b.com/alexd obin/STAR RSEM_1.2.8 Li et al., 2011 https://githu b.com/dewe ylab/RSEM R 3.5.0 N/A https://www. r-project.org

    Single Cell:

    Article Title: Thrombopoietin Metabolically Primes Hematopoietic Stem Cells to Megakaryocyte-Lineage Differentiation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD16/32 [93] eBioscience / Biolegend 14-0161 / 101320; RRID: AB_312800/AB_467132 CD16/32 [93], AF700 eBioscience 56-0161-82; RRID: AB_493994 CD4 [RM4-5], PerCp-Cy5.5 Biolegend 100540; RRID: AB_2563022 CD8a [53-6.7], PerCp-Cy5.5 Biolegend 100734; RRID: AB_893427 Gr-1 [RB6-8C5], PerCp-Cy5.5 Biolegend 108428; RRID: AB_893561 Mac-1 [M1/70], PerCp-Cy5.5 Biolegend 101228; RRID: AB_893233 B220 [RA3-6B2], PerCp-Cy5.5 Biolegend 103236; RRID: AB_893356 Ter-119 [TER-119], PerCp-Cy5.5 Biolegend 116228; RRID: AB_893638 c-Kit [2B8], APC-Cy7 Biolegend 105826; RRID: AB_1626280 Sca-1 [D7], PE-Cy7 Biolegend 108114; RIID: AB_493597 Sca-1 [D7], APC-Cy7 Biolegend 108126; RRID: AB_10639725 CD150 [TC15-12F12.2], APC Biolegend 115910; RRID: AB_493461 CD150 [TC15-12F12.2], PE Biolegend 115904; RRID: AB_313682 CD150 [TC15-12F12.2], PEcy7 Biolegend 115914; RRID: AB_439796 CD48 [HM48-1], AF700 Biolegend 103426; RRID: AB_10612754 CD45.1 [A20], PE Biolegend 110708; RRID: AB_313496 CD45.1 [A20], AF700 Biolegend 110724; RRID: AB_493732 CD45.2 [104], APC-Cy7 Biolegend 109824; RRID: AB_830788 CD8a [53-6.7], PE-Cy7 Biolegend 100722; RRID: AB_312760 Gr-1 [RB6-8C5], APC BD 553129; RRID: AB_2314614 Mac-1 [M1/70], APC Biolegend 101212; RRID: AB_312794 B220 [RA3-6B2], PECy7 BD 552772; RRID: AB_394458 c-Kit [2B8], BV421 Biolegend 105828; RRID: AB_10898120 Flt-3 [A2F10.1], APC eBioscience 17-1351-80; RRID: AB_10596653 Flt-3 [A2F10.1], PE Biolegend 135305; RRID: AB_1877217 CD41 [MWReg30], PE BD 558040; RRID: AB_397004 CD41 [MWReg30], APC Invitrogen 17-0411-82; RRID: AB_1603238 IL-7Ra [A7R34], PE eBioscience 12-1271-81; RRID: AB_465845 IL-7Ra [A7R34], BV510 Biolegend 135033; RRID: AB_2564576 Endoglin [MJ7/18] Biolegend 120410; RRID: AB_1027702 CD9 [KMC8], BV421 BD Horizon 564235; RRID: AB_395032 CD34 [RAM34], FITC eBioscience 11-034-85; RRID: AB_465020 Mpl [AMM2], Biotin IBL 10403 Ki67 [SolA15], PE eBioscience 12-5698-82; RRID: AB_11150954 AnnexinV, PE Life Technologies A35111 pSTAT3 (S727)[49] BD Phosflow 558557 GRIM19 [6E1BH7] Abcam ab110240; RRID: AB_303811 TOMM20 Abcam Ab186734; RRID: AB_2043078 pAMPKa (Thr172) [40H9] CST 2535; RRID: AB_331250 CD41-143Nd [MWreg30] Fluidigm 3143009B SOCS3 [516919] R&D MAB5696; RRID: AB_2193299 pStat5 (Y694)-147Sm [47] Fluidigm 3147012A SOCS1 [4H1] ThermoScientific 37-4100; RRID: AB_10890785 (Continued on next page) e1 Cell Reports 25, 1772–1785.e1–e6, November 13, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER anti-biotin-150Nd Fluidigm 3150008B pAkt (S473) 152Sm [D9E] Fluidigm 3152005A pStat1 (Y701)- 153Eu [58D6] Fluidigm 3153003A CD48-154Sm [HM48-1] Fluidigm 3154004B p38 (T180/Y182)- 156Gd [D3F9] Fluidigm 3156002A pStat3 (Y705)- 158Gd [4] Fluidigm 3158005A pMAPKAPK2 (T334)- 159Tb [27B7] Fluidigm 3159010A pJak2 (Tyr1008) [D4A8] CST 8082S; RRID: AB_10949104 Tie2 [TEK4] Biolegend 124002; RRID: AB_961175 mTOR (phospho S2448) [EPR426(2)] Abcam ab109268; RRID: AB_297588 EPCR [eBio1560] eBioscience 16-2012-83; RRID: AB_657692 CD150 167Er [TC15-12F12.2] Fluidigm 3167004B CD61 [2C9.G2] Biolegend 104302; RRID: AB_313079 Ly-6A/E (Sca-1)- 169Tm [D7] Fluidigm 3169015B pERK 1/2 (T202/Y204)- 171Yb [D13.14.4E] Fluidigm 3171010A CD117 (ckit)- 173Yb [2B8] Fluidigm 3173004B pStat3 (S727) [ab30647] Abcam ab86430; RRID: AB_779085 Pgc1a Abcam ab54481; RRID: AB_881987 Chemicals, Peptides, and Recombinant Proteins Romiplostim Kyowa Kirin n/a MitotrackerTM Green FM ThermoScientific M7514 TMRE Enzo 52309 CellROX ThermoScientific C10448 recombinant human Thpo (PEG-rHuMGDF) Kyowa Kirin n/a Filgrastim Kyowa Kirin n/a antimycin Sigma A8674 rotenone Abcam ab143145 oligomycin Abcam ab141829 FCCP Abcam ab120081 KPT-330 Cayman chemical 18127 murine recombinant SCF Peprotech 250-03 murine recombinant Thpo Peprotech 315-14 cisplatin (Cell-ID Cisplatin) Fluidigm 201198 Critical Commercial Assays CellTiter-Glo 2.0 Assay kit Promega G9241 MegaCult Stem cell Technologies 04960 MethoCult Stem cell Technologies M3234 LIVE/DEAD Viability/cytotoxicity Kit Life Technologies MP03224 SMARTer Ultra Low RNA Kit for Fluidigm C1 system Clonetech 634936 Illumina Nextera XT DNA Sample Preparation Kit Illumina FC-131-1096/FC-131-1002 C1 Single-cell Auto Prep Reagent kit for mRNA-seq Fluidigm 100-6201 Superscript VILO Invitrogen 11754250 RNeasy Mini Kit QIAGEN 74106 IntraPrep reagents Beckman Coulter IM2389 Maxpar antibody labeling kit Fluidigm 201300 MaxPar Fix I buffer Fluidigm 201065 Maxpar Cell Staining Buffer Fluidigm 201068 Cell-ID Intercalator-Ir Fluidigm 201192A Maxpar Fix and Perm Buffer Fluidigm 201057 (Continued on next page) Cell Reports 25, 1772–1785.e1–e6, November 13, 2018 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited Data RNA-seq: Thrombopoietin metabolically primes hematopoietic stem cells to megakaryocyte lineage differentiation This paper GEO: GSE121001 Experimental Models: Organisms/Strains Mouse: Thpo / Toshio Suda Lab n/a Mouse: UBC-GFP (C57BL/6-Tg(UBC-GFP)30Scha/J) Jackson laboratory 004353 Mouse: CD45.1 Jackson laboratory 002014 Mouse: Mito-Dendra2 (Gt(ROSA)26Sortm1.1(CAG-COX8A/ Dendra2)Dcc) Jackson laboratory 018385 Mouse: (Fucci) GMNN-mAG mice (B6.Cg-Tg(FucciS/G2/M)#474Bsi RIKEN RBRC02704 Oligonucleotides Taqman primer: Ppargc1a Thermo Fisher Scientific Mm01208835_m1 Taqman primer: Tfam Thermo Fisher Scientific Mm00447485_m1 Taqman primer: Nrf1 Thermo Fisher Scientific Mm01135606_m1 Taqman primer: Sdhb Thermo Fisher Scientific Mm00458272_m1 Taqman primer: Sdhc Thermo Fisher Scientific Mm00481172_m1 Taqman primer: Atp5a Thermo Fisher Scientific Mm00431960_m1 Taqman primer: Cox5a Thermo Fisher Scientific Mm00432638_m1 Taqman primer: Cyc1 Thermo Fisher Scientific Mm00470540_m1 Taqman primer: Ndufa13 Thermo Fisher Scientific Mm00445751_m1 Taqman primer: B2m Thermo Fisher Scientific Mm03003532_u1 Taqman primer: Bax Thermo Fisher Scientific Mm00432051_m1 Taqman primer: Bak1 Thermo Fisher Scientific Mm00432045_m1 Taqman primer: Bcl2 Thermo Fisher Scientific Mm00477631_m1 Taqman primer: Prdx1 Thermo Fisher Scientific Mm01621996_s1 Taqman primer: Prdx3 Thermo Fisher Scientific Mm00545848_m1 Taqman primer: Gpx1 Thermo Fisher Scientific Mm00656767_g1 Taqman primer: Gpx4 Thermo Fisher Scientific Mm00515041_m1 Taqman primer: Txn2 Thermo Fisher Scientific Mm00444931_m1 Software and Algorithms FlowJo 10.1 Tree Star n/a QuantStudioTM Design and Analysis Software 1.3.1 Thermo Fisher Scientific n/a Agilent Seahorse Wave Desktop Agilent n/a R R Foundation version 3.3.2 Rtsne package version 0.13 Cufflinks version 2.2.1 PANTHER release 20160715 GSEA Broad institute Version 2.0.13 NIS elements Nikon n/a ImageJ n/a Cytobank. n/a flowCore n/a flowViz n/a flowUtils n/a

    Article Title: Dissecting Cell Lineage Specification and Sex Fate Determination in Gonadal Somatic Cells Using Single-Cell Transcriptomics.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Polyclonal Antibody Thermo Fisher Scientific Cat# A10262, RRID:AB_2534023 Human COUP-TF II/NR2F2 Antibody Perseus Proteomics Cat# PP-H7147-00, RRID:AB_2155627 Rabbit anti-FOXL2 Gift from Dagmar Wilhelm N/A Chemicals, Peptides, and Recombinant Proteins Trypsin-EDTA (0.05%), phenol red Thermo Fisher Scientific 25300054 DPBS, no calcium, no magnesium Thermo Fisher Scientific 14190144 Fetal bovine serum Thermo Fisher Scientific 26140087 Critical Commercial Assays C1 IFC for mRNA-seq (5-10 mM) Fluidigm 1005759 C1 Single-Cell Auto Prep Kit for mRNA Seq Fluidigm 100-6209 C1 Single-Cell Auto Prep Reagent Kit for mRNA Seq Fluidigm 100-6201 SMARTer Ultra Low RNA Kit for the Fluidigm C1 System Fluidigm 634833 Nextera XT DNA Sample Preparation Kit Illumina FC-131-1096 Nextera XT DNA Sample Preparation Index Kits A-D Illumina FC-131-2001-4 Agencourt AMPure XP beads Beckman Coulter A63880 Qubit dsDNA High Sensitivity Life Technologies Q32854 Agilent High Sensitivity DNA Kit Reagents Agilent 5067-4626 Deposited Data Raw data, normalized counts matrix for XY data GEO GSE97519 Raw data, normalized counts matrix for XX data GEO GSE119766 Scripts for analysis GitHub https://github.com/IStevant/mouse-gonad-scRNA-seq Experimental Models: Organisms/Strains Mus musculus: CD-1 Charles River Strain code 022 Mus musculus: CD-1-Tg(Nr5a1-GFP) Stallings et al., 2002 N/A Oligonucleotides Primers for sex genotyping McFarlane et al., 2013 N/A Software and Algorithms Gem mapper (version 1.7.1) Marco-Sola et al., 2012 N/A SamTools (version 0.1.19) Li et al., 2009 http://www.htslib.org/ R (version 3.4.3) N/A https://www.R-project.org/ FactoMineR Lê et al., 2008 http://factominer.free.fr/ Destiny Angerer et al., 2016 https://github.com/theislab/destiny Slingshot Street et al., 2018 https://github.com/kstreet13/slingshot Monocle2 Qiu et al., 2017 https://github.com/cole-trapnell-lab/monocle-release Ggplot2 Wickham, 2009 https://ggplot2.tidyverse.org/ Pheatmap N/A https://github.com/raivokolde/pheatmap ..

    Article Title: Tumor-associated high endothelial venules mediate lymphocyte entry into tumors and predict response to PD-1 plus CTLA-4 combination immunotherapy.
    Article Snippet: Patient samples are detailed in Table S3 MSN-08-027 CPP Ile de France Registration number : 2008-A00373-52 Chemicals, peptides, and recombinant proteins MAXblock Blocking Medium Active motif Cat# 15252 BD Cytofix/Cytoperm Fixation/Permeablization Kit BD Biosciences Cat# 554714 OCT embedding matrix CellPath Cat # KMA-0100-00A Collagenase IV Gibco Cat# KMA-0100-00A CellTracker Deep Red Dye Invitrogen Cat# 17104-019 CellTrace CFSE Cell Proliferation Kit Invitrogen Cat# C34656 Calcein AM cell-permanent dye Invitrogen Cat# C34554 Qtracker 565 Vascular Labels Invitrogen Cat# Q21031MP Fixable viability dye eFluor 506 Invitrogen Cat# 65-0866-14 FoxP3/Transcription factor staining buffer set Invitrogen Cat# 00-5523-00 ACK lysing buffer Lonza Cat# 00-5523-00 RLT buffer Qiagen Cat# 79216 RNeasy Mini Kit Qiagen Cat# 10-548E Collagenase VIII Sigma Cat# 74104 (Continued on next page) e2 Cancer Cell 40, 318–334.e1–e9, March 14, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER DNaseI Sigma Cat# 74104 Fingolimod (FTY720) Selleckchem Cat# S5002 Cell Activation Cocktail (with Brefeldin A) BioLegend Cat # 423303 SuperScript VILO cDNA Synthesis Kit ThermoFischer Scientific Cat # 11754050 Power SYBR Green PCR Master Mix ThermoFischer Scientific Cat # 4368577 Critical commercial assays C1 Single-Cell Reagent Kit for mRNA Seq Fluidigm Cat# 100-6201 ArrayControl RNA Spikes ThermoFisher Cat# AM1780 SMARTer Ultra Low RNA Kit for the Fluidigm C1 System Takara Cat# 634833 Nextera XT kit Illumina Cat# FC-131-1096 High Sensitivity NGS Fragment Analysis kit Agilent Cat# DNF-474 EasySep Mouse T Cell Isolation Kit StemCell Cat# 19851 EasySep Mouse CD4+ T Cell Isolation Kit StemCell Cat# 19852 Mouse CD8a + T Cell Isolation Kit Miltenyi Biotec Cat# 130-104-075 Mouse CD62L MicroBeads Miltenyi Biotec Cat# 130-049-701 Deposited data RNA-Seq data This paper GEO Series accession number - GEO: GSE154898 Mouse reference genome UCSC mm10 Genome Reference Consortium https://genome.ucsc.edu/ cgi-bin/hgGateway?db=mm10 Experimental models: Cell lines MCAreg (1969) fibrosarcoma Diamond et al. (2011) Gift from Robert Schreiber (Washington University School of Medicine, Saint-Louis, USA) MCAprog (9609) fibrosarcoma O’Sullivan et al. (2012) Gift from Robert Schreiber (Washington University School of Medicine, Saint-Louis, USA) MMTV-PyMT mammary carcinoma-derived VO-PyMT cells (PyMT) Halpern et al. (2006) Gift from Zena Werb (University of California, San Francisco, USA) CT26 colon carcinoma cells ATCC Cat# ATCC CRL-2638 Experimental models: Organisms/strains Mouse: C57BL/6 Charles River Cat# 027 Mouse: BALB/C Charles River Cat# 028 Mouse: FVB Charles River Cat# 207 Mouse: Rag2-/- House Breeding Oligonucleotides Primer: Ackr1 Forward: AGGATGCTATGCTTGCCTGAA This paper Primer: Ackr1 Reverse: GGTGAAGCCACGGAGTTGA This paper Primer: Fut7 Forward: CAGATGCACCCTCTAGTACTCT This paper N/A Primer: Fut7 Reverse: TGCACTGTCCTTCCACAACC This paper N/A Primer: Glycam1 Forward: GTCCACTCCCACCAGCTACAC This paper N/A Primer: Glycam1 Reverse: GGCTCCTTGGAAAGGTCCTT This paper N/A Primer: Sele Forward: TCCTGCGAAGAAGGATTTGAA This paper N/A Primer: Sele Reverse: CCCCTCTTGGACCACACTGA This paper N/A Primer: Selp Forward: CTCATCTGGTTCAGTGCTTTGATC This paper N/A Primer: Selp Reverse: TCCACGCAGCCACTTCCT This paper N/A Primer: Hprt Forward: CCTAAGATGAGCGCAAAGTTGAA This paper N/A Primer: Hprt Reverse: CCACAGGACTAGAACACCTGCT This paper N/A (Continued on next page) Cancer Cell 40, 318–334.e1–e9, March 14, 2022 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms DiVa V8.0.1 BD Biosciences FlowJo v10.1 Tree Star https://www.flowjo.com/ GraphPad Prism 8.2.1 GraphPad www.graphpad.com RSEM 1.2.18 Li and Dewey (2011) https://github.com/deweylab/RSEM Tophat2 2.0.14 Kim et al. (2013) http://ccb.jhu.edu/software/tophat/ index.shtml Fastq Screen v0.9.5 Wingett and Andrews (2018) https://github.com/StevenWingett/ FastQ-Screen FastQC 0.11.2 https://github.com/s-andrews/FastQC Trimmomatic-32 Bolger et al. (2014) https://github.com/genepattern/ Trimmomatic Monocle 2.0.4 Qiu et al. (2017) https://github.com/cole-trapnell-lab/ monocle-release R 3.3.0 (packages: ggplot2 2.2.1; grid 3.3.2; gridExtra2.3; reshape2 1.4.3; scales 0.5.0; R package Monocle v2.4.0) https://cran.r-project.org/bin/windows/ base

    Article Title: Multiomics Investigation Revealing the Characteristics of HIV-1-Infected Cells In Vivo.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies PerCP/Cy5.5-conjugated anti-CD45 antibody Biolegend Cat# 368504; RRID: AB_2566352 PE-conjugated anti-CD3 antibody BD Biosciences Cat# 555333; RRID: AB_395740 APC-conjugated anti-CD8 antibody Dako Cat# C722701; RRID: AB_578594 APC-conjugated anti-CXCL13 antibody Thermo Fisher Scientific Cat# MA5-23629; RRID: AB_2610225 APC-conjugated anti-CXCR5 antibody BioLegend Cat# 35908; RRID: AB_2561817 Anti-HIV-1 p24 antibody Virostat Cat# 1951 Anti-Vif antibody NIH AIDS Reagent Program Cat# 6459 Anti-Vpr antibody (clone 8D1) Cosmo Bio Cat# NCG-M01 Anti-Vpu antibody NIH AIDS Reagent Program Cat# 969 Anti-Env antibody NIH AIDS Reagent Program Cat# 12559 Anti-Nef antibody (clone 3D12) Thermo Fisher Scientific Cat# MA1-71501; RRID: AB_962113 Anti-PR antibody (clone 1696) Thermo Fisher Scientific Cat# MA1-19015; RRID: AB_1075640 Anti-RT antibody NIH AIDS Reagent Program Cat# 11338 Anti-IN antibody (clone IN-2) Abcam Cat# ab66645; RRID: AB_1139533 Anti-GFP antibody Sigma-Aldrich Cat# G6795; RRID: AB_563117 Anti-alpha-Tubulin antibody Sigma-Aldrich Cat# T9026; RRID: AB_477593 Bacterial and Virus Strains HIV1-GFP (strain NLSCFV3-GFP) (Miura et al., 2001) N/A HIV-1 (strain NLSCFV3) (Suzuki et al., 1999) N/A Biological Samples Human CD34+ hematopoietic stem cells UCLA CFAR Gene and Cellular Therapy Core Facility https://www.uclahealth.org/ aidsinstitute/cfar/gene-and-cellulartherapy-core Human PBMCs This study N/A Chemicals, Peptides, and Recombinant Proteins Dulbecco’s modified Eagle’s medium Sigma-Aldrich Cat# D6046-500ML RPMI 1640 Sigma-Aldrich Cat# R8758-500ML Fetal calf serum (FCS) Sigma-Aldrich Cat# 172012-500ML Penicillin streptomycin Sigma-Aldrich Cat# P4333-100ML L-glutamate Thermo Fisher Scientific Cat# 25030081 Ficoll-Paque GE Healthcare Cat# 17-1440-03 Phytohemagglutinin (PHA) Sigma-Aldrich Cat# 11082132001 Phorbol 12-myristate 13-acetate (PMA) Sigma-Aldrich Cat# P-8139 Ionomycin Sigma-Aldrich Cat# I-0634 Nelfinavir Sigma-Aldrich Cat# PZ0013 Blasticidin Invivogen Cat# ant-bl-1 Recombinant CXCL13 Funakoshi Cat# 801-CX-025 EcoRI Takara Cat# 1040A BamHI Takara Cat# 1010A ddPCR Supermix for probes Bio-Rad Cat# 1863010 NEBNext Ultra II End Repair/dA-Tailing module New England BioLabs Cat# E7546 NEBNext Ultra II ligation module New England BioLabs Cat# E7595 Agencourt AMPure XP Beckman Coulter Cat# A63880 C1 single-cell Auto Prep Reagent kit for mRNA Seq Fluidigm Cat# 100-6201 (Continued on next page) e1 Cell Reports 32, 107887, July 14, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER Short linker for LM-PCR: 50-p-GAT CGG AAG AGC GAA AAA AAA AAA AA-30 (Satou et al., 2017) N/A Primer (B3) for 1st LM-PCR: 50-GCT TGC CTT GAG TGC TTC AAG TAG TGT G-30 (Satou et al., 2017) N/A Primer (B4) for 1st LM-PCR: 50-TCATGATCAATG GGACGATCA-30 (Satou et al., 2017) N/A Primer (P5B5) for 2nd LM-PCR: 50-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACG TGC CCG TCT GTT GTG TGA CTC TGG-30 (Satou et al., 2017) N/A Primer (P7) for 2nd LM-PCR: 50-CAA GCA GAA GAC GGC ATA CGA GAT-30 (Satou et al., 2017) N/A Sequencing primer for LM-PCR (‘Read1’ targeting HIV-1): 50-ATC CCT CAG ACC CTT TTA GTC AGT GTG GAA AAT CTC-30 (Satou et al., 2017) N/A Sequencing primer for LM-PCR (‘Read20 targeting human genome): 50-CGG TCT CGG CAT TCC TGC TGA ACC GCT CTT CCG ATC T-30 (Satou et al., 2017) N/A Sequencing primer for LM-PCR (‘Index1’ targeting adaptor): 50-GAT CGG AAG AGC GGT TCA GCA GGA ATG CCG AGA CCG-30 (Satou et al., 2017) N/A Oligonucleotide for dRNA-Seq (polyT1): 50-ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT NNN NNN ANN CNN TNN GNN ANN CNN TTT TTT TTT TTT TTV-30 IDT N/A Oligonucleotide for dRNA-Seq (polyT2): 50-ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT NNN NNN TNN GNN ANN CNN TNN GNN TTT TTT TTT TTT TTV-30 IDT N/A Oligonucleotide for dRNA-Seq (polyT3): 50-ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT NNN NNN GNN TNN CNN ANN GNN ANN TTT TTT TTT TTT TTV-30 IDT N/A Oligonucleotide for dRNA-Seq (polyT4): 50-ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT NNN NNN CNN ANN GNN TNN CNN TNN TTT TTT TTT TTT TTV-30 IDT N/A Oligonucleotide for dRNA-Seq (TS-Oligo; [ ], RNA): 50-AAG CAG TGG TAT CAA CGC [AGA GUA CAU GGG]-30 Hokkaido System Science Co. N/A Oligonucleotide for dRNA-Seq (PCR primer 1; XXXXXXXX, index): 50-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACX XXX XXX ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT-30 IDT N/A Oligonucleotide for dRNA-Seq (PCR primer 2; XXXXXXXX, index): 50-CAA GCA GAA GAC GGC ATA CGAGAT XXX XXX XTG ACT GGAGTT CAG ACG TGT GCT CTT CCG ATC TAA GCA GTG GTA TCA ACG CAG AGT ACA TGG G-30 IDT N/A Primer for CXCR5 cloning: CXCR5_F1, 50-CGG GGA GCC TCT CAA CAT AA-30 This study N/A Primer for CXCR5 cloning: CXCR5_R1, 50-CCC TTA GGA TCC CAG CTC CT-30 This study N/A Primer for CXCR5 cloning: CXCR5_F2, 50-AGA GAG AAT TCC CAC CAT GAA CTA CCC GCT AAC GCT-30 This study N/A (Continued on next page) e3 Cell Reports 32, 107887, July 14, 2020

    Article Title: Single-Cell Transcriptome Analysis Reveals Estrogen Signaling Coordinately Augments One-Carbon, Polyamine, and Purine Synthesis in Breast Cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins 17b-estradiol (E2) Sigma Cat# 50-28-2 Critical Commercial Assays RNeasy Mini Kit QIAGEN Cat# 74106 SMARTer Ultra Low RNA Kit Clontech Cat# 634936 C1 Single-Cell mRNA Seq IFC Fluidigm Cat# 100-6041 C1 Single-Cell Reagent Kit for mRNA Seq Fluidigm Cat# 100-6201 C1 Single-Cell mRNA Seq HT IFC Fluidigm Cat# 101-4982 C1 Single-Cell mRNA Seq HT Reagent Kit v2 Fluidigm Cat# 101-3473 Nextera XT Sample Prep Kit Illumina Cat# FC-131-1096 Nextera XT DNA Sample Preparation Index Kit Illumina Cat# FC-131-1002 KAPA Library Quantification Kit KAPA Biosystems Cat# KR0405 Nextera XT Index Kit v2 Illumina Cat# FC-131-2001(set A) and FC-131-2002(set B). ddPCR Supermix for Probes (no dUTP) BioRad Cat# 186-3024 ddPCR Droplet Reader Oil BioRad Cat# 186-3004 DG8 Cartridges and Gaskets BioRad Cat# 186-4007 ddPCR 96-Well PCR Plates BioRad Cat# 12001925 RNAscope Multiplex Fluorescent v2 Kit ACDbio Cat# 323110 Cell apoptosis kit ThermoFisher Cat# V13245 MTT ThermoFisher Cat# M6494 Deposited Data Raw and analyzed data This paper GEO: GSE107864, GSE119455 Genome reference UCSC hg19 UCSC http://hgdownload.soe.ucsc.edu/goldenPath/ hg19/bigZips/ Gene annotation reference Gencode V18 Gencode database https://www.gencodegenes.org/18.html ERa ChIP-seq data Ross-Innes et al., 2012 GEO: GSE32222 Experimental Models: Cell Lines Human: MCF7 ATCC ATCC HTB-22 Human: T47D ATCC ATCC HTB-133 Oligonucleotides Primer sets and probes used in droplet digital PCR (Table S2) This paper N/A DsiRNAs used for knockdown assays (Table S3) This paper N/A Software and Algorithms Tophat v2.0.6 Kim et al., 2013 https://ccb.jhu.edu/software/tophat/index.shtml Cufflink v2.0.2 Trapnell et al., 2012 http://cole-trapnell-lab.github.io/cufflinks FastQC v0.11.5 https://www.bioinformatics. babraham.ac.uk/projects/fastqc/ https://www.bioinformatics.babraham.ac.uk/ projects/download.html#fastqc RSeQC v2.6.4 Wang et al., 2012 http://rseqc.sourceforge.net/ SIBER (OOMPA v2.1.0) Tong et al., 2013 http://bioinformatics.mdanderson.org/main/ OOMPA:Overview bc-GenExMiner 4.0 Jézéquel et al., 2012 http://bcgenex.centregauducheau.fr/BC-GEM/ GEM-Accueil.php?js=1 DAVID website v6.8 Huang et al., 2009 https://david.ncifcrf.gov/ GSEA software (MSigDB 6.2) Subramanian et al., 2005 http://software.broadinstitute.org/gsea/index.jsp Cell Reports 25, 2285–2298.e1–e4, November 20, 2018 e1 ..

    Article Title: Single cell analyses identify a highly regenerative and homogenous human CD34+ hematopoietic stem cell population
    Article Snippet: CD11c APC BD Biosciences B-ly6 CD14 FITC BD Biosciences M5E2 CD15 FITC BD Biosciences HI98 CD19 APC-eFluor780 Thermo Fisher Scientific/eBioscience HIB19 CD19 FITC BD Biosciences HIB19 CD33 PE BD Biosciences WM53 CD33 PE-Cy7 Thermo Fisher Scientific/eBioscience WM53 CD34 FITC BD Biosciences 581 CD34 PerCp BD Biosciences 8G12 CD38 PE-Cy7 Thermo Fisher Scientific/eBioscience HB7 CD38 APC-eFluor780 Thermo Fisher Scientific/eBioscience HB7 CD45 FITC BD Biosciences HI30 CD45 PerCp BD Biosciences HI30 CD45 APC BD Biosciences HI30 CD45RA FITC BD Biosciences HI100 CD45RA PE-Cy7 Thermo Fisher Scientific/eBioscience HI100 CD49f PE BD Biosciences GoH3 CD49f AlexaFluor 647 BD Biosciences GoH3 CD56 PE BD Biosciences B159 CD90 PerCp-eFluor710 Thermo Fisher Scientific/eBioscience 5E10 CD90 APC Thermo Fisher Scientific/eBioscience 5E10 CD90 BV605 BD Biosciences 5E10 CD93/C1qRp Biotin Biolegend VIMD2 CD133 PE Miltenyi Biotec AC133 CD143 APC BD Biosciences BB9 CD201/EPCR PE BD Biosciences RCR-252 CD201/EPCR APC BD Biosciences RCR-252 CD201/EPCR PE Biolegend RCR-401 CD201/EPCR APC Biolegend RCR-401 CD201/EPCR APC Thermo Fisher Scientific/eBioscience RCR-227 Chemicals and Recombinant Proteins for Cell Culture and in vivo Experiments Ficoll-Paque GE Healthcare Life Sciences 17-1440-02 EasySep CD34+ Selection Kit II StemCell Technologies 17856 EasySep Mouse/Human Chimera Enrichment kit StemCell Technologies 19849 StemSep Human Progenitor Enrichment Kit StemCell Technologies 14056 Collagen Solution StemCell Technologies 04902 alpha-Minimum Essential media with nucleosides (MEM) Thermo Fisher Scientific/Gibco 22571038 MyeloCultTM H5100 StemCell Technologies 05150 StemSpanTM SFEM II StemCell Technologies 09605 IL2 Peprotech 200-02 IL7 Peprotech 200-07 IL15 Peprotech 200-15 FLT3L Peprotech 300-19 G-CSF Peprotech 300-23 SCF Peprotech 300-07 TPO Peprotech 300-18 Immune Globulin Intravenous (IVIG; human) Bio Products Laboratory (BPL) Gammaplex 5% Betamox 150 mg/ml suspension for injection Norbrook Betamox LA 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) Merck/Sigma-Aldrich D8417 CellTraceTM Violet staining kit Thermo Fisher Scientific C34557 TMRE (tetramethylrhodamine ethyl ester) BD Biosciences 564696 CellTitre-Glow 2.0 kit Promega G9241 Click-&-Go Plus 488 OPP Protein Synthesis Assay Kit Clickchemistrytools 1493 Saponin Merck-Sigma 47036 .. 96-well skirted FrameStar PCR plates 4titude 4ti-0960 TrixonX-100 solution Merck/Sigma-Aldrich 93443 RNAse inhibitor Thermo Fisher Scientific/Ambion AM2682 KAPA Stranded with RiboErase RNA-seq kit KAPA Biosystems KK8483 Kapa Dual-Indexed Adapters KAPA Biosystems KK8720 RNeasy Plus Micro Kit Qiagen 74034 Agencourt AMPure XP beads Beckman Coulter A63880 NexteraTM XT DNA Sample Prep Kit Illumina FC-1311096 C1TM Single-Cell Reagent Kit for mRNA Seq Fluidigm 100-6201 Ethidium homodimer-1 Thermo Fisher Scientific/Invitrogen E1169 Calcein AM Thermo Fisher Scientific/Invitrogen C3099 SMART-Seq v4 Ultra Low Input RNA Kit for C1 System Takara 635026 .. FACSDiva v. 8.0.1.1 BD Biosciences N/A FlowJo v 9.96 and 10.6.2 FlowJo, LLC N/A Extreme Limiting Dilution Analysis (ELDA) Hu and Smyth (2009) http://bioinf. wehi.edu.au /software/el da/index.ht ml Prism 8.4.2 GraphPad Software N/A Adobe Illustrator 26.0.3 Adobe Inc. N/A DeSeq2 V1.28.1 Love et al., 2014 https://bioco nductor.org/ packages/re lease/bioc/h tml/DESeq2 .html GSEA 4.1.0 Subramanian et al., 2005 www.gseamsigdb.org/ gsea/index.j sp STAR_2.4 Dobin et al., 2013 https://githu b.com/alexd obin/STAR RSEM_1.2.8 Li et al., 2011 https://githu b.com/dewe ylab/RSEM R 3.5.0 N/A https://www. r-project.org

    Article Title: Transcriptional Convergence of Oligodendrocyte Lineage Progenitors during Development.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Chicken polyclonal anti-GFP Abcam ab13970, RRID:AB_300798 Goat polyclonal anti-PDGFRA R&D AF1062, RRID:AB_2236897 Rabbit polyclonal anti-COL1A1 Abcam ab21286, RRID:AB_446161 Mouse monoclonal anti-CC1 (anti-APC) Millipore OP80, RRID:AB_2057371 Rabbit polyclonal anti-NG2 Millipore AB5320, RRID:AB_11213678 Experimental Models: Organisms/Strains Pdgfra-CreERT1/RCE (mouse) The Jackson Laboratory B6N.Cg-Tg(Pdgfra-CreERT)467Dbe/J crossed with Gt(ROSA)26Sortm1.1(CAG-EGFP)Fsh/Mmjax Pdgfra-H2BGFP (mouse) Philippe Soriano B6.129S4-Pdgfratm11(EGFP)Sor/J Critical Commercial Assays Neural tissue dissociation kit (P) Miltenyi 130-092-628 C1 Single-Cell Reagent Kit for mRNA Seq Fluidigm 100-6201 miRNeasy micro kit Qiagen 217084 MaxTract High density Qiagen 29046 QuBit RNA HS assay kit ThermoFisher Q32852 RNA 6000 Pico Kit Agilent 5067-1513 TruSeq Stranded Total RNA Library Prep Kit Illumina 20020596 Other C1 Single-Cell Open App IFC, 10–17 mm Fluidigm 100-8134 C1 instrument Fluidigm N/A FACSAria III Cell Sorter B5/R3/V3 BD biosciences N/A Axopatch 200B Amplifier Molecular Devices N/A Digidata 1322A Molecular Devices N/A Nikon Ti-E with motorized stage Nikon N/A 7900HT Fast System Applied biosystems N/A Software and Algorithms FastQC Andrews (2010) https://www.bioinformatics.babraham.ac.uk/ projects/fastqc/ STAR (v.2.5.0a) Dobin et al. (2013) https://github.com/alexdobin/STAR GENCODE M8 annotations Mudge and Harrow (2015) https://www.gencodegenes.org/ featureCounts v1.5.0-p1 Liao et al. (2014) http://bioinf.wehi.edu.au/featureCounts/ Bioconductor packages Gentleman et al. (2004) https://www.bioconductor.org/ biomaRt library Durinck et al. (2009) https://bioconductor.org/packages/release/bioc/ html/biomaRt.html limma package Ritchie et al. (2015) http://bioconductor.org/packages/release/bioc/ html/limma.html DESeq2 package Love et al. (2014) http://bioconductor.org/packages/release/bioc/ html/DESeq2.html heatmap3 library Zhao et al. (2014) https://cran.r-project.org/web/packages/ heatmap3/index.html RNASeqPower library Hart et al. (2013) https://bioconductor.org/packages/release/bioc/ html/RNASeqPower.html topGO R package Alexa and Rahnenfuhrer (2016) https://bioconductor.org/packages/release/bioc/ html/topGO.html (Continued on next page) e1 Developmental Cell 46, 504–517.e1–e7, August 20, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fisher-elim algorithm Alexa et al. (2006) https://bioconductor.org/packages/3.7/bioc/ vignettes/topGO/inst/doc/topGO.pdf Cytoscape Cline et al. (2007) http://www.cytoscape.org/ EnrichmentMap plugin Merico et al. (2010) http://baderlab.org/Software/EnrichmentMap HISAT2 version 2.0.5 Kim et al. (2015) https://ccb.jhu.edu/software/hisat2/index.shtml Stringtie 1.3.1c Pertea et al. (2015) http://www.ccb.jhu.edu/software/stringtie/ BackSPIN2 algorithm Marques et al. (2016) https://github.com/linnarsson-lab/BackSPIN Rpackage DPT Haghverdi et al. (2016) https://www.rdocumentation.org/packages/ destiny/versions/2.0.4/topics/DPT PAGODA (SCDE R-package) Fan et al. (2016) http://hms-dbmi.github.io/scde/ MAST package R Finak et al. (2015) https://github.com/RGLab/MAST SCN3E This paper https://github.com/Castelo-Branco-lab/ OPCsinglecell2017 Deposited Data Raw and Analysed data This paper GEO: GSE95194 (single cell) and GEO: GSE95093 (bulk) Other Webresource with browsable data This paper https://ki.se/en/mbb/oligointernode

    Antibody Labeling:

    Article Title: Thrombopoietin Metabolically Primes Hematopoietic Stem Cells to Megakaryocyte-Lineage Differentiation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD16/32 [93] eBioscience / Biolegend 14-0161 / 101320; RRID: AB_312800/AB_467132 CD16/32 [93], AF700 eBioscience 56-0161-82; RRID: AB_493994 CD4 [RM4-5], PerCp-Cy5.5 Biolegend 100540; RRID: AB_2563022 CD8a [53-6.7], PerCp-Cy5.5 Biolegend 100734; RRID: AB_893427 Gr-1 [RB6-8C5], PerCp-Cy5.5 Biolegend 108428; RRID: AB_893561 Mac-1 [M1/70], PerCp-Cy5.5 Biolegend 101228; RRID: AB_893233 B220 [RA3-6B2], PerCp-Cy5.5 Biolegend 103236; RRID: AB_893356 Ter-119 [TER-119], PerCp-Cy5.5 Biolegend 116228; RRID: AB_893638 c-Kit [2B8], APC-Cy7 Biolegend 105826; RRID: AB_1626280 Sca-1 [D7], PE-Cy7 Biolegend 108114; RIID: AB_493597 Sca-1 [D7], APC-Cy7 Biolegend 108126; RRID: AB_10639725 CD150 [TC15-12F12.2], APC Biolegend 115910; RRID: AB_493461 CD150 [TC15-12F12.2], PE Biolegend 115904; RRID: AB_313682 CD150 [TC15-12F12.2], PEcy7 Biolegend 115914; RRID: AB_439796 CD48 [HM48-1], AF700 Biolegend 103426; RRID: AB_10612754 CD45.1 [A20], PE Biolegend 110708; RRID: AB_313496 CD45.1 [A20], AF700 Biolegend 110724; RRID: AB_493732 CD45.2 [104], APC-Cy7 Biolegend 109824; RRID: AB_830788 CD8a [53-6.7], PE-Cy7 Biolegend 100722; RRID: AB_312760 Gr-1 [RB6-8C5], APC BD 553129; RRID: AB_2314614 Mac-1 [M1/70], APC Biolegend 101212; RRID: AB_312794 B220 [RA3-6B2], PECy7 BD 552772; RRID: AB_394458 c-Kit [2B8], BV421 Biolegend 105828; RRID: AB_10898120 Flt-3 [A2F10.1], APC eBioscience 17-1351-80; RRID: AB_10596653 Flt-3 [A2F10.1], PE Biolegend 135305; RRID: AB_1877217 CD41 [MWReg30], PE BD 558040; RRID: AB_397004 CD41 [MWReg30], APC Invitrogen 17-0411-82; RRID: AB_1603238 IL-7Ra [A7R34], PE eBioscience 12-1271-81; RRID: AB_465845 IL-7Ra [A7R34], BV510 Biolegend 135033; RRID: AB_2564576 Endoglin [MJ7/18] Biolegend 120410; RRID: AB_1027702 CD9 [KMC8], BV421 BD Horizon 564235; RRID: AB_395032 CD34 [RAM34], FITC eBioscience 11-034-85; RRID: AB_465020 Mpl [AMM2], Biotin IBL 10403 Ki67 [SolA15], PE eBioscience 12-5698-82; RRID: AB_11150954 AnnexinV, PE Life Technologies A35111 pSTAT3 (S727)[49] BD Phosflow 558557 GRIM19 [6E1BH7] Abcam ab110240; RRID: AB_303811 TOMM20 Abcam Ab186734; RRID: AB_2043078 pAMPKa (Thr172) [40H9] CST 2535; RRID: AB_331250 CD41-143Nd [MWreg30] Fluidigm 3143009B SOCS3 [516919] R&D MAB5696; RRID: AB_2193299 pStat5 (Y694)-147Sm [47] Fluidigm 3147012A SOCS1 [4H1] ThermoScientific 37-4100; RRID: AB_10890785 (Continued on next page) e1 Cell Reports 25, 1772–1785.e1–e6, November 13, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER anti-biotin-150Nd Fluidigm 3150008B pAkt (S473) 152Sm [D9E] Fluidigm 3152005A pStat1 (Y701)- 153Eu [58D6] Fluidigm 3153003A CD48-154Sm [HM48-1] Fluidigm 3154004B p38 (T180/Y182)- 156Gd [D3F9] Fluidigm 3156002A pStat3 (Y705)- 158Gd [4] Fluidigm 3158005A pMAPKAPK2 (T334)- 159Tb [27B7] Fluidigm 3159010A pJak2 (Tyr1008) [D4A8] CST 8082S; RRID: AB_10949104 Tie2 [TEK4] Biolegend 124002; RRID: AB_961175 mTOR (phospho S2448) [EPR426(2)] Abcam ab109268; RRID: AB_297588 EPCR [eBio1560] eBioscience 16-2012-83; RRID: AB_657692 CD150 167Er [TC15-12F12.2] Fluidigm 3167004B CD61 [2C9.G2] Biolegend 104302; RRID: AB_313079 Ly-6A/E (Sca-1)- 169Tm [D7] Fluidigm 3169015B pERK 1/2 (T202/Y204)- 171Yb [D13.14.4E] Fluidigm 3171010A CD117 (ckit)- 173Yb [2B8] Fluidigm 3173004B pStat3 (S727) [ab30647] Abcam ab86430; RRID: AB_779085 Pgc1a Abcam ab54481; RRID: AB_881987 Chemicals, Peptides, and Recombinant Proteins Romiplostim Kyowa Kirin n/a MitotrackerTM Green FM ThermoScientific M7514 TMRE Enzo 52309 CellROX ThermoScientific C10448 recombinant human Thpo (PEG-rHuMGDF) Kyowa Kirin n/a Filgrastim Kyowa Kirin n/a antimycin Sigma A8674 rotenone Abcam ab143145 oligomycin Abcam ab141829 FCCP Abcam ab120081 KPT-330 Cayman chemical 18127 murine recombinant SCF Peprotech 250-03 murine recombinant Thpo Peprotech 315-14 cisplatin (Cell-ID Cisplatin) Fluidigm 201198 Critical Commercial Assays CellTiter-Glo 2.0 Assay kit Promega G9241 MegaCult Stem cell Technologies 04960 MethoCult Stem cell Technologies M3234 LIVE/DEAD Viability/cytotoxicity Kit Life Technologies MP03224 SMARTer Ultra Low RNA Kit for Fluidigm C1 system Clonetech 634936 Illumina Nextera XT DNA Sample Preparation Kit Illumina FC-131-1096/FC-131-1002 C1 Single-cell Auto Prep Reagent kit for mRNA-seq Fluidigm 100-6201 Superscript VILO Invitrogen 11754250 RNeasy Mini Kit QIAGEN 74106 IntraPrep reagents Beckman Coulter IM2389 Maxpar antibody labeling kit Fluidigm 201300 MaxPar Fix I buffer Fluidigm 201065 Maxpar Cell Staining Buffer Fluidigm 201068 Cell-ID Intercalator-Ir Fluidigm 201192A Maxpar Fix and Perm Buffer Fluidigm 201057 (Continued on next page) Cell Reports 25, 1772–1785.e1–e6, November 13, 2018 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited Data RNA-seq: Thrombopoietin metabolically primes hematopoietic stem cells to megakaryocyte lineage differentiation This paper GEO: GSE121001 Experimental Models: Organisms/Strains Mouse: Thpo / Toshio Suda Lab n/a Mouse: UBC-GFP (C57BL/6-Tg(UBC-GFP)30Scha/J) Jackson laboratory 004353 Mouse: CD45.1 Jackson laboratory 002014 Mouse: Mito-Dendra2 (Gt(ROSA)26Sortm1.1(CAG-COX8A/ Dendra2)Dcc) Jackson laboratory 018385 Mouse: (Fucci) GMNN-mAG mice (B6.Cg-Tg(FucciS/G2/M)#474Bsi RIKEN RBRC02704 Oligonucleotides Taqman primer: Ppargc1a Thermo Fisher Scientific Mm01208835_m1 Taqman primer: Tfam Thermo Fisher Scientific Mm00447485_m1 Taqman primer: Nrf1 Thermo Fisher Scientific Mm01135606_m1 Taqman primer: Sdhb Thermo Fisher Scientific Mm00458272_m1 Taqman primer: Sdhc Thermo Fisher Scientific Mm00481172_m1 Taqman primer: Atp5a Thermo Fisher Scientific Mm00431960_m1 Taqman primer: Cox5a Thermo Fisher Scientific Mm00432638_m1 Taqman primer: Cyc1 Thermo Fisher Scientific Mm00470540_m1 Taqman primer: Ndufa13 Thermo Fisher Scientific Mm00445751_m1 Taqman primer: B2m Thermo Fisher Scientific Mm03003532_u1 Taqman primer: Bax Thermo Fisher Scientific Mm00432051_m1 Taqman primer: Bak1 Thermo Fisher Scientific Mm00432045_m1 Taqman primer: Bcl2 Thermo Fisher Scientific Mm00477631_m1 Taqman primer: Prdx1 Thermo Fisher Scientific Mm01621996_s1 Taqman primer: Prdx3 Thermo Fisher Scientific Mm00545848_m1 Taqman primer: Gpx1 Thermo Fisher Scientific Mm00656767_g1 Taqman primer: Gpx4 Thermo Fisher Scientific Mm00515041_m1 Taqman primer: Txn2 Thermo Fisher Scientific Mm00444931_m1 Software and Algorithms FlowJo 10.1 Tree Star n/a QuantStudioTM Design and Analysis Software 1.3.1 Thermo Fisher Scientific n/a Agilent Seahorse Wave Desktop Agilent n/a R R Foundation version 3.3.2 Rtsne package version 0.13 Cufflinks version 2.2.1 PANTHER release 20160715 GSEA Broad institute Version 2.0.13 NIS elements Nikon n/a ImageJ n/a Cytobank. n/a flowCore n/a flowViz n/a flowUtils n/a

    Staining:

    Article Title: Thrombopoietin Metabolically Primes Hematopoietic Stem Cells to Megakaryocyte-Lineage Differentiation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD16/32 [93] eBioscience / Biolegend 14-0161 / 101320; RRID: AB_312800/AB_467132 CD16/32 [93], AF700 eBioscience 56-0161-82; RRID: AB_493994 CD4 [RM4-5], PerCp-Cy5.5 Biolegend 100540; RRID: AB_2563022 CD8a [53-6.7], PerCp-Cy5.5 Biolegend 100734; RRID: AB_893427 Gr-1 [RB6-8C5], PerCp-Cy5.5 Biolegend 108428; RRID: AB_893561 Mac-1 [M1/70], PerCp-Cy5.5 Biolegend 101228; RRID: AB_893233 B220 [RA3-6B2], PerCp-Cy5.5 Biolegend 103236; RRID: AB_893356 Ter-119 [TER-119], PerCp-Cy5.5 Biolegend 116228; RRID: AB_893638 c-Kit [2B8], APC-Cy7 Biolegend 105826; RRID: AB_1626280 Sca-1 [D7], PE-Cy7 Biolegend 108114; RIID: AB_493597 Sca-1 [D7], APC-Cy7 Biolegend 108126; RRID: AB_10639725 CD150 [TC15-12F12.2], APC Biolegend 115910; RRID: AB_493461 CD150 [TC15-12F12.2], PE Biolegend 115904; RRID: AB_313682 CD150 [TC15-12F12.2], PEcy7 Biolegend 115914; RRID: AB_439796 CD48 [HM48-1], AF700 Biolegend 103426; RRID: AB_10612754 CD45.1 [A20], PE Biolegend 110708; RRID: AB_313496 CD45.1 [A20], AF700 Biolegend 110724; RRID: AB_493732 CD45.2 [104], APC-Cy7 Biolegend 109824; RRID: AB_830788 CD8a [53-6.7], PE-Cy7 Biolegend 100722; RRID: AB_312760 Gr-1 [RB6-8C5], APC BD 553129; RRID: AB_2314614 Mac-1 [M1/70], APC Biolegend 101212; RRID: AB_312794 B220 [RA3-6B2], PECy7 BD 552772; RRID: AB_394458 c-Kit [2B8], BV421 Biolegend 105828; RRID: AB_10898120 Flt-3 [A2F10.1], APC eBioscience 17-1351-80; RRID: AB_10596653 Flt-3 [A2F10.1], PE Biolegend 135305; RRID: AB_1877217 CD41 [MWReg30], PE BD 558040; RRID: AB_397004 CD41 [MWReg30], APC Invitrogen 17-0411-82; RRID: AB_1603238 IL-7Ra [A7R34], PE eBioscience 12-1271-81; RRID: AB_465845 IL-7Ra [A7R34], BV510 Biolegend 135033; RRID: AB_2564576 Endoglin [MJ7/18] Biolegend 120410; RRID: AB_1027702 CD9 [KMC8], BV421 BD Horizon 564235; RRID: AB_395032 CD34 [RAM34], FITC eBioscience 11-034-85; RRID: AB_465020 Mpl [AMM2], Biotin IBL 10403 Ki67 [SolA15], PE eBioscience 12-5698-82; RRID: AB_11150954 AnnexinV, PE Life Technologies A35111 pSTAT3 (S727)[49] BD Phosflow 558557 GRIM19 [6E1BH7] Abcam ab110240; RRID: AB_303811 TOMM20 Abcam Ab186734; RRID: AB_2043078 pAMPKa (Thr172) [40H9] CST 2535; RRID: AB_331250 CD41-143Nd [MWreg30] Fluidigm 3143009B SOCS3 [516919] R&D MAB5696; RRID: AB_2193299 pStat5 (Y694)-147Sm [47] Fluidigm 3147012A SOCS1 [4H1] ThermoScientific 37-4100; RRID: AB_10890785 (Continued on next page) e1 Cell Reports 25, 1772–1785.e1–e6, November 13, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER anti-biotin-150Nd Fluidigm 3150008B pAkt (S473) 152Sm [D9E] Fluidigm 3152005A pStat1 (Y701)- 153Eu [58D6] Fluidigm 3153003A CD48-154Sm [HM48-1] Fluidigm 3154004B p38 (T180/Y182)- 156Gd [D3F9] Fluidigm 3156002A pStat3 (Y705)- 158Gd [4] Fluidigm 3158005A pMAPKAPK2 (T334)- 159Tb [27B7] Fluidigm 3159010A pJak2 (Tyr1008) [D4A8] CST 8082S; RRID: AB_10949104 Tie2 [TEK4] Biolegend 124002; RRID: AB_961175 mTOR (phospho S2448) [EPR426(2)] Abcam ab109268; RRID: AB_297588 EPCR [eBio1560] eBioscience 16-2012-83; RRID: AB_657692 CD150 167Er [TC15-12F12.2] Fluidigm 3167004B CD61 [2C9.G2] Biolegend 104302; RRID: AB_313079 Ly-6A/E (Sca-1)- 169Tm [D7] Fluidigm 3169015B pERK 1/2 (T202/Y204)- 171Yb [D13.14.4E] Fluidigm 3171010A CD117 (ckit)- 173Yb [2B8] Fluidigm 3173004B pStat3 (S727) [ab30647] Abcam ab86430; RRID: AB_779085 Pgc1a Abcam ab54481; RRID: AB_881987 Chemicals, Peptides, and Recombinant Proteins Romiplostim Kyowa Kirin n/a MitotrackerTM Green FM ThermoScientific M7514 TMRE Enzo 52309 CellROX ThermoScientific C10448 recombinant human Thpo (PEG-rHuMGDF) Kyowa Kirin n/a Filgrastim Kyowa Kirin n/a antimycin Sigma A8674 rotenone Abcam ab143145 oligomycin Abcam ab141829 FCCP Abcam ab120081 KPT-330 Cayman chemical 18127 murine recombinant SCF Peprotech 250-03 murine recombinant Thpo Peprotech 315-14 cisplatin (Cell-ID Cisplatin) Fluidigm 201198 Critical Commercial Assays CellTiter-Glo 2.0 Assay kit Promega G9241 MegaCult Stem cell Technologies 04960 MethoCult Stem cell Technologies M3234 LIVE/DEAD Viability/cytotoxicity Kit Life Technologies MP03224 SMARTer Ultra Low RNA Kit for Fluidigm C1 system Clonetech 634936 Illumina Nextera XT DNA Sample Preparation Kit Illumina FC-131-1096/FC-131-1002 C1 Single-cell Auto Prep Reagent kit for mRNA-seq Fluidigm 100-6201 Superscript VILO Invitrogen 11754250 RNeasy Mini Kit QIAGEN 74106 IntraPrep reagents Beckman Coulter IM2389 Maxpar antibody labeling kit Fluidigm 201300 MaxPar Fix I buffer Fluidigm 201065 Maxpar Cell Staining Buffer Fluidigm 201068 Cell-ID Intercalator-Ir Fluidigm 201192A Maxpar Fix and Perm Buffer Fluidigm 201057 (Continued on next page) Cell Reports 25, 1772–1785.e1–e6, November 13, 2018 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited Data RNA-seq: Thrombopoietin metabolically primes hematopoietic stem cells to megakaryocyte lineage differentiation This paper GEO: GSE121001 Experimental Models: Organisms/Strains Mouse: Thpo / Toshio Suda Lab n/a Mouse: UBC-GFP (C57BL/6-Tg(UBC-GFP)30Scha/J) Jackson laboratory 004353 Mouse: CD45.1 Jackson laboratory 002014 Mouse: Mito-Dendra2 (Gt(ROSA)26Sortm1.1(CAG-COX8A/ Dendra2)Dcc) Jackson laboratory 018385 Mouse: (Fucci) GMNN-mAG mice (B6.Cg-Tg(FucciS/G2/M)#474Bsi RIKEN RBRC02704 Oligonucleotides Taqman primer: Ppargc1a Thermo Fisher Scientific Mm01208835_m1 Taqman primer: Tfam Thermo Fisher Scientific Mm00447485_m1 Taqman primer: Nrf1 Thermo Fisher Scientific Mm01135606_m1 Taqman primer: Sdhb Thermo Fisher Scientific Mm00458272_m1 Taqman primer: Sdhc Thermo Fisher Scientific Mm00481172_m1 Taqman primer: Atp5a Thermo Fisher Scientific Mm00431960_m1 Taqman primer: Cox5a Thermo Fisher Scientific Mm00432638_m1 Taqman primer: Cyc1 Thermo Fisher Scientific Mm00470540_m1 Taqman primer: Ndufa13 Thermo Fisher Scientific Mm00445751_m1 Taqman primer: B2m Thermo Fisher Scientific Mm03003532_u1 Taqman primer: Bax Thermo Fisher Scientific Mm00432051_m1 Taqman primer: Bak1 Thermo Fisher Scientific Mm00432045_m1 Taqman primer: Bcl2 Thermo Fisher Scientific Mm00477631_m1 Taqman primer: Prdx1 Thermo Fisher Scientific Mm01621996_s1 Taqman primer: Prdx3 Thermo Fisher Scientific Mm00545848_m1 Taqman primer: Gpx1 Thermo Fisher Scientific Mm00656767_g1 Taqman primer: Gpx4 Thermo Fisher Scientific Mm00515041_m1 Taqman primer: Txn2 Thermo Fisher Scientific Mm00444931_m1 Software and Algorithms FlowJo 10.1 Tree Star n/a QuantStudioTM Design and Analysis Software 1.3.1 Thermo Fisher Scientific n/a Agilent Seahorse Wave Desktop Agilent n/a R R Foundation version 3.3.2 Rtsne package version 0.13 Cufflinks version 2.2.1 PANTHER release 20160715 GSEA Broad institute Version 2.0.13 NIS elements Nikon n/a ImageJ n/a Cytobank. n/a flowCore n/a flowViz n/a flowUtils n/a

    Software:

    Article Title: Dissecting Cell Lineage Specification and Sex Fate Determination in Gonadal Somatic Cells Using Single-Cell Transcriptomics.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Polyclonal Antibody Thermo Fisher Scientific Cat# A10262, RRID:AB_2534023 Human COUP-TF II/NR2F2 Antibody Perseus Proteomics Cat# PP-H7147-00, RRID:AB_2155627 Rabbit anti-FOXL2 Gift from Dagmar Wilhelm N/A Chemicals, Peptides, and Recombinant Proteins Trypsin-EDTA (0.05%), phenol red Thermo Fisher Scientific 25300054 DPBS, no calcium, no magnesium Thermo Fisher Scientific 14190144 Fetal bovine serum Thermo Fisher Scientific 26140087 Critical Commercial Assays C1 IFC for mRNA-seq (5-10 mM) Fluidigm 1005759 C1 Single-Cell Auto Prep Kit for mRNA Seq Fluidigm 100-6209 C1 Single-Cell Auto Prep Reagent Kit for mRNA Seq Fluidigm 100-6201 SMARTer Ultra Low RNA Kit for the Fluidigm C1 System Fluidigm 634833 Nextera XT DNA Sample Preparation Kit Illumina FC-131-1096 Nextera XT DNA Sample Preparation Index Kits A-D Illumina FC-131-2001-4 Agencourt AMPure XP beads Beckman Coulter A63880 Qubit dsDNA High Sensitivity Life Technologies Q32854 Agilent High Sensitivity DNA Kit Reagents Agilent 5067-4626 Deposited Data Raw data, normalized counts matrix for XY data GEO GSE97519 Raw data, normalized counts matrix for XX data GEO GSE119766 Scripts for analysis GitHub https://github.com/IStevant/mouse-gonad-scRNA-seq Experimental Models: Organisms/Strains Mus musculus: CD-1 Charles River Strain code 022 Mus musculus: CD-1-Tg(Nr5a1-GFP) Stallings et al., 2002 N/A Oligonucleotides Primers for sex genotyping McFarlane et al., 2013 N/A Software and Algorithms Gem mapper (version 1.7.1) Marco-Sola et al., 2012 N/A SamTools (version 0.1.19) Li et al., 2009 http://www.htslib.org/ R (version 3.4.3) N/A https://www.R-project.org/ FactoMineR Lê et al., 2008 http://factominer.free.fr/ Destiny Angerer et al., 2016 https://github.com/theislab/destiny Slingshot Street et al., 2018 https://github.com/kstreet13/slingshot Monocle2 Qiu et al., 2017 https://github.com/cole-trapnell-lab/monocle-release Ggplot2 Wickham, 2009 https://ggplot2.tidyverse.org/ Pheatmap N/A https://github.com/raivokolde/pheatmap ..

    Article Title: Single-Cell Transcriptome Analysis Reveals Estrogen Signaling Coordinately Augments One-Carbon, Polyamine, and Purine Synthesis in Breast Cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins 17b-estradiol (E2) Sigma Cat# 50-28-2 Critical Commercial Assays RNeasy Mini Kit QIAGEN Cat# 74106 SMARTer Ultra Low RNA Kit Clontech Cat# 634936 C1 Single-Cell mRNA Seq IFC Fluidigm Cat# 100-6041 C1 Single-Cell Reagent Kit for mRNA Seq Fluidigm Cat# 100-6201 C1 Single-Cell mRNA Seq HT IFC Fluidigm Cat# 101-4982 C1 Single-Cell mRNA Seq HT Reagent Kit v2 Fluidigm Cat# 101-3473 Nextera XT Sample Prep Kit Illumina Cat# FC-131-1096 Nextera XT DNA Sample Preparation Index Kit Illumina Cat# FC-131-1002 KAPA Library Quantification Kit KAPA Biosystems Cat# KR0405 Nextera XT Index Kit v2 Illumina Cat# FC-131-2001(set A) and FC-131-2002(set B). ddPCR Supermix for Probes (no dUTP) BioRad Cat# 186-3024 ddPCR Droplet Reader Oil BioRad Cat# 186-3004 DG8 Cartridges and Gaskets BioRad Cat# 186-4007 ddPCR 96-Well PCR Plates BioRad Cat# 12001925 RNAscope Multiplex Fluorescent v2 Kit ACDbio Cat# 323110 Cell apoptosis kit ThermoFisher Cat# V13245 MTT ThermoFisher Cat# M6494 Deposited Data Raw and analyzed data This paper GEO: GSE107864, GSE119455 Genome reference UCSC hg19 UCSC http://hgdownload.soe.ucsc.edu/goldenPath/ hg19/bigZips/ Gene annotation reference Gencode V18 Gencode database https://www.gencodegenes.org/18.html ERa ChIP-seq data Ross-Innes et al., 2012 GEO: GSE32222 Experimental Models: Cell Lines Human: MCF7 ATCC ATCC HTB-22 Human: T47D ATCC ATCC HTB-133 Oligonucleotides Primer sets and probes used in droplet digital PCR (Table S2) This paper N/A DsiRNAs used for knockdown assays (Table S3) This paper N/A Software and Algorithms Tophat v2.0.6 Kim et al., 2013 https://ccb.jhu.edu/software/tophat/index.shtml Cufflink v2.0.2 Trapnell et al., 2012 http://cole-trapnell-lab.github.io/cufflinks FastQC v0.11.5 https://www.bioinformatics. babraham.ac.uk/projects/fastqc/ https://www.bioinformatics.babraham.ac.uk/ projects/download.html#fastqc RSeQC v2.6.4 Wang et al., 2012 http://rseqc.sourceforge.net/ SIBER (OOMPA v2.1.0) Tong et al., 2013 http://bioinformatics.mdanderson.org/main/ OOMPA:Overview bc-GenExMiner 4.0 Jézéquel et al., 2012 http://bcgenex.centregauducheau.fr/BC-GEM/ GEM-Accueil.php?js=1 DAVID website v6.8 Huang et al., 2009 https://david.ncifcrf.gov/ GSEA software (MSigDB 6.2) Subramanian et al., 2005 http://software.broadinstitute.org/gsea/index.jsp Cell Reports 25, 2285–2298.e1–e4, November 20, 2018 e1 ..

    Article Title: Transcriptional Convergence of Oligodendrocyte Lineage Progenitors during Development.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Chicken polyclonal anti-GFP Abcam ab13970, RRID:AB_300798 Goat polyclonal anti-PDGFRA R&D AF1062, RRID:AB_2236897 Rabbit polyclonal anti-COL1A1 Abcam ab21286, RRID:AB_446161 Mouse monoclonal anti-CC1 (anti-APC) Millipore OP80, RRID:AB_2057371 Rabbit polyclonal anti-NG2 Millipore AB5320, RRID:AB_11213678 Experimental Models: Organisms/Strains Pdgfra-CreERT1/RCE (mouse) The Jackson Laboratory B6N.Cg-Tg(Pdgfra-CreERT)467Dbe/J crossed with Gt(ROSA)26Sortm1.1(CAG-EGFP)Fsh/Mmjax Pdgfra-H2BGFP (mouse) Philippe Soriano B6.129S4-Pdgfratm11(EGFP)Sor/J Critical Commercial Assays Neural tissue dissociation kit (P) Miltenyi 130-092-628 C1 Single-Cell Reagent Kit for mRNA Seq Fluidigm 100-6201 miRNeasy micro kit Qiagen 217084 MaxTract High density Qiagen 29046 QuBit RNA HS assay kit ThermoFisher Q32852 RNA 6000 Pico Kit Agilent 5067-1513 TruSeq Stranded Total RNA Library Prep Kit Illumina 20020596 Other C1 Single-Cell Open App IFC, 10–17 mm Fluidigm 100-8134 C1 instrument Fluidigm N/A FACSAria III Cell Sorter B5/R3/V3 BD biosciences N/A Axopatch 200B Amplifier Molecular Devices N/A Digidata 1322A Molecular Devices N/A Nikon Ti-E with motorized stage Nikon N/A 7900HT Fast System Applied biosystems N/A Software and Algorithms FastQC Andrews (2010) https://www.bioinformatics.babraham.ac.uk/ projects/fastqc/ STAR (v.2.5.0a) Dobin et al. (2013) https://github.com/alexdobin/STAR GENCODE M8 annotations Mudge and Harrow (2015) https://www.gencodegenes.org/ featureCounts v1.5.0-p1 Liao et al. (2014) http://bioinf.wehi.edu.au/featureCounts/ Bioconductor packages Gentleman et al. (2004) https://www.bioconductor.org/ biomaRt library Durinck et al. (2009) https://bioconductor.org/packages/release/bioc/ html/biomaRt.html limma package Ritchie et al. (2015) http://bioconductor.org/packages/release/bioc/ html/limma.html DESeq2 package Love et al. (2014) http://bioconductor.org/packages/release/bioc/ html/DESeq2.html heatmap3 library Zhao et al. (2014) https://cran.r-project.org/web/packages/ heatmap3/index.html RNASeqPower library Hart et al. (2013) https://bioconductor.org/packages/release/bioc/ html/RNASeqPower.html topGO R package Alexa and Rahnenfuhrer (2016) https://bioconductor.org/packages/release/bioc/ html/topGO.html (Continued on next page) e1 Developmental Cell 46, 504–517.e1–e7, August 20, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fisher-elim algorithm Alexa et al. (2006) https://bioconductor.org/packages/3.7/bioc/ vignettes/topGO/inst/doc/topGO.pdf Cytoscape Cline et al. (2007) http://www.cytoscape.org/ EnrichmentMap plugin Merico et al. (2010) http://baderlab.org/Software/EnrichmentMap HISAT2 version 2.0.5 Kim et al. (2015) https://ccb.jhu.edu/software/hisat2/index.shtml Stringtie 1.3.1c Pertea et al. (2015) http://www.ccb.jhu.edu/software/stringtie/ BackSPIN2 algorithm Marques et al. (2016) https://github.com/linnarsson-lab/BackSPIN Rpackage DPT Haghverdi et al. (2016) https://www.rdocumentation.org/packages/ destiny/versions/2.0.4/topics/DPT PAGODA (SCDE R-package) Fan et al. (2016) http://hms-dbmi.github.io/scde/ MAST package R Finak et al. (2015) https://github.com/RGLab/MAST SCN3E This paper https://github.com/Castelo-Branco-lab/ OPCsinglecell2017 Deposited Data Raw and Analysed data This paper GEO: GSE95194 (single cell) and GEO: GSE95093 (bulk) Other Webresource with browsable data This paper https://ki.se/en/mbb/oligointernode

    other:

    Article Title: Resolving Cell Fate Decisions during Somatic Cell Reprogramming by Single-Cell RNA-Seq.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies PE anti-mouse CD34 Biolegend Cat# 119307; RRID: AB_493401 Alexa Fluor 647 anti-mouse CD104 Biolegend Cat# 123607; RRID: AB_2563511 Mouse IFN-a/b R1 Antibody R&D Systems Cat# AF3039; RRID: AB_664107 Anti-IFNAR1-1, clone MARI-5A3 Millipore Cat# 04-151; RRID: AB_11213383 Anti-Mouse CD119 (IFN gamma recepter 1) Functional Grade Purified Thermo Fisher Scientific Cat# 16-1193; RRID: AB_2573079 Anti-Mouse Interferon Beta, Rabbit Serum R&D Systems Cat# 32400-1; RRID: AB_2121718 Anti-Mouse IFN gamma Functional Grade purified Thermo Fisher Scientific Cat# 16-7311; RRID: AB_469243 Chemicals, Peptides, and Recombinant Proteins Recombinant Mouse IFNb R&D Systems Cat# 8234-MB-010 Recombinant Mouse IFNg R&D Systems Cat# 485-MI-100 Leukemia Inhibitory Factor (LIF) Millipore Cat# ESGE107 CHIR99021 This paper N/A PD0325901 This paper N/A Y27632 Chembest Cat# C14357 iCD1 mouse iPS inducing complete medium for the reprogramming of mouse iPS cells DeliCell Cat# 820250 Fetal Bovine Serum Moregate Batch# 67301120 DMEM-Dulbecco’s Modified Eagle Medium, High Glucose Hyclone Cat# SH30022-2B GlutaMAX GIBCO Cat# 35050079 Non-Essential Amino Acids Solution GIBCO Cat# 11140076 2-Mercaptoethoethanol GIBCO Cat# 21985-023 Sodium Pyruvate Solution GIBCO Cat# 11360070 Penicillin-Streptomycin Solution Hyclone Cat# SV30010 Phosphate-Buffer Saline (PBS) GIBCO Cat# C14190500BT Trypsin-EDTA (0.05%), phenol red GIBCO Cat# 25300120 Trypsin-EDTA (0.25%), phenol red GIBCO Cat# 25200114 0.1% Gelatin Solution Millipore Cat# ES-006-B DAPI Sigma Cat# D9542 TRI Reagent MRC Cat# TR118-200 Puromycin Dihydrochloride Thermo Fisher Scientific Cat# A1113803 Mineral Oil, Light Thermo Fisher Scientific Cat# O121-20 KSOM Embryo Culture (1x) Millipore Cat# MR-020P-5F M2 Medium (1x) Millipore Cat# MR-015P-5F ReverTra Ace Toyobo Cat# A3477L Oligo-dT TaKaRa Cat# D511 RRI TaKaRa Cat# D2313A SsoAdvanced Universal SYBR Green Supermix Bio-Rad Cat# 172-5274 Critical Commercial Assays SMARTer Ultra Low RNA Kit for Illumina Sequencing Clonetech Cat# 643833 C1 Single-Cell Auto Prep Reagent Kit for mRNA Seq Fluidigm Cat# 100-6201 Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Cat# P7589 C1 IFC for mRNA seq (10-17 mm) Fluidigm Cat# 100-5760 (Continued on next page) e1 Molecular Cell 73, 1–15.e1–e7, February 21, 2019

    Activation Assay:

    Article Title: Tumor-associated high endothelial venules mediate lymphocyte entry into tumors and predict response to PD-1 plus CTLA-4 combination immunotherapy.
    Article Snippet: Patient samples are detailed in Table S3 MSN-08-027 CPP Ile de France Registration number : 2008-A00373-52 Chemicals, peptides, and recombinant proteins MAXblock Blocking Medium Active motif Cat# 15252 BD Cytofix/Cytoperm Fixation/Permeablization Kit BD Biosciences Cat# 554714 OCT embedding matrix CellPath Cat # KMA-0100-00A Collagenase IV Gibco Cat# KMA-0100-00A CellTracker Deep Red Dye Invitrogen Cat# 17104-019 CellTrace CFSE Cell Proliferation Kit Invitrogen Cat# C34656 Calcein AM cell-permanent dye Invitrogen Cat# C34554 Qtracker 565 Vascular Labels Invitrogen Cat# Q21031MP Fixable viability dye eFluor 506 Invitrogen Cat# 65-0866-14 FoxP3/Transcription factor staining buffer set Invitrogen Cat# 00-5523-00 ACK lysing buffer Lonza Cat# 00-5523-00 RLT buffer Qiagen Cat# 79216 RNeasy Mini Kit Qiagen Cat# 10-548E Collagenase VIII Sigma Cat# 74104 (Continued on next page) e2 Cancer Cell 40, 318–334.e1–e9, March 14, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER DNaseI Sigma Cat# 74104 Fingolimod (FTY720) Selleckchem Cat# S5002 Cell Activation Cocktail (with Brefeldin A) BioLegend Cat # 423303 SuperScript VILO cDNA Synthesis Kit ThermoFischer Scientific Cat # 11754050 Power SYBR Green PCR Master Mix ThermoFischer Scientific Cat # 4368577 Critical commercial assays C1 Single-Cell Reagent Kit for mRNA Seq Fluidigm Cat# 100-6201 ArrayControl RNA Spikes ThermoFisher Cat# AM1780 SMARTer Ultra Low RNA Kit for the Fluidigm C1 System Takara Cat# 634833 Nextera XT kit Illumina Cat# FC-131-1096 High Sensitivity NGS Fragment Analysis kit Agilent Cat# DNF-474 EasySep Mouse T Cell Isolation Kit StemCell Cat# 19851 EasySep Mouse CD4+ T Cell Isolation Kit StemCell Cat# 19852 Mouse CD8a + T Cell Isolation Kit Miltenyi Biotec Cat# 130-104-075 Mouse CD62L MicroBeads Miltenyi Biotec Cat# 130-049-701 Deposited data RNA-Seq data This paper GEO Series accession number - GEO: GSE154898 Mouse reference genome UCSC mm10 Genome Reference Consortium https://genome.ucsc.edu/ cgi-bin/hgGateway?db=mm10 Experimental models: Cell lines MCAreg (1969) fibrosarcoma Diamond et al. (2011) Gift from Robert Schreiber (Washington University School of Medicine, Saint-Louis, USA) MCAprog (9609) fibrosarcoma O’Sullivan et al. (2012) Gift from Robert Schreiber (Washington University School of Medicine, Saint-Louis, USA) MMTV-PyMT mammary carcinoma-derived VO-PyMT cells (PyMT) Halpern et al. (2006) Gift from Zena Werb (University of California, San Francisco, USA) CT26 colon carcinoma cells ATCC Cat# ATCC CRL-2638 Experimental models: Organisms/strains Mouse: C57BL/6 Charles River Cat# 027 Mouse: BALB/C Charles River Cat# 028 Mouse: FVB Charles River Cat# 207 Mouse: Rag2-/- House Breeding Oligonucleotides Primer: Ackr1 Forward: AGGATGCTATGCTTGCCTGAA This paper Primer: Ackr1 Reverse: GGTGAAGCCACGGAGTTGA This paper Primer: Fut7 Forward: CAGATGCACCCTCTAGTACTCT This paper N/A Primer: Fut7 Reverse: TGCACTGTCCTTCCACAACC This paper N/A Primer: Glycam1 Forward: GTCCACTCCCACCAGCTACAC This paper N/A Primer: Glycam1 Reverse: GGCTCCTTGGAAAGGTCCTT This paper N/A Primer: Sele Forward: TCCTGCGAAGAAGGATTTGAA This paper N/A Primer: Sele Reverse: CCCCTCTTGGACCACACTGA This paper N/A Primer: Selp Forward: CTCATCTGGTTCAGTGCTTTGATC This paper N/A Primer: Selp Reverse: TCCACGCAGCCACTTCCT This paper N/A Primer: Hprt Forward: CCTAAGATGAGCGCAAAGTTGAA This paper N/A Primer: Hprt Reverse: CCACAGGACTAGAACACCTGCT This paper N/A (Continued on next page) Cancer Cell 40, 318–334.e1–e9, March 14, 2022 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms DiVa V8.0.1 BD Biosciences FlowJo v10.1 Tree Star https://www.flowjo.com/ GraphPad Prism 8.2.1 GraphPad www.graphpad.com RSEM 1.2.18 Li and Dewey (2011) https://github.com/deweylab/RSEM Tophat2 2.0.14 Kim et al. (2013) http://ccb.jhu.edu/software/tophat/ index.shtml Fastq Screen v0.9.5 Wingett and Andrews (2018) https://github.com/StevenWingett/ FastQ-Screen FastQC 0.11.2 https://github.com/s-andrews/FastQC Trimmomatic-32 Bolger et al. (2014) https://github.com/genepattern/ Trimmomatic Monocle 2.0.4 Qiu et al. (2017) https://github.com/cole-trapnell-lab/ monocle-release R 3.3.0 (packages: ggplot2 2.2.1; grid 3.3.2; gridExtra2.3; reshape2 1.4.3; scales 0.5.0; R package Monocle v2.4.0) https://cran.r-project.org/bin/windows/ base

    cDNA Synthesis:

    Article Title: Tumor-associated high endothelial venules mediate lymphocyte entry into tumors and predict response to PD-1 plus CTLA-4 combination immunotherapy.
    Article Snippet: Patient samples are detailed in Table S3 MSN-08-027 CPP Ile de France Registration number : 2008-A00373-52 Chemicals, peptides, and recombinant proteins MAXblock Blocking Medium Active motif Cat# 15252 BD Cytofix/Cytoperm Fixation/Permeablization Kit BD Biosciences Cat# 554714 OCT embedding matrix CellPath Cat # KMA-0100-00A Collagenase IV Gibco Cat# KMA-0100-00A CellTracker Deep Red Dye Invitrogen Cat# 17104-019 CellTrace CFSE Cell Proliferation Kit Invitrogen Cat# C34656 Calcein AM cell-permanent dye Invitrogen Cat# C34554 Qtracker 565 Vascular Labels Invitrogen Cat# Q21031MP Fixable viability dye eFluor 506 Invitrogen Cat# 65-0866-14 FoxP3/Transcription factor staining buffer set Invitrogen Cat# 00-5523-00 ACK lysing buffer Lonza Cat# 00-5523-00 RLT buffer Qiagen Cat# 79216 RNeasy Mini Kit Qiagen Cat# 10-548E Collagenase VIII Sigma Cat# 74104 (Continued on next page) e2 Cancer Cell 40, 318–334.e1–e9, March 14, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER DNaseI Sigma Cat# 74104 Fingolimod (FTY720) Selleckchem Cat# S5002 Cell Activation Cocktail (with Brefeldin A) BioLegend Cat # 423303 SuperScript VILO cDNA Synthesis Kit ThermoFischer Scientific Cat # 11754050 Power SYBR Green PCR Master Mix ThermoFischer Scientific Cat # 4368577 Critical commercial assays C1 Single-Cell Reagent Kit for mRNA Seq Fluidigm Cat# 100-6201 ArrayControl RNA Spikes ThermoFisher Cat# AM1780 SMARTer Ultra Low RNA Kit for the Fluidigm C1 System Takara Cat# 634833 Nextera XT kit Illumina Cat# FC-131-1096 High Sensitivity NGS Fragment Analysis kit Agilent Cat# DNF-474 EasySep Mouse T Cell Isolation Kit StemCell Cat# 19851 EasySep Mouse CD4+ T Cell Isolation Kit StemCell Cat# 19852 Mouse CD8a + T Cell Isolation Kit Miltenyi Biotec Cat# 130-104-075 Mouse CD62L MicroBeads Miltenyi Biotec Cat# 130-049-701 Deposited data RNA-Seq data This paper GEO Series accession number - GEO: GSE154898 Mouse reference genome UCSC mm10 Genome Reference Consortium https://genome.ucsc.edu/ cgi-bin/hgGateway?db=mm10 Experimental models: Cell lines MCAreg (1969) fibrosarcoma Diamond et al. (2011) Gift from Robert Schreiber (Washington University School of Medicine, Saint-Louis, USA) MCAprog (9609) fibrosarcoma O’Sullivan et al. (2012) Gift from Robert Schreiber (Washington University School of Medicine, Saint-Louis, USA) MMTV-PyMT mammary carcinoma-derived VO-PyMT cells (PyMT) Halpern et al. (2006) Gift from Zena Werb (University of California, San Francisco, USA) CT26 colon carcinoma cells ATCC Cat# ATCC CRL-2638 Experimental models: Organisms/strains Mouse: C57BL/6 Charles River Cat# 027 Mouse: BALB/C Charles River Cat# 028 Mouse: FVB Charles River Cat# 207 Mouse: Rag2-/- House Breeding Oligonucleotides Primer: Ackr1 Forward: AGGATGCTATGCTTGCCTGAA This paper Primer: Ackr1 Reverse: GGTGAAGCCACGGAGTTGA This paper Primer: Fut7 Forward: CAGATGCACCCTCTAGTACTCT This paper N/A Primer: Fut7 Reverse: TGCACTGTCCTTCCACAACC This paper N/A Primer: Glycam1 Forward: GTCCACTCCCACCAGCTACAC This paper N/A Primer: Glycam1 Reverse: GGCTCCTTGGAAAGGTCCTT This paper N/A Primer: Sele Forward: TCCTGCGAAGAAGGATTTGAA This paper N/A Primer: Sele Reverse: CCCCTCTTGGACCACACTGA This paper N/A Primer: Selp Forward: CTCATCTGGTTCAGTGCTTTGATC This paper N/A Primer: Selp Reverse: TCCACGCAGCCACTTCCT This paper N/A Primer: Hprt Forward: CCTAAGATGAGCGCAAAGTTGAA This paper N/A Primer: Hprt Reverse: CCACAGGACTAGAACACCTGCT This paper N/A (Continued on next page) Cancer Cell 40, 318–334.e1–e9, March 14, 2022 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms DiVa V8.0.1 BD Biosciences FlowJo v10.1 Tree Star https://www.flowjo.com/ GraphPad Prism 8.2.1 GraphPad www.graphpad.com RSEM 1.2.18 Li and Dewey (2011) https://github.com/deweylab/RSEM Tophat2 2.0.14 Kim et al. (2013) http://ccb.jhu.edu/software/tophat/ index.shtml Fastq Screen v0.9.5 Wingett and Andrews (2018) https://github.com/StevenWingett/ FastQ-Screen FastQC 0.11.2 https://github.com/s-andrews/FastQC Trimmomatic-32 Bolger et al. (2014) https://github.com/genepattern/ Trimmomatic Monocle 2.0.4 Qiu et al. (2017) https://github.com/cole-trapnell-lab/ monocle-release R 3.3.0 (packages: ggplot2 2.2.1; grid 3.3.2; gridExtra2.3; reshape2 1.4.3; scales 0.5.0; R package Monocle v2.4.0) https://cran.r-project.org/bin/windows/ base

    SYBR Green Assay:

    Article Title: Tumor-associated high endothelial venules mediate lymphocyte entry into tumors and predict response to PD-1 plus CTLA-4 combination immunotherapy.
    Article Snippet: Patient samples are detailed in Table S3 MSN-08-027 CPP Ile de France Registration number : 2008-A00373-52 Chemicals, peptides, and recombinant proteins MAXblock Blocking Medium Active motif Cat# 15252 BD Cytofix/Cytoperm Fixation/Permeablization Kit BD Biosciences Cat# 554714 OCT embedding matrix CellPath Cat # KMA-0100-00A Collagenase IV Gibco Cat# KMA-0100-00A CellTracker Deep Red Dye Invitrogen Cat# 17104-019 CellTrace CFSE Cell Proliferation Kit Invitrogen Cat# C34656 Calcein AM cell-permanent dye Invitrogen Cat# C34554 Qtracker 565 Vascular Labels Invitrogen Cat# Q21031MP Fixable viability dye eFluor 506 Invitrogen Cat# 65-0866-14 FoxP3/Transcription factor staining buffer set Invitrogen Cat# 00-5523-00 ACK lysing buffer Lonza Cat# 00-5523-00 RLT buffer Qiagen Cat# 79216 RNeasy Mini Kit Qiagen Cat# 10-548E Collagenase VIII Sigma Cat# 74104 (Continued on next page) e2 Cancer Cell 40, 318–334.e1–e9, March 14, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER DNaseI Sigma Cat# 74104 Fingolimod (FTY720) Selleckchem Cat# S5002 Cell Activation Cocktail (with Brefeldin A) BioLegend Cat # 423303 SuperScript VILO cDNA Synthesis Kit ThermoFischer Scientific Cat # 11754050 Power SYBR Green PCR Master Mix ThermoFischer Scientific Cat # 4368577 Critical commercial assays C1 Single-Cell Reagent Kit for mRNA Seq Fluidigm Cat# 100-6201 ArrayControl RNA Spikes ThermoFisher Cat# AM1780 SMARTer Ultra Low RNA Kit for the Fluidigm C1 System Takara Cat# 634833 Nextera XT kit Illumina Cat# FC-131-1096 High Sensitivity NGS Fragment Analysis kit Agilent Cat# DNF-474 EasySep Mouse T Cell Isolation Kit StemCell Cat# 19851 EasySep Mouse CD4+ T Cell Isolation Kit StemCell Cat# 19852 Mouse CD8a + T Cell Isolation Kit Miltenyi Biotec Cat# 130-104-075 Mouse CD62L MicroBeads Miltenyi Biotec Cat# 130-049-701 Deposited data RNA-Seq data This paper GEO Series accession number - GEO: GSE154898 Mouse reference genome UCSC mm10 Genome Reference Consortium https://genome.ucsc.edu/ cgi-bin/hgGateway?db=mm10 Experimental models: Cell lines MCAreg (1969) fibrosarcoma Diamond et al. (2011) Gift from Robert Schreiber (Washington University School of Medicine, Saint-Louis, USA) MCAprog (9609) fibrosarcoma O’Sullivan et al. (2012) Gift from Robert Schreiber (Washington University School of Medicine, Saint-Louis, USA) MMTV-PyMT mammary carcinoma-derived VO-PyMT cells (PyMT) Halpern et al. (2006) Gift from Zena Werb (University of California, San Francisco, USA) CT26 colon carcinoma cells ATCC Cat# ATCC CRL-2638 Experimental models: Organisms/strains Mouse: C57BL/6 Charles River Cat# 027 Mouse: BALB/C Charles River Cat# 028 Mouse: FVB Charles River Cat# 207 Mouse: Rag2-/- House Breeding Oligonucleotides Primer: Ackr1 Forward: AGGATGCTATGCTTGCCTGAA This paper Primer: Ackr1 Reverse: GGTGAAGCCACGGAGTTGA This paper Primer: Fut7 Forward: CAGATGCACCCTCTAGTACTCT This paper N/A Primer: Fut7 Reverse: TGCACTGTCCTTCCACAACC This paper N/A Primer: Glycam1 Forward: GTCCACTCCCACCAGCTACAC This paper N/A Primer: Glycam1 Reverse: GGCTCCTTGGAAAGGTCCTT This paper N/A Primer: Sele Forward: TCCTGCGAAGAAGGATTTGAA This paper N/A Primer: Sele Reverse: CCCCTCTTGGACCACACTGA This paper N/A Primer: Selp Forward: CTCATCTGGTTCAGTGCTTTGATC This paper N/A Primer: Selp Reverse: TCCACGCAGCCACTTCCT This paper N/A Primer: Hprt Forward: CCTAAGATGAGCGCAAAGTTGAA This paper N/A Primer: Hprt Reverse: CCACAGGACTAGAACACCTGCT This paper N/A (Continued on next page) Cancer Cell 40, 318–334.e1–e9, March 14, 2022 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms DiVa V8.0.1 BD Biosciences FlowJo v10.1 Tree Star https://www.flowjo.com/ GraphPad Prism 8.2.1 GraphPad www.graphpad.com RSEM 1.2.18 Li and Dewey (2011) https://github.com/deweylab/RSEM Tophat2 2.0.14 Kim et al. (2013) http://ccb.jhu.edu/software/tophat/ index.shtml Fastq Screen v0.9.5 Wingett and Andrews (2018) https://github.com/StevenWingett/ FastQ-Screen FastQC 0.11.2 https://github.com/s-andrews/FastQC Trimmomatic-32 Bolger et al. (2014) https://github.com/genepattern/ Trimmomatic Monocle 2.0.4 Qiu et al. (2017) https://github.com/cole-trapnell-lab/ monocle-release R 3.3.0 (packages: ggplot2 2.2.1; grid 3.3.2; gridExtra2.3; reshape2 1.4.3; scales 0.5.0; R package Monocle v2.4.0) https://cran.r-project.org/bin/windows/ base

    Polymerase Chain Reaction:

    Article Title: Tumor-associated high endothelial venules mediate lymphocyte entry into tumors and predict response to PD-1 plus CTLA-4 combination immunotherapy.
    Article Snippet: Patient samples are detailed in Table S3 MSN-08-027 CPP Ile de France Registration number : 2008-A00373-52 Chemicals, peptides, and recombinant proteins MAXblock Blocking Medium Active motif Cat# 15252 BD Cytofix/Cytoperm Fixation/Permeablization Kit BD Biosciences Cat# 554714 OCT embedding matrix CellPath Cat # KMA-0100-00A Collagenase IV Gibco Cat# KMA-0100-00A CellTracker Deep Red Dye Invitrogen Cat# 17104-019 CellTrace CFSE Cell Proliferation Kit Invitrogen Cat# C34656 Calcein AM cell-permanent dye Invitrogen Cat# C34554 Qtracker 565 Vascular Labels Invitrogen Cat# Q21031MP Fixable viability dye eFluor 506 Invitrogen Cat# 65-0866-14 FoxP3/Transcription factor staining buffer set Invitrogen Cat# 00-5523-00 ACK lysing buffer Lonza Cat# 00-5523-00 RLT buffer Qiagen Cat# 79216 RNeasy Mini Kit Qiagen Cat# 10-548E Collagenase VIII Sigma Cat# 74104 (Continued on next page) e2 Cancer Cell 40, 318–334.e1–e9, March 14, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER DNaseI Sigma Cat# 74104 Fingolimod (FTY720) Selleckchem Cat# S5002 Cell Activation Cocktail (with Brefeldin A) BioLegend Cat # 423303 SuperScript VILO cDNA Synthesis Kit ThermoFischer Scientific Cat # 11754050 Power SYBR Green PCR Master Mix ThermoFischer Scientific Cat # 4368577 Critical commercial assays C1 Single-Cell Reagent Kit for mRNA Seq Fluidigm Cat# 100-6201 ArrayControl RNA Spikes ThermoFisher Cat# AM1780 SMARTer Ultra Low RNA Kit for the Fluidigm C1 System Takara Cat# 634833 Nextera XT kit Illumina Cat# FC-131-1096 High Sensitivity NGS Fragment Analysis kit Agilent Cat# DNF-474 EasySep Mouse T Cell Isolation Kit StemCell Cat# 19851 EasySep Mouse CD4+ T Cell Isolation Kit StemCell Cat# 19852 Mouse CD8a + T Cell Isolation Kit Miltenyi Biotec Cat# 130-104-075 Mouse CD62L MicroBeads Miltenyi Biotec Cat# 130-049-701 Deposited data RNA-Seq data This paper GEO Series accession number - GEO: GSE154898 Mouse reference genome UCSC mm10 Genome Reference Consortium https://genome.ucsc.edu/ cgi-bin/hgGateway?db=mm10 Experimental models: Cell lines MCAreg (1969) fibrosarcoma Diamond et al. (2011) Gift from Robert Schreiber (Washington University School of Medicine, Saint-Louis, USA) MCAprog (9609) fibrosarcoma O’Sullivan et al. (2012) Gift from Robert Schreiber (Washington University School of Medicine, Saint-Louis, USA) MMTV-PyMT mammary carcinoma-derived VO-PyMT cells (PyMT) Halpern et al. (2006) Gift from Zena Werb (University of California, San Francisco, USA) CT26 colon carcinoma cells ATCC Cat# ATCC CRL-2638 Experimental models: Organisms/strains Mouse: C57BL/6 Charles River Cat# 027 Mouse: BALB/C Charles River Cat# 028 Mouse: FVB Charles River Cat# 207 Mouse: Rag2-/- House Breeding Oligonucleotides Primer: Ackr1 Forward: AGGATGCTATGCTTGCCTGAA This paper Primer: Ackr1 Reverse: GGTGAAGCCACGGAGTTGA This paper Primer: Fut7 Forward: CAGATGCACCCTCTAGTACTCT This paper N/A Primer: Fut7 Reverse: TGCACTGTCCTTCCACAACC This paper N/A Primer: Glycam1 Forward: GTCCACTCCCACCAGCTACAC This paper N/A Primer: Glycam1 Reverse: GGCTCCTTGGAAAGGTCCTT This paper N/A Primer: Sele Forward: TCCTGCGAAGAAGGATTTGAA This paper N/A Primer: Sele Reverse: CCCCTCTTGGACCACACTGA This paper N/A Primer: Selp Forward: CTCATCTGGTTCAGTGCTTTGATC This paper N/A Primer: Selp Reverse: TCCACGCAGCCACTTCCT This paper N/A Primer: Hprt Forward: CCTAAGATGAGCGCAAAGTTGAA This paper N/A Primer: Hprt Reverse: CCACAGGACTAGAACACCTGCT This paper N/A (Continued on next page) Cancer Cell 40, 318–334.e1–e9, March 14, 2022 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms DiVa V8.0.1 BD Biosciences FlowJo v10.1 Tree Star https://www.flowjo.com/ GraphPad Prism 8.2.1 GraphPad www.graphpad.com RSEM 1.2.18 Li and Dewey (2011) https://github.com/deweylab/RSEM Tophat2 2.0.14 Kim et al. (2013) http://ccb.jhu.edu/software/tophat/ index.shtml Fastq Screen v0.9.5 Wingett and Andrews (2018) https://github.com/StevenWingett/ FastQ-Screen FastQC 0.11.2 https://github.com/s-andrews/FastQC Trimmomatic-32 Bolger et al. (2014) https://github.com/genepattern/ Trimmomatic Monocle 2.0.4 Qiu et al. (2017) https://github.com/cole-trapnell-lab/ monocle-release R 3.3.0 (packages: ggplot2 2.2.1; grid 3.3.2; gridExtra2.3; reshape2 1.4.3; scales 0.5.0; R package Monocle v2.4.0) https://cran.r-project.org/bin/windows/ base

    Article Title: Single-Cell Transcriptome Analysis Reveals Estrogen Signaling Coordinately Augments One-Carbon, Polyamine, and Purine Synthesis in Breast Cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins 17b-estradiol (E2) Sigma Cat# 50-28-2 Critical Commercial Assays RNeasy Mini Kit QIAGEN Cat# 74106 SMARTer Ultra Low RNA Kit Clontech Cat# 634936 C1 Single-Cell mRNA Seq IFC Fluidigm Cat# 100-6041 C1 Single-Cell Reagent Kit for mRNA Seq Fluidigm Cat# 100-6201 C1 Single-Cell mRNA Seq HT IFC Fluidigm Cat# 101-4982 C1 Single-Cell mRNA Seq HT Reagent Kit v2 Fluidigm Cat# 101-3473 Nextera XT Sample Prep Kit Illumina Cat# FC-131-1096 Nextera XT DNA Sample Preparation Index Kit Illumina Cat# FC-131-1002 KAPA Library Quantification Kit KAPA Biosystems Cat# KR0405 Nextera XT Index Kit v2 Illumina Cat# FC-131-2001(set A) and FC-131-2002(set B). ddPCR Supermix for Probes (no dUTP) BioRad Cat# 186-3024 ddPCR Droplet Reader Oil BioRad Cat# 186-3004 DG8 Cartridges and Gaskets BioRad Cat# 186-4007 ddPCR 96-Well PCR Plates BioRad Cat# 12001925 RNAscope Multiplex Fluorescent v2 Kit ACDbio Cat# 323110 Cell apoptosis kit ThermoFisher Cat# V13245 MTT ThermoFisher Cat# M6494 Deposited Data Raw and analyzed data This paper GEO: GSE107864, GSE119455 Genome reference UCSC hg19 UCSC http://hgdownload.soe.ucsc.edu/goldenPath/ hg19/bigZips/ Gene annotation reference Gencode V18 Gencode database https://www.gencodegenes.org/18.html ERa ChIP-seq data Ross-Innes et al., 2012 GEO: GSE32222 Experimental Models: Cell Lines Human: MCF7 ATCC ATCC HTB-22 Human: T47D ATCC ATCC HTB-133 Oligonucleotides Primer sets and probes used in droplet digital PCR (Table S2) This paper N/A DsiRNAs used for knockdown assays (Table S3) This paper N/A Software and Algorithms Tophat v2.0.6 Kim et al., 2013 https://ccb.jhu.edu/software/tophat/index.shtml Cufflink v2.0.2 Trapnell et al., 2012 http://cole-trapnell-lab.github.io/cufflinks FastQC v0.11.5 https://www.bioinformatics. babraham.ac.uk/projects/fastqc/ https://www.bioinformatics.babraham.ac.uk/ projects/download.html#fastqc RSeQC v2.6.4 Wang et al., 2012 http://rseqc.sourceforge.net/ SIBER (OOMPA v2.1.0) Tong et al., 2013 http://bioinformatics.mdanderson.org/main/ OOMPA:Overview bc-GenExMiner 4.0 Jézéquel et al., 2012 http://bcgenex.centregauducheau.fr/BC-GEM/ GEM-Accueil.php?js=1 DAVID website v6.8 Huang et al., 2009 https://david.ncifcrf.gov/ GSEA software (MSigDB 6.2) Subramanian et al., 2005 http://software.broadinstitute.org/gsea/index.jsp Cell Reports 25, 2285–2298.e1–e4, November 20, 2018 e1 ..

    Article Title: Single cell analyses identify a highly regenerative and homogenous human CD34+ hematopoietic stem cell population
    Article Snippet: CD11c APC BD Biosciences B-ly6 CD14 FITC BD Biosciences M5E2 CD15 FITC BD Biosciences HI98 CD19 APC-eFluor780 Thermo Fisher Scientific/eBioscience HIB19 CD19 FITC BD Biosciences HIB19 CD33 PE BD Biosciences WM53 CD33 PE-Cy7 Thermo Fisher Scientific/eBioscience WM53 CD34 FITC BD Biosciences 581 CD34 PerCp BD Biosciences 8G12 CD38 PE-Cy7 Thermo Fisher Scientific/eBioscience HB7 CD38 APC-eFluor780 Thermo Fisher Scientific/eBioscience HB7 CD45 FITC BD Biosciences HI30 CD45 PerCp BD Biosciences HI30 CD45 APC BD Biosciences HI30 CD45RA FITC BD Biosciences HI100 CD45RA PE-Cy7 Thermo Fisher Scientific/eBioscience HI100 CD49f PE BD Biosciences GoH3 CD49f AlexaFluor 647 BD Biosciences GoH3 CD56 PE BD Biosciences B159 CD90 PerCp-eFluor710 Thermo Fisher Scientific/eBioscience 5E10 CD90 APC Thermo Fisher Scientific/eBioscience 5E10 CD90 BV605 BD Biosciences 5E10 CD93/C1qRp Biotin Biolegend VIMD2 CD133 PE Miltenyi Biotec AC133 CD143 APC BD Biosciences BB9 CD201/EPCR PE BD Biosciences RCR-252 CD201/EPCR APC BD Biosciences RCR-252 CD201/EPCR PE Biolegend RCR-401 CD201/EPCR APC Biolegend RCR-401 CD201/EPCR APC Thermo Fisher Scientific/eBioscience RCR-227 Chemicals and Recombinant Proteins for Cell Culture and in vivo Experiments Ficoll-Paque GE Healthcare Life Sciences 17-1440-02 EasySep CD34+ Selection Kit II StemCell Technologies 17856 EasySep Mouse/Human Chimera Enrichment kit StemCell Technologies 19849 StemSep Human Progenitor Enrichment Kit StemCell Technologies 14056 Collagen Solution StemCell Technologies 04902 alpha-Minimum Essential media with nucleosides (MEM) Thermo Fisher Scientific/Gibco 22571038 MyeloCultTM H5100 StemCell Technologies 05150 StemSpanTM SFEM II StemCell Technologies 09605 IL2 Peprotech 200-02 IL7 Peprotech 200-07 IL15 Peprotech 200-15 FLT3L Peprotech 300-19 G-CSF Peprotech 300-23 SCF Peprotech 300-07 TPO Peprotech 300-18 Immune Globulin Intravenous (IVIG; human) Bio Products Laboratory (BPL) Gammaplex 5% Betamox 150 mg/ml suspension for injection Norbrook Betamox LA 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) Merck/Sigma-Aldrich D8417 CellTraceTM Violet staining kit Thermo Fisher Scientific C34557 TMRE (tetramethylrhodamine ethyl ester) BD Biosciences 564696 CellTitre-Glow 2.0 kit Promega G9241 Click-&-Go Plus 488 OPP Protein Synthesis Assay Kit Clickchemistrytools 1493 Saponin Merck-Sigma 47036 .. 96-well skirted FrameStar PCR plates 4titude 4ti-0960 TrixonX-100 solution Merck/Sigma-Aldrich 93443 RNAse inhibitor Thermo Fisher Scientific/Ambion AM2682 KAPA Stranded with RiboErase RNA-seq kit KAPA Biosystems KK8483 Kapa Dual-Indexed Adapters KAPA Biosystems KK8720 RNeasy Plus Micro Kit Qiagen 74034 Agencourt AMPure XP beads Beckman Coulter A63880 NexteraTM XT DNA Sample Prep Kit Illumina FC-1311096 C1TM Single-Cell Reagent Kit for mRNA Seq Fluidigm 100-6201 Ethidium homodimer-1 Thermo Fisher Scientific/Invitrogen E1169 Calcein AM Thermo Fisher Scientific/Invitrogen C3099 SMART-Seq v4 Ultra Low Input RNA Kit for C1 System Takara 635026 .. FACSDiva v. 8.0.1.1 BD Biosciences N/A FlowJo v 9.96 and 10.6.2 FlowJo, LLC N/A Extreme Limiting Dilution Analysis (ELDA) Hu and Smyth (2009) http://bioinf. wehi.edu.au /software/el da/index.ht ml Prism 8.4.2 GraphPad Software N/A Adobe Illustrator 26.0.3 Adobe Inc. N/A DeSeq2 V1.28.1 Love et al., 2014 https://bioco nductor.org/ packages/re lease/bioc/h tml/DESeq2 .html GSEA 4.1.0 Subramanian et al., 2005 www.gseamsigdb.org/ gsea/index.j sp STAR_2.4 Dobin et al., 2013 https://githu b.com/alexd obin/STAR RSEM_1.2.8 Li et al., 2011 https://githu b.com/dewe ylab/RSEM R 3.5.0 N/A https://www. r-project.org

    Next-Generation Sequencing:

    Article Title: Tumor-associated high endothelial venules mediate lymphocyte entry into tumors and predict response to PD-1 plus CTLA-4 combination immunotherapy.
    Article Snippet: Patient samples are detailed in Table S3 MSN-08-027 CPP Ile de France Registration number : 2008-A00373-52 Chemicals, peptides, and recombinant proteins MAXblock Blocking Medium Active motif Cat# 15252 BD Cytofix/Cytoperm Fixation/Permeablization Kit BD Biosciences Cat# 554714 OCT embedding matrix CellPath Cat # KMA-0100-00A Collagenase IV Gibco Cat# KMA-0100-00A CellTracker Deep Red Dye Invitrogen Cat# 17104-019 CellTrace CFSE Cell Proliferation Kit Invitrogen Cat# C34656 Calcein AM cell-permanent dye Invitrogen Cat# C34554 Qtracker 565 Vascular Labels Invitrogen Cat# Q21031MP Fixable viability dye eFluor 506 Invitrogen Cat# 65-0866-14 FoxP3/Transcription factor staining buffer set Invitrogen Cat# 00-5523-00 ACK lysing buffer Lonza Cat# 00-5523-00 RLT buffer Qiagen Cat# 79216 RNeasy Mini Kit Qiagen Cat# 10-548E Collagenase VIII Sigma Cat# 74104 (Continued on next page) e2 Cancer Cell 40, 318–334.e1–e9, March 14, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER DNaseI Sigma Cat# 74104 Fingolimod (FTY720) Selleckchem Cat# S5002 Cell Activation Cocktail (with Brefeldin A) BioLegend Cat # 423303 SuperScript VILO cDNA Synthesis Kit ThermoFischer Scientific Cat # 11754050 Power SYBR Green PCR Master Mix ThermoFischer Scientific Cat # 4368577 Critical commercial assays C1 Single-Cell Reagent Kit for mRNA Seq Fluidigm Cat# 100-6201 ArrayControl RNA Spikes ThermoFisher Cat# AM1780 SMARTer Ultra Low RNA Kit for the Fluidigm C1 System Takara Cat# 634833 Nextera XT kit Illumina Cat# FC-131-1096 High Sensitivity NGS Fragment Analysis kit Agilent Cat# DNF-474 EasySep Mouse T Cell Isolation Kit StemCell Cat# 19851 EasySep Mouse CD4+ T Cell Isolation Kit StemCell Cat# 19852 Mouse CD8a + T Cell Isolation Kit Miltenyi Biotec Cat# 130-104-075 Mouse CD62L MicroBeads Miltenyi Biotec Cat# 130-049-701 Deposited data RNA-Seq data This paper GEO Series accession number - GEO: GSE154898 Mouse reference genome UCSC mm10 Genome Reference Consortium https://genome.ucsc.edu/ cgi-bin/hgGateway?db=mm10 Experimental models: Cell lines MCAreg (1969) fibrosarcoma Diamond et al. (2011) Gift from Robert Schreiber (Washington University School of Medicine, Saint-Louis, USA) MCAprog (9609) fibrosarcoma O’Sullivan et al. (2012) Gift from Robert Schreiber (Washington University School of Medicine, Saint-Louis, USA) MMTV-PyMT mammary carcinoma-derived VO-PyMT cells (PyMT) Halpern et al. (2006) Gift from Zena Werb (University of California, San Francisco, USA) CT26 colon carcinoma cells ATCC Cat# ATCC CRL-2638 Experimental models: Organisms/strains Mouse: C57BL/6 Charles River Cat# 027 Mouse: BALB/C Charles River Cat# 028 Mouse: FVB Charles River Cat# 207 Mouse: Rag2-/- House Breeding Oligonucleotides Primer: Ackr1 Forward: AGGATGCTATGCTTGCCTGAA This paper Primer: Ackr1 Reverse: GGTGAAGCCACGGAGTTGA This paper Primer: Fut7 Forward: CAGATGCACCCTCTAGTACTCT This paper N/A Primer: Fut7 Reverse: TGCACTGTCCTTCCACAACC This paper N/A Primer: Glycam1 Forward: GTCCACTCCCACCAGCTACAC This paper N/A Primer: Glycam1 Reverse: GGCTCCTTGGAAAGGTCCTT This paper N/A Primer: Sele Forward: TCCTGCGAAGAAGGATTTGAA This paper N/A Primer: Sele Reverse: CCCCTCTTGGACCACACTGA This paper N/A Primer: Selp Forward: CTCATCTGGTTCAGTGCTTTGATC This paper N/A Primer: Selp Reverse: TCCACGCAGCCACTTCCT This paper N/A Primer: Hprt Forward: CCTAAGATGAGCGCAAAGTTGAA This paper N/A Primer: Hprt Reverse: CCACAGGACTAGAACACCTGCT This paper N/A (Continued on next page) Cancer Cell 40, 318–334.e1–e9, March 14, 2022 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms DiVa V8.0.1 BD Biosciences FlowJo v10.1 Tree Star https://www.flowjo.com/ GraphPad Prism 8.2.1 GraphPad www.graphpad.com RSEM 1.2.18 Li and Dewey (2011) https://github.com/deweylab/RSEM Tophat2 2.0.14 Kim et al. (2013) http://ccb.jhu.edu/software/tophat/ index.shtml Fastq Screen v0.9.5 Wingett and Andrews (2018) https://github.com/StevenWingett/ FastQ-Screen FastQC 0.11.2 https://github.com/s-andrews/FastQC Trimmomatic-32 Bolger et al. (2014) https://github.com/genepattern/ Trimmomatic Monocle 2.0.4 Qiu et al. (2017) https://github.com/cole-trapnell-lab/ monocle-release R 3.3.0 (packages: ggplot2 2.2.1; grid 3.3.2; gridExtra2.3; reshape2 1.4.3; scales 0.5.0; R package Monocle v2.4.0) https://cran.r-project.org/bin/windows/ base

    Cell Isolation:

    Article Title: Tumor-associated high endothelial venules mediate lymphocyte entry into tumors and predict response to PD-1 plus CTLA-4 combination immunotherapy.
    Article Snippet: Patient samples are detailed in Table S3 MSN-08-027 CPP Ile de France Registration number : 2008-A00373-52 Chemicals, peptides, and recombinant proteins MAXblock Blocking Medium Active motif Cat# 15252 BD Cytofix/Cytoperm Fixation/Permeablization Kit BD Biosciences Cat# 554714 OCT embedding matrix CellPath Cat # KMA-0100-00A Collagenase IV Gibco Cat# KMA-0100-00A CellTracker Deep Red Dye Invitrogen Cat# 17104-019 CellTrace CFSE Cell Proliferation Kit Invitrogen Cat# C34656 Calcein AM cell-permanent dye Invitrogen Cat# C34554 Qtracker 565 Vascular Labels Invitrogen Cat# Q21031MP Fixable viability dye eFluor 506 Invitrogen Cat# 65-0866-14 FoxP3/Transcription factor staining buffer set Invitrogen Cat# 00-5523-00 ACK lysing buffer Lonza Cat# 00-5523-00 RLT buffer Qiagen Cat# 79216 RNeasy Mini Kit Qiagen Cat# 10-548E Collagenase VIII Sigma Cat# 74104 (Continued on next page) e2 Cancer Cell 40, 318–334.e1–e9, March 14, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER DNaseI Sigma Cat# 74104 Fingolimod (FTY720) Selleckchem Cat# S5002 Cell Activation Cocktail (with Brefeldin A) BioLegend Cat # 423303 SuperScript VILO cDNA Synthesis Kit ThermoFischer Scientific Cat # 11754050 Power SYBR Green PCR Master Mix ThermoFischer Scientific Cat # 4368577 Critical commercial assays C1 Single-Cell Reagent Kit for mRNA Seq Fluidigm Cat# 100-6201 ArrayControl RNA Spikes ThermoFisher Cat# AM1780 SMARTer Ultra Low RNA Kit for the Fluidigm C1 System Takara Cat# 634833 Nextera XT kit Illumina Cat# FC-131-1096 High Sensitivity NGS Fragment Analysis kit Agilent Cat# DNF-474 EasySep Mouse T Cell Isolation Kit StemCell Cat# 19851 EasySep Mouse CD4+ T Cell Isolation Kit StemCell Cat# 19852 Mouse CD8a + T Cell Isolation Kit Miltenyi Biotec Cat# 130-104-075 Mouse CD62L MicroBeads Miltenyi Biotec Cat# 130-049-701 Deposited data RNA-Seq data This paper GEO Series accession number - GEO: GSE154898 Mouse reference genome UCSC mm10 Genome Reference Consortium https://genome.ucsc.edu/ cgi-bin/hgGateway?db=mm10 Experimental models: Cell lines MCAreg (1969) fibrosarcoma Diamond et al. (2011) Gift from Robert Schreiber (Washington University School of Medicine, Saint-Louis, USA) MCAprog (9609) fibrosarcoma O’Sullivan et al. (2012) Gift from Robert Schreiber (Washington University School of Medicine, Saint-Louis, USA) MMTV-PyMT mammary carcinoma-derived VO-PyMT cells (PyMT) Halpern et al. (2006) Gift from Zena Werb (University of California, San Francisco, USA) CT26 colon carcinoma cells ATCC Cat# ATCC CRL-2638 Experimental models: Organisms/strains Mouse: C57BL/6 Charles River Cat# 027 Mouse: BALB/C Charles River Cat# 028 Mouse: FVB Charles River Cat# 207 Mouse: Rag2-/- House Breeding Oligonucleotides Primer: Ackr1 Forward: AGGATGCTATGCTTGCCTGAA This paper Primer: Ackr1 Reverse: GGTGAAGCCACGGAGTTGA This paper Primer: Fut7 Forward: CAGATGCACCCTCTAGTACTCT This paper N/A Primer: Fut7 Reverse: TGCACTGTCCTTCCACAACC This paper N/A Primer: Glycam1 Forward: GTCCACTCCCACCAGCTACAC This paper N/A Primer: Glycam1 Reverse: GGCTCCTTGGAAAGGTCCTT This paper N/A Primer: Sele Forward: TCCTGCGAAGAAGGATTTGAA This paper N/A Primer: Sele Reverse: CCCCTCTTGGACCACACTGA This paper N/A Primer: Selp Forward: CTCATCTGGTTCAGTGCTTTGATC This paper N/A Primer: Selp Reverse: TCCACGCAGCCACTTCCT This paper N/A Primer: Hprt Forward: CCTAAGATGAGCGCAAAGTTGAA This paper N/A Primer: Hprt Reverse: CCACAGGACTAGAACACCTGCT This paper N/A (Continued on next page) Cancer Cell 40, 318–334.e1–e9, March 14, 2022 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms DiVa V8.0.1 BD Biosciences FlowJo v10.1 Tree Star https://www.flowjo.com/ GraphPad Prism 8.2.1 GraphPad www.graphpad.com RSEM 1.2.18 Li and Dewey (2011) https://github.com/deweylab/RSEM Tophat2 2.0.14 Kim et al. (2013) http://ccb.jhu.edu/software/tophat/ index.shtml Fastq Screen v0.9.5 Wingett and Andrews (2018) https://github.com/StevenWingett/ FastQ-Screen FastQC 0.11.2 https://github.com/s-andrews/FastQC Trimmomatic-32 Bolger et al. (2014) https://github.com/genepattern/ Trimmomatic Monocle 2.0.4 Qiu et al. (2017) https://github.com/cole-trapnell-lab/ monocle-release R 3.3.0 (packages: ggplot2 2.2.1; grid 3.3.2; gridExtra2.3; reshape2 1.4.3; scales 0.5.0; R package Monocle v2.4.0) https://cran.r-project.org/bin/windows/ base

    RNA sequencing:

    Article Title: Tumor-associated high endothelial venules mediate lymphocyte entry into tumors and predict response to PD-1 plus CTLA-4 combination immunotherapy.
    Article Snippet: Patient samples are detailed in Table S3 MSN-08-027 CPP Ile de France Registration number : 2008-A00373-52 Chemicals, peptides, and recombinant proteins MAXblock Blocking Medium Active motif Cat# 15252 BD Cytofix/Cytoperm Fixation/Permeablization Kit BD Biosciences Cat# 554714 OCT embedding matrix CellPath Cat # KMA-0100-00A Collagenase IV Gibco Cat# KMA-0100-00A CellTracker Deep Red Dye Invitrogen Cat# 17104-019 CellTrace CFSE Cell Proliferation Kit Invitrogen Cat# C34656 Calcein AM cell-permanent dye Invitrogen Cat# C34554 Qtracker 565 Vascular Labels Invitrogen Cat# Q21031MP Fixable viability dye eFluor 506 Invitrogen Cat# 65-0866-14 FoxP3/Transcription factor staining buffer set Invitrogen Cat# 00-5523-00 ACK lysing buffer Lonza Cat# 00-5523-00 RLT buffer Qiagen Cat# 79216 RNeasy Mini Kit Qiagen Cat# 10-548E Collagenase VIII Sigma Cat# 74104 (Continued on next page) e2 Cancer Cell 40, 318–334.e1–e9, March 14, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER DNaseI Sigma Cat# 74104 Fingolimod (FTY720) Selleckchem Cat# S5002 Cell Activation Cocktail (with Brefeldin A) BioLegend Cat # 423303 SuperScript VILO cDNA Synthesis Kit ThermoFischer Scientific Cat # 11754050 Power SYBR Green PCR Master Mix ThermoFischer Scientific Cat # 4368577 Critical commercial assays C1 Single-Cell Reagent Kit for mRNA Seq Fluidigm Cat# 100-6201 ArrayControl RNA Spikes ThermoFisher Cat# AM1780 SMARTer Ultra Low RNA Kit for the Fluidigm C1 System Takara Cat# 634833 Nextera XT kit Illumina Cat# FC-131-1096 High Sensitivity NGS Fragment Analysis kit Agilent Cat# DNF-474 EasySep Mouse T Cell Isolation Kit StemCell Cat# 19851 EasySep Mouse CD4+ T Cell Isolation Kit StemCell Cat# 19852 Mouse CD8a + T Cell Isolation Kit Miltenyi Biotec Cat# 130-104-075 Mouse CD62L MicroBeads Miltenyi Biotec Cat# 130-049-701 Deposited data RNA-Seq data This paper GEO Series accession number - GEO: GSE154898 Mouse reference genome UCSC mm10 Genome Reference Consortium https://genome.ucsc.edu/ cgi-bin/hgGateway?db=mm10 Experimental models: Cell lines MCAreg (1969) fibrosarcoma Diamond et al. (2011) Gift from Robert Schreiber (Washington University School of Medicine, Saint-Louis, USA) MCAprog (9609) fibrosarcoma O’Sullivan et al. (2012) Gift from Robert Schreiber (Washington University School of Medicine, Saint-Louis, USA) MMTV-PyMT mammary carcinoma-derived VO-PyMT cells (PyMT) Halpern et al. (2006) Gift from Zena Werb (University of California, San Francisco, USA) CT26 colon carcinoma cells ATCC Cat# ATCC CRL-2638 Experimental models: Organisms/strains Mouse: C57BL/6 Charles River Cat# 027 Mouse: BALB/C Charles River Cat# 028 Mouse: FVB Charles River Cat# 207 Mouse: Rag2-/- House Breeding Oligonucleotides Primer: Ackr1 Forward: AGGATGCTATGCTTGCCTGAA This paper Primer: Ackr1 Reverse: GGTGAAGCCACGGAGTTGA This paper Primer: Fut7 Forward: CAGATGCACCCTCTAGTACTCT This paper N/A Primer: Fut7 Reverse: TGCACTGTCCTTCCACAACC This paper N/A Primer: Glycam1 Forward: GTCCACTCCCACCAGCTACAC This paper N/A Primer: Glycam1 Reverse: GGCTCCTTGGAAAGGTCCTT This paper N/A Primer: Sele Forward: TCCTGCGAAGAAGGATTTGAA This paper N/A Primer: Sele Reverse: CCCCTCTTGGACCACACTGA This paper N/A Primer: Selp Forward: CTCATCTGGTTCAGTGCTTTGATC This paper N/A Primer: Selp Reverse: TCCACGCAGCCACTTCCT This paper N/A Primer: Hprt Forward: CCTAAGATGAGCGCAAAGTTGAA This paper N/A Primer: Hprt Reverse: CCACAGGACTAGAACACCTGCT This paper N/A (Continued on next page) Cancer Cell 40, 318–334.e1–e9, March 14, 2022 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms DiVa V8.0.1 BD Biosciences FlowJo v10.1 Tree Star https://www.flowjo.com/ GraphPad Prism 8.2.1 GraphPad www.graphpad.com RSEM 1.2.18 Li and Dewey (2011) https://github.com/deweylab/RSEM Tophat2 2.0.14 Kim et al. (2013) http://ccb.jhu.edu/software/tophat/ index.shtml Fastq Screen v0.9.5 Wingett and Andrews (2018) https://github.com/StevenWingett/ FastQ-Screen FastQC 0.11.2 https://github.com/s-andrews/FastQC Trimmomatic-32 Bolger et al. (2014) https://github.com/genepattern/ Trimmomatic Monocle 2.0.4 Qiu et al. (2017) https://github.com/cole-trapnell-lab/ monocle-release R 3.3.0 (packages: ggplot2 2.2.1; grid 3.3.2; gridExtra2.3; reshape2 1.4.3; scales 0.5.0; R package Monocle v2.4.0) https://cran.r-project.org/bin/windows/ base

    Virus:

    Article Title: Multiomics Investigation Revealing the Characteristics of HIV-1-Infected Cells In Vivo.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies PerCP/Cy5.5-conjugated anti-CD45 antibody Biolegend Cat# 368504; RRID: AB_2566352 PE-conjugated anti-CD3 antibody BD Biosciences Cat# 555333; RRID: AB_395740 APC-conjugated anti-CD8 antibody Dako Cat# C722701; RRID: AB_578594 APC-conjugated anti-CXCL13 antibody Thermo Fisher Scientific Cat# MA5-23629; RRID: AB_2610225 APC-conjugated anti-CXCR5 antibody BioLegend Cat# 35908; RRID: AB_2561817 Anti-HIV-1 p24 antibody Virostat Cat# 1951 Anti-Vif antibody NIH AIDS Reagent Program Cat# 6459 Anti-Vpr antibody (clone 8D1) Cosmo Bio Cat# NCG-M01 Anti-Vpu antibody NIH AIDS Reagent Program Cat# 969 Anti-Env antibody NIH AIDS Reagent Program Cat# 12559 Anti-Nef antibody (clone 3D12) Thermo Fisher Scientific Cat# MA1-71501; RRID: AB_962113 Anti-PR antibody (clone 1696) Thermo Fisher Scientific Cat# MA1-19015; RRID: AB_1075640 Anti-RT antibody NIH AIDS Reagent Program Cat# 11338 Anti-IN antibody (clone IN-2) Abcam Cat# ab66645; RRID: AB_1139533 Anti-GFP antibody Sigma-Aldrich Cat# G6795; RRID: AB_563117 Anti-alpha-Tubulin antibody Sigma-Aldrich Cat# T9026; RRID: AB_477593 Bacterial and Virus Strains HIV1-GFP (strain NLSCFV3-GFP) (Miura et al., 2001) N/A HIV-1 (strain NLSCFV3) (Suzuki et al., 1999) N/A Biological Samples Human CD34+ hematopoietic stem cells UCLA CFAR Gene and Cellular Therapy Core Facility https://www.uclahealth.org/ aidsinstitute/cfar/gene-and-cellulartherapy-core Human PBMCs This study N/A Chemicals, Peptides, and Recombinant Proteins Dulbecco’s modified Eagle’s medium Sigma-Aldrich Cat# D6046-500ML RPMI 1640 Sigma-Aldrich Cat# R8758-500ML Fetal calf serum (FCS) Sigma-Aldrich Cat# 172012-500ML Penicillin streptomycin Sigma-Aldrich Cat# P4333-100ML L-glutamate Thermo Fisher Scientific Cat# 25030081 Ficoll-Paque GE Healthcare Cat# 17-1440-03 Phytohemagglutinin (PHA) Sigma-Aldrich Cat# 11082132001 Phorbol 12-myristate 13-acetate (PMA) Sigma-Aldrich Cat# P-8139 Ionomycin Sigma-Aldrich Cat# I-0634 Nelfinavir Sigma-Aldrich Cat# PZ0013 Blasticidin Invivogen Cat# ant-bl-1 Recombinant CXCL13 Funakoshi Cat# 801-CX-025 EcoRI Takara Cat# 1040A BamHI Takara Cat# 1010A ddPCR Supermix for probes Bio-Rad Cat# 1863010 NEBNext Ultra II End Repair/dA-Tailing module New England BioLabs Cat# E7546 NEBNext Ultra II ligation module New England BioLabs Cat# E7595 Agencourt AMPure XP Beckman Coulter Cat# A63880 C1 single-cell Auto Prep Reagent kit for mRNA Seq Fluidigm Cat# 100-6201 (Continued on next page) e1 Cell Reports 32, 107887, July 14, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER Short linker for LM-PCR: 50-p-GAT CGG AAG AGC GAA AAA AAA AAA AA-30 (Satou et al., 2017) N/A Primer (B3) for 1st LM-PCR: 50-GCT TGC CTT GAG TGC TTC AAG TAG TGT G-30 (Satou et al., 2017) N/A Primer (B4) for 1st LM-PCR: 50-TCATGATCAATG GGACGATCA-30 (Satou et al., 2017) N/A Primer (P5B5) for 2nd LM-PCR: 50-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACG TGC CCG TCT GTT GTG TGA CTC TGG-30 (Satou et al., 2017) N/A Primer (P7) for 2nd LM-PCR: 50-CAA GCA GAA GAC GGC ATA CGA GAT-30 (Satou et al., 2017) N/A Sequencing primer for LM-PCR (‘Read1’ targeting HIV-1): 50-ATC CCT CAG ACC CTT TTA GTC AGT GTG GAA AAT CTC-30 (Satou et al., 2017) N/A Sequencing primer for LM-PCR (‘Read20 targeting human genome): 50-CGG TCT CGG CAT TCC TGC TGA ACC GCT CTT CCG ATC T-30 (Satou et al., 2017) N/A Sequencing primer for LM-PCR (‘Index1’ targeting adaptor): 50-GAT CGG AAG AGC GGT TCA GCA GGA ATG CCG AGA CCG-30 (Satou et al., 2017) N/A Oligonucleotide for dRNA-Seq (polyT1): 50-ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT NNN NNN ANN CNN TNN GNN ANN CNN TTT TTT TTT TTT TTV-30 IDT N/A Oligonucleotide for dRNA-Seq (polyT2): 50-ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT NNN NNN TNN GNN ANN CNN TNN GNN TTT TTT TTT TTT TTV-30 IDT N/A Oligonucleotide for dRNA-Seq (polyT3): 50-ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT NNN NNN GNN TNN CNN ANN GNN ANN TTT TTT TTT TTT TTV-30 IDT N/A Oligonucleotide for dRNA-Seq (polyT4): 50-ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT NNN NNN CNN ANN GNN TNN CNN TNN TTT TTT TTT TTT TTV-30 IDT N/A Oligonucleotide for dRNA-Seq (TS-Oligo; [ ], RNA): 50-AAG CAG TGG TAT CAA CGC [AGA GUA CAU GGG]-30 Hokkaido System Science Co. N/A Oligonucleotide for dRNA-Seq (PCR primer 1; XXXXXXXX, index): 50-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACX XXX XXX ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT-30 IDT N/A Oligonucleotide for dRNA-Seq (PCR primer 2; XXXXXXXX, index): 50-CAA GCA GAA GAC GGC ATA CGAGAT XXX XXX XTG ACT GGAGTT CAG ACG TGT GCT CTT CCG ATC TAA GCA GTG GTA TCA ACG CAG AGT ACA TGG G-30 IDT N/A Primer for CXCR5 cloning: CXCR5_F1, 50-CGG GGA GCC TCT CAA CAT AA-30 This study N/A Primer for CXCR5 cloning: CXCR5_R1, 50-CCC TTA GGA TCC CAG CTC CT-30 This study N/A Primer for CXCR5 cloning: CXCR5_F2, 50-AGA GAG AAT TCC CAC CAT GAA CTA CCC GCT AAC GCT-30 This study N/A (Continued on next page) e3 Cell Reports 32, 107887, July 14, 2020

    Modification:

    Article Title: Multiomics Investigation Revealing the Characteristics of HIV-1-Infected Cells In Vivo.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies PerCP/Cy5.5-conjugated anti-CD45 antibody Biolegend Cat# 368504; RRID: AB_2566352 PE-conjugated anti-CD3 antibody BD Biosciences Cat# 555333; RRID: AB_395740 APC-conjugated anti-CD8 antibody Dako Cat# C722701; RRID: AB_578594 APC-conjugated anti-CXCL13 antibody Thermo Fisher Scientific Cat# MA5-23629; RRID: AB_2610225 APC-conjugated anti-CXCR5 antibody BioLegend Cat# 35908; RRID: AB_2561817 Anti-HIV-1 p24 antibody Virostat Cat# 1951 Anti-Vif antibody NIH AIDS Reagent Program Cat# 6459 Anti-Vpr antibody (clone 8D1) Cosmo Bio Cat# NCG-M01 Anti-Vpu antibody NIH AIDS Reagent Program Cat# 969 Anti-Env antibody NIH AIDS Reagent Program Cat# 12559 Anti-Nef antibody (clone 3D12) Thermo Fisher Scientific Cat# MA1-71501; RRID: AB_962113 Anti-PR antibody (clone 1696) Thermo Fisher Scientific Cat# MA1-19015; RRID: AB_1075640 Anti-RT antibody NIH AIDS Reagent Program Cat# 11338 Anti-IN antibody (clone IN-2) Abcam Cat# ab66645; RRID: AB_1139533 Anti-GFP antibody Sigma-Aldrich Cat# G6795; RRID: AB_563117 Anti-alpha-Tubulin antibody Sigma-Aldrich Cat# T9026; RRID: AB_477593 Bacterial and Virus Strains HIV1-GFP (strain NLSCFV3-GFP) (Miura et al., 2001) N/A HIV-1 (strain NLSCFV3) (Suzuki et al., 1999) N/A Biological Samples Human CD34+ hematopoietic stem cells UCLA CFAR Gene and Cellular Therapy Core Facility https://www.uclahealth.org/ aidsinstitute/cfar/gene-and-cellulartherapy-core Human PBMCs This study N/A Chemicals, Peptides, and Recombinant Proteins Dulbecco’s modified Eagle’s medium Sigma-Aldrich Cat# D6046-500ML RPMI 1640 Sigma-Aldrich Cat# R8758-500ML Fetal calf serum (FCS) Sigma-Aldrich Cat# 172012-500ML Penicillin streptomycin Sigma-Aldrich Cat# P4333-100ML L-glutamate Thermo Fisher Scientific Cat# 25030081 Ficoll-Paque GE Healthcare Cat# 17-1440-03 Phytohemagglutinin (PHA) Sigma-Aldrich Cat# 11082132001 Phorbol 12-myristate 13-acetate (PMA) Sigma-Aldrich Cat# P-8139 Ionomycin Sigma-Aldrich Cat# I-0634 Nelfinavir Sigma-Aldrich Cat# PZ0013 Blasticidin Invivogen Cat# ant-bl-1 Recombinant CXCL13 Funakoshi Cat# 801-CX-025 EcoRI Takara Cat# 1040A BamHI Takara Cat# 1010A ddPCR Supermix for probes Bio-Rad Cat# 1863010 NEBNext Ultra II End Repair/dA-Tailing module New England BioLabs Cat# E7546 NEBNext Ultra II ligation module New England BioLabs Cat# E7595 Agencourt AMPure XP Beckman Coulter Cat# A63880 C1 single-cell Auto Prep Reagent kit for mRNA Seq Fluidigm Cat# 100-6201 (Continued on next page) e1 Cell Reports 32, 107887, July 14, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER Short linker for LM-PCR: 50-p-GAT CGG AAG AGC GAA AAA AAA AAA AA-30 (Satou et al., 2017) N/A Primer (B3) for 1st LM-PCR: 50-GCT TGC CTT GAG TGC TTC AAG TAG TGT G-30 (Satou et al., 2017) N/A Primer (B4) for 1st LM-PCR: 50-TCATGATCAATG GGACGATCA-30 (Satou et al., 2017) N/A Primer (P5B5) for 2nd LM-PCR: 50-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACG TGC CCG TCT GTT GTG TGA CTC TGG-30 (Satou et al., 2017) N/A Primer (P7) for 2nd LM-PCR: 50-CAA GCA GAA GAC GGC ATA CGA GAT-30 (Satou et al., 2017) N/A Sequencing primer for LM-PCR (‘Read1’ targeting HIV-1): 50-ATC CCT CAG ACC CTT TTA GTC AGT GTG GAA AAT CTC-30 (Satou et al., 2017) N/A Sequencing primer for LM-PCR (‘Read20 targeting human genome): 50-CGG TCT CGG CAT TCC TGC TGA ACC GCT CTT CCG ATC T-30 (Satou et al., 2017) N/A Sequencing primer for LM-PCR (‘Index1’ targeting adaptor): 50-GAT CGG AAG AGC GGT TCA GCA GGA ATG CCG AGA CCG-30 (Satou et al., 2017) N/A Oligonucleotide for dRNA-Seq (polyT1): 50-ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT NNN NNN ANN CNN TNN GNN ANN CNN TTT TTT TTT TTT TTV-30 IDT N/A Oligonucleotide for dRNA-Seq (polyT2): 50-ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT NNN NNN TNN GNN ANN CNN TNN GNN TTT TTT TTT TTT TTV-30 IDT N/A Oligonucleotide for dRNA-Seq (polyT3): 50-ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT NNN NNN GNN TNN CNN ANN GNN ANN TTT TTT TTT TTT TTV-30 IDT N/A Oligonucleotide for dRNA-Seq (polyT4): 50-ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT NNN NNN CNN ANN GNN TNN CNN TNN TTT TTT TTT TTT TTV-30 IDT N/A Oligonucleotide for dRNA-Seq (TS-Oligo; [ ], RNA): 50-AAG CAG TGG TAT CAA CGC [AGA GUA CAU GGG]-30 Hokkaido System Science Co. N/A Oligonucleotide for dRNA-Seq (PCR primer 1; XXXXXXXX, index): 50-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACX XXX XXX ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT-30 IDT N/A Oligonucleotide for dRNA-Seq (PCR primer 2; XXXXXXXX, index): 50-CAA GCA GAA GAC GGC ATA CGAGAT XXX XXX XTG ACT GGAGTT CAG ACG TGT GCT CTT CCG ATC TAA GCA GTG GTA TCA ACG CAG AGT ACA TGG G-30 IDT N/A Primer for CXCR5 cloning: CXCR5_F1, 50-CGG GGA GCC TCT CAA CAT AA-30 This study N/A Primer for CXCR5 cloning: CXCR5_R1, 50-CCC TTA GGA TCC CAG CTC CT-30 This study N/A Primer for CXCR5 cloning: CXCR5_F2, 50-AGA GAG AAT TCC CAC CAT GAA CTA CCC GCT AAC GCT-30 This study N/A (Continued on next page) e3 Cell Reports 32, 107887, July 14, 2020

    Ligation:

    Article Title: Multiomics Investigation Revealing the Characteristics of HIV-1-Infected Cells In Vivo.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies PerCP/Cy5.5-conjugated anti-CD45 antibody Biolegend Cat# 368504; RRID: AB_2566352 PE-conjugated anti-CD3 antibody BD Biosciences Cat# 555333; RRID: AB_395740 APC-conjugated anti-CD8 antibody Dako Cat# C722701; RRID: AB_578594 APC-conjugated anti-CXCL13 antibody Thermo Fisher Scientific Cat# MA5-23629; RRID: AB_2610225 APC-conjugated anti-CXCR5 antibody BioLegend Cat# 35908; RRID: AB_2561817 Anti-HIV-1 p24 antibody Virostat Cat# 1951 Anti-Vif antibody NIH AIDS Reagent Program Cat# 6459 Anti-Vpr antibody (clone 8D1) Cosmo Bio Cat# NCG-M01 Anti-Vpu antibody NIH AIDS Reagent Program Cat# 969 Anti-Env antibody NIH AIDS Reagent Program Cat# 12559 Anti-Nef antibody (clone 3D12) Thermo Fisher Scientific Cat# MA1-71501; RRID: AB_962113 Anti-PR antibody (clone 1696) Thermo Fisher Scientific Cat# MA1-19015; RRID: AB_1075640 Anti-RT antibody NIH AIDS Reagent Program Cat# 11338 Anti-IN antibody (clone IN-2) Abcam Cat# ab66645; RRID: AB_1139533 Anti-GFP antibody Sigma-Aldrich Cat# G6795; RRID: AB_563117 Anti-alpha-Tubulin antibody Sigma-Aldrich Cat# T9026; RRID: AB_477593 Bacterial and Virus Strains HIV1-GFP (strain NLSCFV3-GFP) (Miura et al., 2001) N/A HIV-1 (strain NLSCFV3) (Suzuki et al., 1999) N/A Biological Samples Human CD34+ hematopoietic stem cells UCLA CFAR Gene and Cellular Therapy Core Facility https://www.uclahealth.org/ aidsinstitute/cfar/gene-and-cellulartherapy-core Human PBMCs This study N/A Chemicals, Peptides, and Recombinant Proteins Dulbecco’s modified Eagle’s medium Sigma-Aldrich Cat# D6046-500ML RPMI 1640 Sigma-Aldrich Cat# R8758-500ML Fetal calf serum (FCS) Sigma-Aldrich Cat# 172012-500ML Penicillin streptomycin Sigma-Aldrich Cat# P4333-100ML L-glutamate Thermo Fisher Scientific Cat# 25030081 Ficoll-Paque GE Healthcare Cat# 17-1440-03 Phytohemagglutinin (PHA) Sigma-Aldrich Cat# 11082132001 Phorbol 12-myristate 13-acetate (PMA) Sigma-Aldrich Cat# P-8139 Ionomycin Sigma-Aldrich Cat# I-0634 Nelfinavir Sigma-Aldrich Cat# PZ0013 Blasticidin Invivogen Cat# ant-bl-1 Recombinant CXCL13 Funakoshi Cat# 801-CX-025 EcoRI Takara Cat# 1040A BamHI Takara Cat# 1010A ddPCR Supermix for probes Bio-Rad Cat# 1863010 NEBNext Ultra II End Repair/dA-Tailing module New England BioLabs Cat# E7546 NEBNext Ultra II ligation module New England BioLabs Cat# E7595 Agencourt AMPure XP Beckman Coulter Cat# A63880 C1 single-cell Auto Prep Reagent kit for mRNA Seq Fluidigm Cat# 100-6201 (Continued on next page) e1 Cell Reports 32, 107887, July 14, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER Short linker for LM-PCR: 50-p-GAT CGG AAG AGC GAA AAA AAA AAA AA-30 (Satou et al., 2017) N/A Primer (B3) for 1st LM-PCR: 50-GCT TGC CTT GAG TGC TTC AAG TAG TGT G-30 (Satou et al., 2017) N/A Primer (B4) for 1st LM-PCR: 50-TCATGATCAATG GGACGATCA-30 (Satou et al., 2017) N/A Primer (P5B5) for 2nd LM-PCR: 50-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACG TGC CCG TCT GTT GTG TGA CTC TGG-30 (Satou et al., 2017) N/A Primer (P7) for 2nd LM-PCR: 50-CAA GCA GAA GAC GGC ATA CGA GAT-30 (Satou et al., 2017) N/A Sequencing primer for LM-PCR (‘Read1’ targeting HIV-1): 50-ATC CCT CAG ACC CTT TTA GTC AGT GTG GAA AAT CTC-30 (Satou et al., 2017) N/A Sequencing primer for LM-PCR (‘Read20 targeting human genome): 50-CGG TCT CGG CAT TCC TGC TGA ACC GCT CTT CCG ATC T-30 (Satou et al., 2017) N/A Sequencing primer for LM-PCR (‘Index1’ targeting adaptor): 50-GAT CGG AAG AGC GGT TCA GCA GGA ATG CCG AGA CCG-30 (Satou et al., 2017) N/A Oligonucleotide for dRNA-Seq (polyT1): 50-ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT NNN NNN ANN CNN TNN GNN ANN CNN TTT TTT TTT TTT TTV-30 IDT N/A Oligonucleotide for dRNA-Seq (polyT2): 50-ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT NNN NNN TNN GNN ANN CNN TNN GNN TTT TTT TTT TTT TTV-30 IDT N/A Oligonucleotide for dRNA-Seq (polyT3): 50-ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT NNN NNN GNN TNN CNN ANN GNN ANN TTT TTT TTT TTT TTV-30 IDT N/A Oligonucleotide for dRNA-Seq (polyT4): 50-ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT NNN NNN CNN ANN GNN TNN CNN TNN TTT TTT TTT TTT TTV-30 IDT N/A Oligonucleotide for dRNA-Seq (TS-Oligo; [ ], RNA): 50-AAG CAG TGG TAT CAA CGC [AGA GUA CAU GGG]-30 Hokkaido System Science Co. N/A Oligonucleotide for dRNA-Seq (PCR primer 1; XXXXXXXX, index): 50-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACX XXX XXX ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT-30 IDT N/A Oligonucleotide for dRNA-Seq (PCR primer 2; XXXXXXXX, index): 50-CAA GCA GAA GAC GGC ATA CGAGAT XXX XXX XTG ACT GGAGTT CAG ACG TGT GCT CTT CCG ATC TAA GCA GTG GTA TCA ACG CAG AGT ACA TGG G-30 IDT N/A Primer for CXCR5 cloning: CXCR5_F1, 50-CGG GGA GCC TCT CAA CAT AA-30 This study N/A Primer for CXCR5 cloning: CXCR5_R1, 50-CCC TTA GGA TCC CAG CTC CT-30 This study N/A Primer for CXCR5 cloning: CXCR5_F2, 50-AGA GAG AAT TCC CAC CAT GAA CTA CCC GCT AAC GCT-30 This study N/A (Continued on next page) e3 Cell Reports 32, 107887, July 14, 2020

    Library Quantification:

    Article Title: Single-Cell Transcriptome Analysis Reveals Estrogen Signaling Coordinately Augments One-Carbon, Polyamine, and Purine Synthesis in Breast Cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins 17b-estradiol (E2) Sigma Cat# 50-28-2 Critical Commercial Assays RNeasy Mini Kit QIAGEN Cat# 74106 SMARTer Ultra Low RNA Kit Clontech Cat# 634936 C1 Single-Cell mRNA Seq IFC Fluidigm Cat# 100-6041 C1 Single-Cell Reagent Kit for mRNA Seq Fluidigm Cat# 100-6201 C1 Single-Cell mRNA Seq HT IFC Fluidigm Cat# 101-4982 C1 Single-Cell mRNA Seq HT Reagent Kit v2 Fluidigm Cat# 101-3473 Nextera XT Sample Prep Kit Illumina Cat# FC-131-1096 Nextera XT DNA Sample Preparation Index Kit Illumina Cat# FC-131-1002 KAPA Library Quantification Kit KAPA Biosystems Cat# KR0405 Nextera XT Index Kit v2 Illumina Cat# FC-131-2001(set A) and FC-131-2002(set B). ddPCR Supermix for Probes (no dUTP) BioRad Cat# 186-3024 ddPCR Droplet Reader Oil BioRad Cat# 186-3004 DG8 Cartridges and Gaskets BioRad Cat# 186-4007 ddPCR 96-Well PCR Plates BioRad Cat# 12001925 RNAscope Multiplex Fluorescent v2 Kit ACDbio Cat# 323110 Cell apoptosis kit ThermoFisher Cat# V13245 MTT ThermoFisher Cat# M6494 Deposited Data Raw and analyzed data This paper GEO: GSE107864, GSE119455 Genome reference UCSC hg19 UCSC http://hgdownload.soe.ucsc.edu/goldenPath/ hg19/bigZips/ Gene annotation reference Gencode V18 Gencode database https://www.gencodegenes.org/18.html ERa ChIP-seq data Ross-Innes et al., 2012 GEO: GSE32222 Experimental Models: Cell Lines Human: MCF7 ATCC ATCC HTB-22 Human: T47D ATCC ATCC HTB-133 Oligonucleotides Primer sets and probes used in droplet digital PCR (Table S2) This paper N/A DsiRNAs used for knockdown assays (Table S3) This paper N/A Software and Algorithms Tophat v2.0.6 Kim et al., 2013 https://ccb.jhu.edu/software/tophat/index.shtml Cufflink v2.0.2 Trapnell et al., 2012 http://cole-trapnell-lab.github.io/cufflinks FastQC v0.11.5 https://www.bioinformatics. babraham.ac.uk/projects/fastqc/ https://www.bioinformatics.babraham.ac.uk/ projects/download.html#fastqc RSeQC v2.6.4 Wang et al., 2012 http://rseqc.sourceforge.net/ SIBER (OOMPA v2.1.0) Tong et al., 2013 http://bioinformatics.mdanderson.org/main/ OOMPA:Overview bc-GenExMiner 4.0 Jézéquel et al., 2012 http://bcgenex.centregauducheau.fr/BC-GEM/ GEM-Accueil.php?js=1 DAVID website v6.8 Huang et al., 2009 https://david.ncifcrf.gov/ GSEA software (MSigDB 6.2) Subramanian et al., 2005 http://software.broadinstitute.org/gsea/index.jsp Cell Reports 25, 2285–2298.e1–e4, November 20, 2018 e1 ..

    RNAscope:

    Article Title: Single-Cell Transcriptome Analysis Reveals Estrogen Signaling Coordinately Augments One-Carbon, Polyamine, and Purine Synthesis in Breast Cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins 17b-estradiol (E2) Sigma Cat# 50-28-2 Critical Commercial Assays RNeasy Mini Kit QIAGEN Cat# 74106 SMARTer Ultra Low RNA Kit Clontech Cat# 634936 C1 Single-Cell mRNA Seq IFC Fluidigm Cat# 100-6041 C1 Single-Cell Reagent Kit for mRNA Seq Fluidigm Cat# 100-6201 C1 Single-Cell mRNA Seq HT IFC Fluidigm Cat# 101-4982 C1 Single-Cell mRNA Seq HT Reagent Kit v2 Fluidigm Cat# 101-3473 Nextera XT Sample Prep Kit Illumina Cat# FC-131-1096 Nextera XT DNA Sample Preparation Index Kit Illumina Cat# FC-131-1002 KAPA Library Quantification Kit KAPA Biosystems Cat# KR0405 Nextera XT Index Kit v2 Illumina Cat# FC-131-2001(set A) and FC-131-2002(set B). ddPCR Supermix for Probes (no dUTP) BioRad Cat# 186-3024 ddPCR Droplet Reader Oil BioRad Cat# 186-3004 DG8 Cartridges and Gaskets BioRad Cat# 186-4007 ddPCR 96-Well PCR Plates BioRad Cat# 12001925 RNAscope Multiplex Fluorescent v2 Kit ACDbio Cat# 323110 Cell apoptosis kit ThermoFisher Cat# V13245 MTT ThermoFisher Cat# M6494 Deposited Data Raw and analyzed data This paper GEO: GSE107864, GSE119455 Genome reference UCSC hg19 UCSC http://hgdownload.soe.ucsc.edu/goldenPath/ hg19/bigZips/ Gene annotation reference Gencode V18 Gencode database https://www.gencodegenes.org/18.html ERa ChIP-seq data Ross-Innes et al., 2012 GEO: GSE32222 Experimental Models: Cell Lines Human: MCF7 ATCC ATCC HTB-22 Human: T47D ATCC ATCC HTB-133 Oligonucleotides Primer sets and probes used in droplet digital PCR (Table S2) This paper N/A DsiRNAs used for knockdown assays (Table S3) This paper N/A Software and Algorithms Tophat v2.0.6 Kim et al., 2013 https://ccb.jhu.edu/software/tophat/index.shtml Cufflink v2.0.2 Trapnell et al., 2012 http://cole-trapnell-lab.github.io/cufflinks FastQC v0.11.5 https://www.bioinformatics. babraham.ac.uk/projects/fastqc/ https://www.bioinformatics.babraham.ac.uk/ projects/download.html#fastqc RSeQC v2.6.4 Wang et al., 2012 http://rseqc.sourceforge.net/ SIBER (OOMPA v2.1.0) Tong et al., 2013 http://bioinformatics.mdanderson.org/main/ OOMPA:Overview bc-GenExMiner 4.0 Jézéquel et al., 2012 http://bcgenex.centregauducheau.fr/BC-GEM/ GEM-Accueil.php?js=1 DAVID website v6.8 Huang et al., 2009 https://david.ncifcrf.gov/ GSEA software (MSigDB 6.2) Subramanian et al., 2005 http://software.broadinstitute.org/gsea/index.jsp Cell Reports 25, 2285–2298.e1–e4, November 20, 2018 e1 ..

    Multiplex Assay:

    Article Title: Single-Cell Transcriptome Analysis Reveals Estrogen Signaling Coordinately Augments One-Carbon, Polyamine, and Purine Synthesis in Breast Cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins 17b-estradiol (E2) Sigma Cat# 50-28-2 Critical Commercial Assays RNeasy Mini Kit QIAGEN Cat# 74106 SMARTer Ultra Low RNA Kit Clontech Cat# 634936 C1 Single-Cell mRNA Seq IFC Fluidigm Cat# 100-6041 C1 Single-Cell Reagent Kit for mRNA Seq Fluidigm Cat# 100-6201 C1 Single-Cell mRNA Seq HT IFC Fluidigm Cat# 101-4982 C1 Single-Cell mRNA Seq HT Reagent Kit v2 Fluidigm Cat# 101-3473 Nextera XT Sample Prep Kit Illumina Cat# FC-131-1096 Nextera XT DNA Sample Preparation Index Kit Illumina Cat# FC-131-1002 KAPA Library Quantification Kit KAPA Biosystems Cat# KR0405 Nextera XT Index Kit v2 Illumina Cat# FC-131-2001(set A) and FC-131-2002(set B). ddPCR Supermix for Probes (no dUTP) BioRad Cat# 186-3024 ddPCR Droplet Reader Oil BioRad Cat# 186-3004 DG8 Cartridges and Gaskets BioRad Cat# 186-4007 ddPCR 96-Well PCR Plates BioRad Cat# 12001925 RNAscope Multiplex Fluorescent v2 Kit ACDbio Cat# 323110 Cell apoptosis kit ThermoFisher Cat# V13245 MTT ThermoFisher Cat# M6494 Deposited Data Raw and analyzed data This paper GEO: GSE107864, GSE119455 Genome reference UCSC hg19 UCSC http://hgdownload.soe.ucsc.edu/goldenPath/ hg19/bigZips/ Gene annotation reference Gencode V18 Gencode database https://www.gencodegenes.org/18.html ERa ChIP-seq data Ross-Innes et al., 2012 GEO: GSE32222 Experimental Models: Cell Lines Human: MCF7 ATCC ATCC HTB-22 Human: T47D ATCC ATCC HTB-133 Oligonucleotides Primer sets and probes used in droplet digital PCR (Table S2) This paper N/A DsiRNAs used for knockdown assays (Table S3) This paper N/A Software and Algorithms Tophat v2.0.6 Kim et al., 2013 https://ccb.jhu.edu/software/tophat/index.shtml Cufflink v2.0.2 Trapnell et al., 2012 http://cole-trapnell-lab.github.io/cufflinks FastQC v0.11.5 https://www.bioinformatics. babraham.ac.uk/projects/fastqc/ https://www.bioinformatics.babraham.ac.uk/ projects/download.html#fastqc RSeQC v2.6.4 Wang et al., 2012 http://rseqc.sourceforge.net/ SIBER (OOMPA v2.1.0) Tong et al., 2013 http://bioinformatics.mdanderson.org/main/ OOMPA:Overview bc-GenExMiner 4.0 Jézéquel et al., 2012 http://bcgenex.centregauducheau.fr/BC-GEM/ GEM-Accueil.php?js=1 DAVID website v6.8 Huang et al., 2009 https://david.ncifcrf.gov/ GSEA software (MSigDB 6.2) Subramanian et al., 2005 http://software.broadinstitute.org/gsea/index.jsp Cell Reports 25, 2285–2298.e1–e4, November 20, 2018 e1 ..

    MTT Assay:

    Article Title: Single-Cell Transcriptome Analysis Reveals Estrogen Signaling Coordinately Augments One-Carbon, Polyamine, and Purine Synthesis in Breast Cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins 17b-estradiol (E2) Sigma Cat# 50-28-2 Critical Commercial Assays RNeasy Mini Kit QIAGEN Cat# 74106 SMARTer Ultra Low RNA Kit Clontech Cat# 634936 C1 Single-Cell mRNA Seq IFC Fluidigm Cat# 100-6041 C1 Single-Cell Reagent Kit for mRNA Seq Fluidigm Cat# 100-6201 C1 Single-Cell mRNA Seq HT IFC Fluidigm Cat# 101-4982 C1 Single-Cell mRNA Seq HT Reagent Kit v2 Fluidigm Cat# 101-3473 Nextera XT Sample Prep Kit Illumina Cat# FC-131-1096 Nextera XT DNA Sample Preparation Index Kit Illumina Cat# FC-131-1002 KAPA Library Quantification Kit KAPA Biosystems Cat# KR0405 Nextera XT Index Kit v2 Illumina Cat# FC-131-2001(set A) and FC-131-2002(set B). ddPCR Supermix for Probes (no dUTP) BioRad Cat# 186-3024 ddPCR Droplet Reader Oil BioRad Cat# 186-3004 DG8 Cartridges and Gaskets BioRad Cat# 186-4007 ddPCR 96-Well PCR Plates BioRad Cat# 12001925 RNAscope Multiplex Fluorescent v2 Kit ACDbio Cat# 323110 Cell apoptosis kit ThermoFisher Cat# V13245 MTT ThermoFisher Cat# M6494 Deposited Data Raw and analyzed data This paper GEO: GSE107864, GSE119455 Genome reference UCSC hg19 UCSC http://hgdownload.soe.ucsc.edu/goldenPath/ hg19/bigZips/ Gene annotation reference Gencode V18 Gencode database https://www.gencodegenes.org/18.html ERa ChIP-seq data Ross-Innes et al., 2012 GEO: GSE32222 Experimental Models: Cell Lines Human: MCF7 ATCC ATCC HTB-22 Human: T47D ATCC ATCC HTB-133 Oligonucleotides Primer sets and probes used in droplet digital PCR (Table S2) This paper N/A DsiRNAs used for knockdown assays (Table S3) This paper N/A Software and Algorithms Tophat v2.0.6 Kim et al., 2013 https://ccb.jhu.edu/software/tophat/index.shtml Cufflink v2.0.2 Trapnell et al., 2012 http://cole-trapnell-lab.github.io/cufflinks FastQC v0.11.5 https://www.bioinformatics. babraham.ac.uk/projects/fastqc/ https://www.bioinformatics.babraham.ac.uk/ projects/download.html#fastqc RSeQC v2.6.4 Wang et al., 2012 http://rseqc.sourceforge.net/ SIBER (OOMPA v2.1.0) Tong et al., 2013 http://bioinformatics.mdanderson.org/main/ OOMPA:Overview bc-GenExMiner 4.0 Jézéquel et al., 2012 http://bcgenex.centregauducheau.fr/BC-GEM/ GEM-Accueil.php?js=1 DAVID website v6.8 Huang et al., 2009 https://david.ncifcrf.gov/ GSEA software (MSigDB 6.2) Subramanian et al., 2005 http://software.broadinstitute.org/gsea/index.jsp Cell Reports 25, 2285–2298.e1–e4, November 20, 2018 e1 ..

    Chromatin Immunoprecipitation:

    Article Title: Single-Cell Transcriptome Analysis Reveals Estrogen Signaling Coordinately Augments One-Carbon, Polyamine, and Purine Synthesis in Breast Cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins 17b-estradiol (E2) Sigma Cat# 50-28-2 Critical Commercial Assays RNeasy Mini Kit QIAGEN Cat# 74106 SMARTer Ultra Low RNA Kit Clontech Cat# 634936 C1 Single-Cell mRNA Seq IFC Fluidigm Cat# 100-6041 C1 Single-Cell Reagent Kit for mRNA Seq Fluidigm Cat# 100-6201 C1 Single-Cell mRNA Seq HT IFC Fluidigm Cat# 101-4982 C1 Single-Cell mRNA Seq HT Reagent Kit v2 Fluidigm Cat# 101-3473 Nextera XT Sample Prep Kit Illumina Cat# FC-131-1096 Nextera XT DNA Sample Preparation Index Kit Illumina Cat# FC-131-1002 KAPA Library Quantification Kit KAPA Biosystems Cat# KR0405 Nextera XT Index Kit v2 Illumina Cat# FC-131-2001(set A) and FC-131-2002(set B). ddPCR Supermix for Probes (no dUTP) BioRad Cat# 186-3024 ddPCR Droplet Reader Oil BioRad Cat# 186-3004 DG8 Cartridges and Gaskets BioRad Cat# 186-4007 ddPCR 96-Well PCR Plates BioRad Cat# 12001925 RNAscope Multiplex Fluorescent v2 Kit ACDbio Cat# 323110 Cell apoptosis kit ThermoFisher Cat# V13245 MTT ThermoFisher Cat# M6494 Deposited Data Raw and analyzed data This paper GEO: GSE107864, GSE119455 Genome reference UCSC hg19 UCSC http://hgdownload.soe.ucsc.edu/goldenPath/ hg19/bigZips/ Gene annotation reference Gencode V18 Gencode database https://www.gencodegenes.org/18.html ERa ChIP-seq data Ross-Innes et al., 2012 GEO: GSE32222 Experimental Models: Cell Lines Human: MCF7 ATCC ATCC HTB-22 Human: T47D ATCC ATCC HTB-133 Oligonucleotides Primer sets and probes used in droplet digital PCR (Table S2) This paper N/A DsiRNAs used for knockdown assays (Table S3) This paper N/A Software and Algorithms Tophat v2.0.6 Kim et al., 2013 https://ccb.jhu.edu/software/tophat/index.shtml Cufflink v2.0.2 Trapnell et al., 2012 http://cole-trapnell-lab.github.io/cufflinks FastQC v0.11.5 https://www.bioinformatics. babraham.ac.uk/projects/fastqc/ https://www.bioinformatics.babraham.ac.uk/ projects/download.html#fastqc RSeQC v2.6.4 Wang et al., 2012 http://rseqc.sourceforge.net/ SIBER (OOMPA v2.1.0) Tong et al., 2013 http://bioinformatics.mdanderson.org/main/ OOMPA:Overview bc-GenExMiner 4.0 Jézéquel et al., 2012 http://bcgenex.centregauducheau.fr/BC-GEM/ GEM-Accueil.php?js=1 DAVID website v6.8 Huang et al., 2009 https://david.ncifcrf.gov/ GSEA software (MSigDB 6.2) Subramanian et al., 2005 http://software.broadinstitute.org/gsea/index.jsp Cell Reports 25, 2285–2298.e1–e4, November 20, 2018 e1 ..

    Digital PCR:

    Article Title: Single-Cell Transcriptome Analysis Reveals Estrogen Signaling Coordinately Augments One-Carbon, Polyamine, and Purine Synthesis in Breast Cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins 17b-estradiol (E2) Sigma Cat# 50-28-2 Critical Commercial Assays RNeasy Mini Kit QIAGEN Cat# 74106 SMARTer Ultra Low RNA Kit Clontech Cat# 634936 C1 Single-Cell mRNA Seq IFC Fluidigm Cat# 100-6041 C1 Single-Cell Reagent Kit for mRNA Seq Fluidigm Cat# 100-6201 C1 Single-Cell mRNA Seq HT IFC Fluidigm Cat# 101-4982 C1 Single-Cell mRNA Seq HT Reagent Kit v2 Fluidigm Cat# 101-3473 Nextera XT Sample Prep Kit Illumina Cat# FC-131-1096 Nextera XT DNA Sample Preparation Index Kit Illumina Cat# FC-131-1002 KAPA Library Quantification Kit KAPA Biosystems Cat# KR0405 Nextera XT Index Kit v2 Illumina Cat# FC-131-2001(set A) and FC-131-2002(set B). ddPCR Supermix for Probes (no dUTP) BioRad Cat# 186-3024 ddPCR Droplet Reader Oil BioRad Cat# 186-3004 DG8 Cartridges and Gaskets BioRad Cat# 186-4007 ddPCR 96-Well PCR Plates BioRad Cat# 12001925 RNAscope Multiplex Fluorescent v2 Kit ACDbio Cat# 323110 Cell apoptosis kit ThermoFisher Cat# V13245 MTT ThermoFisher Cat# M6494 Deposited Data Raw and analyzed data This paper GEO: GSE107864, GSE119455 Genome reference UCSC hg19 UCSC http://hgdownload.soe.ucsc.edu/goldenPath/ hg19/bigZips/ Gene annotation reference Gencode V18 Gencode database https://www.gencodegenes.org/18.html ERa ChIP-seq data Ross-Innes et al., 2012 GEO: GSE32222 Experimental Models: Cell Lines Human: MCF7 ATCC ATCC HTB-22 Human: T47D ATCC ATCC HTB-133 Oligonucleotides Primer sets and probes used in droplet digital PCR (Table S2) This paper N/A DsiRNAs used for knockdown assays (Table S3) This paper N/A Software and Algorithms Tophat v2.0.6 Kim et al., 2013 https://ccb.jhu.edu/software/tophat/index.shtml Cufflink v2.0.2 Trapnell et al., 2012 http://cole-trapnell-lab.github.io/cufflinks FastQC v0.11.5 https://www.bioinformatics. babraham.ac.uk/projects/fastqc/ https://www.bioinformatics.babraham.ac.uk/ projects/download.html#fastqc RSeQC v2.6.4 Wang et al., 2012 http://rseqc.sourceforge.net/ SIBER (OOMPA v2.1.0) Tong et al., 2013 http://bioinformatics.mdanderson.org/main/ OOMPA:Overview bc-GenExMiner 4.0 Jézéquel et al., 2012 http://bcgenex.centregauducheau.fr/BC-GEM/ GEM-Accueil.php?js=1 DAVID website v6.8 Huang et al., 2009 https://david.ncifcrf.gov/ GSEA software (MSigDB 6.2) Subramanian et al., 2005 http://software.broadinstitute.org/gsea/index.jsp Cell Reports 25, 2285–2298.e1–e4, November 20, 2018 e1 ..

    Knockdown:

    Article Title: Single-Cell Transcriptome Analysis Reveals Estrogen Signaling Coordinately Augments One-Carbon, Polyamine, and Purine Synthesis in Breast Cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins 17b-estradiol (E2) Sigma Cat# 50-28-2 Critical Commercial Assays RNeasy Mini Kit QIAGEN Cat# 74106 SMARTer Ultra Low RNA Kit Clontech Cat# 634936 C1 Single-Cell mRNA Seq IFC Fluidigm Cat# 100-6041 C1 Single-Cell Reagent Kit for mRNA Seq Fluidigm Cat# 100-6201 C1 Single-Cell mRNA Seq HT IFC Fluidigm Cat# 101-4982 C1 Single-Cell mRNA Seq HT Reagent Kit v2 Fluidigm Cat# 101-3473 Nextera XT Sample Prep Kit Illumina Cat# FC-131-1096 Nextera XT DNA Sample Preparation Index Kit Illumina Cat# FC-131-1002 KAPA Library Quantification Kit KAPA Biosystems Cat# KR0405 Nextera XT Index Kit v2 Illumina Cat# FC-131-2001(set A) and FC-131-2002(set B). ddPCR Supermix for Probes (no dUTP) BioRad Cat# 186-3024 ddPCR Droplet Reader Oil BioRad Cat# 186-3004 DG8 Cartridges and Gaskets BioRad Cat# 186-4007 ddPCR 96-Well PCR Plates BioRad Cat# 12001925 RNAscope Multiplex Fluorescent v2 Kit ACDbio Cat# 323110 Cell apoptosis kit ThermoFisher Cat# V13245 MTT ThermoFisher Cat# M6494 Deposited Data Raw and analyzed data This paper GEO: GSE107864, GSE119455 Genome reference UCSC hg19 UCSC http://hgdownload.soe.ucsc.edu/goldenPath/ hg19/bigZips/ Gene annotation reference Gencode V18 Gencode database https://www.gencodegenes.org/18.html ERa ChIP-seq data Ross-Innes et al., 2012 GEO: GSE32222 Experimental Models: Cell Lines Human: MCF7 ATCC ATCC HTB-22 Human: T47D ATCC ATCC HTB-133 Oligonucleotides Primer sets and probes used in droplet digital PCR (Table S2) This paper N/A DsiRNAs used for knockdown assays (Table S3) This paper N/A Software and Algorithms Tophat v2.0.6 Kim et al., 2013 https://ccb.jhu.edu/software/tophat/index.shtml Cufflink v2.0.2 Trapnell et al., 2012 http://cole-trapnell-lab.github.io/cufflinks FastQC v0.11.5 https://www.bioinformatics. babraham.ac.uk/projects/fastqc/ https://www.bioinformatics.babraham.ac.uk/ projects/download.html#fastqc RSeQC v2.6.4 Wang et al., 2012 http://rseqc.sourceforge.net/ SIBER (OOMPA v2.1.0) Tong et al., 2013 http://bioinformatics.mdanderson.org/main/ OOMPA:Overview bc-GenExMiner 4.0 Jézéquel et al., 2012 http://bcgenex.centregauducheau.fr/BC-GEM/ GEM-Accueil.php?js=1 DAVID website v6.8 Huang et al., 2009 https://david.ncifcrf.gov/ GSEA software (MSigDB 6.2) Subramanian et al., 2005 http://software.broadinstitute.org/gsea/index.jsp Cell Reports 25, 2285–2298.e1–e4, November 20, 2018 e1 ..

    RNA Sequencing:

    Article Title: Single cell analyses identify a highly regenerative and homogenous human CD34+ hematopoietic stem cell population
    Article Snippet: CD11c APC BD Biosciences B-ly6 CD14 FITC BD Biosciences M5E2 CD15 FITC BD Biosciences HI98 CD19 APC-eFluor780 Thermo Fisher Scientific/eBioscience HIB19 CD19 FITC BD Biosciences HIB19 CD33 PE BD Biosciences WM53 CD33 PE-Cy7 Thermo Fisher Scientific/eBioscience WM53 CD34 FITC BD Biosciences 581 CD34 PerCp BD Biosciences 8G12 CD38 PE-Cy7 Thermo Fisher Scientific/eBioscience HB7 CD38 APC-eFluor780 Thermo Fisher Scientific/eBioscience HB7 CD45 FITC BD Biosciences HI30 CD45 PerCp BD Biosciences HI30 CD45 APC BD Biosciences HI30 CD45RA FITC BD Biosciences HI100 CD45RA PE-Cy7 Thermo Fisher Scientific/eBioscience HI100 CD49f PE BD Biosciences GoH3 CD49f AlexaFluor 647 BD Biosciences GoH3 CD56 PE BD Biosciences B159 CD90 PerCp-eFluor710 Thermo Fisher Scientific/eBioscience 5E10 CD90 APC Thermo Fisher Scientific/eBioscience 5E10 CD90 BV605 BD Biosciences 5E10 CD93/C1qRp Biotin Biolegend VIMD2 CD133 PE Miltenyi Biotec AC133 CD143 APC BD Biosciences BB9 CD201/EPCR PE BD Biosciences RCR-252 CD201/EPCR APC BD Biosciences RCR-252 CD201/EPCR PE Biolegend RCR-401 CD201/EPCR APC Biolegend RCR-401 CD201/EPCR APC Thermo Fisher Scientific/eBioscience RCR-227 Chemicals and Recombinant Proteins for Cell Culture and in vivo Experiments Ficoll-Paque GE Healthcare Life Sciences 17-1440-02 EasySep CD34+ Selection Kit II StemCell Technologies 17856 EasySep Mouse/Human Chimera Enrichment kit StemCell Technologies 19849 StemSep Human Progenitor Enrichment Kit StemCell Technologies 14056 Collagen Solution StemCell Technologies 04902 alpha-Minimum Essential media with nucleosides (MEM) Thermo Fisher Scientific/Gibco 22571038 MyeloCultTM H5100 StemCell Technologies 05150 StemSpanTM SFEM II StemCell Technologies 09605 IL2 Peprotech 200-02 IL7 Peprotech 200-07 IL15 Peprotech 200-15 FLT3L Peprotech 300-19 G-CSF Peprotech 300-23 SCF Peprotech 300-07 TPO Peprotech 300-18 Immune Globulin Intravenous (IVIG; human) Bio Products Laboratory (BPL) Gammaplex 5% Betamox 150 mg/ml suspension for injection Norbrook Betamox LA 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) Merck/Sigma-Aldrich D8417 CellTraceTM Violet staining kit Thermo Fisher Scientific C34557 TMRE (tetramethylrhodamine ethyl ester) BD Biosciences 564696 CellTitre-Glow 2.0 kit Promega G9241 Click-&-Go Plus 488 OPP Protein Synthesis Assay Kit Clickchemistrytools 1493 Saponin Merck-Sigma 47036 .. 96-well skirted FrameStar PCR plates 4titude 4ti-0960 TrixonX-100 solution Merck/Sigma-Aldrich 93443 RNAse inhibitor Thermo Fisher Scientific/Ambion AM2682 KAPA Stranded with RiboErase RNA-seq kit KAPA Biosystems KK8483 Kapa Dual-Indexed Adapters KAPA Biosystems KK8720 RNeasy Plus Micro Kit Qiagen 74034 Agencourt AMPure XP beads Beckman Coulter A63880 NexteraTM XT DNA Sample Prep Kit Illumina FC-1311096 C1TM Single-Cell Reagent Kit for mRNA Seq Fluidigm 100-6201 Ethidium homodimer-1 Thermo Fisher Scientific/Invitrogen E1169 Calcein AM Thermo Fisher Scientific/Invitrogen C3099 SMART-Seq v4 Ultra Low Input RNA Kit for C1 System Takara 635026 .. FACSDiva v. 8.0.1.1 BD Biosciences N/A FlowJo v 9.96 and 10.6.2 FlowJo, LLC N/A Extreme Limiting Dilution Analysis (ELDA) Hu and Smyth (2009) http://bioinf. wehi.edu.au /software/el da/index.ht ml Prism 8.4.2 GraphPad Software N/A Adobe Illustrator 26.0.3 Adobe Inc. N/A DeSeq2 V1.28.1 Love et al., 2014 https://bioco nductor.org/ packages/re lease/bioc/h tml/DESeq2 .html GSEA 4.1.0 Subramanian et al., 2005 www.gseamsigdb.org/ gsea/index.j sp STAR_2.4 Dobin et al., 2013 https://githu b.com/alexd obin/STAR RSEM_1.2.8 Li et al., 2011 https://githu b.com/dewe ylab/RSEM R 3.5.0 N/A https://www. r-project.org

    RNA HS Assay:

    Article Title: Transcriptional Convergence of Oligodendrocyte Lineage Progenitors during Development.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Chicken polyclonal anti-GFP Abcam ab13970, RRID:AB_300798 Goat polyclonal anti-PDGFRA R&D AF1062, RRID:AB_2236897 Rabbit polyclonal anti-COL1A1 Abcam ab21286, RRID:AB_446161 Mouse monoclonal anti-CC1 (anti-APC) Millipore OP80, RRID:AB_2057371 Rabbit polyclonal anti-NG2 Millipore AB5320, RRID:AB_11213678 Experimental Models: Organisms/Strains Pdgfra-CreERT1/RCE (mouse) The Jackson Laboratory B6N.Cg-Tg(Pdgfra-CreERT)467Dbe/J crossed with Gt(ROSA)26Sortm1.1(CAG-EGFP)Fsh/Mmjax Pdgfra-H2BGFP (mouse) Philippe Soriano B6.129S4-Pdgfratm11(EGFP)Sor/J Critical Commercial Assays Neural tissue dissociation kit (P) Miltenyi 130-092-628 C1 Single-Cell Reagent Kit for mRNA Seq Fluidigm 100-6201 miRNeasy micro kit Qiagen 217084 MaxTract High density Qiagen 29046 QuBit RNA HS assay kit ThermoFisher Q32852 RNA 6000 Pico Kit Agilent 5067-1513 TruSeq Stranded Total RNA Library Prep Kit Illumina 20020596 Other C1 Single-Cell Open App IFC, 10–17 mm Fluidigm 100-8134 C1 instrument Fluidigm N/A FACSAria III Cell Sorter B5/R3/V3 BD biosciences N/A Axopatch 200B Amplifier Molecular Devices N/A Digidata 1322A Molecular Devices N/A Nikon Ti-E with motorized stage Nikon N/A 7900HT Fast System Applied biosystems N/A Software and Algorithms FastQC Andrews (2010) https://www.bioinformatics.babraham.ac.uk/ projects/fastqc/ STAR (v.2.5.0a) Dobin et al. (2013) https://github.com/alexdobin/STAR GENCODE M8 annotations Mudge and Harrow (2015) https://www.gencodegenes.org/ featureCounts v1.5.0-p1 Liao et al. (2014) http://bioinf.wehi.edu.au/featureCounts/ Bioconductor packages Gentleman et al. (2004) https://www.bioconductor.org/ biomaRt library Durinck et al. (2009) https://bioconductor.org/packages/release/bioc/ html/biomaRt.html limma package Ritchie et al. (2015) http://bioconductor.org/packages/release/bioc/ html/limma.html DESeq2 package Love et al. (2014) http://bioconductor.org/packages/release/bioc/ html/DESeq2.html heatmap3 library Zhao et al. (2014) https://cran.r-project.org/web/packages/ heatmap3/index.html RNASeqPower library Hart et al. (2013) https://bioconductor.org/packages/release/bioc/ html/RNASeqPower.html topGO R package Alexa and Rahnenfuhrer (2016) https://bioconductor.org/packages/release/bioc/ html/topGO.html (Continued on next page) e1 Developmental Cell 46, 504–517.e1–e7, August 20, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fisher-elim algorithm Alexa et al. (2006) https://bioconductor.org/packages/3.7/bioc/ vignettes/topGO/inst/doc/topGO.pdf Cytoscape Cline et al. (2007) http://www.cytoscape.org/ EnrichmentMap plugin Merico et al. (2010) http://baderlab.org/Software/EnrichmentMap HISAT2 version 2.0.5 Kim et al. (2015) https://ccb.jhu.edu/software/hisat2/index.shtml Stringtie 1.3.1c Pertea et al. (2015) http://www.ccb.jhu.edu/software/stringtie/ BackSPIN2 algorithm Marques et al. (2016) https://github.com/linnarsson-lab/BackSPIN Rpackage DPT Haghverdi et al. (2016) https://www.rdocumentation.org/packages/ destiny/versions/2.0.4/topics/DPT PAGODA (SCDE R-package) Fan et al. (2016) http://hms-dbmi.github.io/scde/ MAST package R Finak et al. (2015) https://github.com/RGLab/MAST SCN3E This paper https://github.com/Castelo-Branco-lab/ OPCsinglecell2017 Deposited Data Raw and Analysed data This paper GEO: GSE95194 (single cell) and GEO: GSE95093 (bulk) Other Webresource with browsable data This paper https://ki.se/en/mbb/oligointernode



    Similar Products

    92
    fluidigm large ifc plate fluidigm 100 5761
    Large Ifc Plate Fluidigm 100 5761, supplied by fluidigm, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mrna+seq+fluidigm/C1+Single-Cell+mRNA+Seq+IFC/pmc12004274-158-44-47
    Average 92 stars, based on 1 article reviews
    large ifc plate fluidigm 100 5761 - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    93
    fluidigm c1 fluidigm system single cells
    (a) Schematic overview of the study design (see detailed descriptions and notations in the Methods). Two reference cell lines (Sample A, HCC1395; and Sample B, HCC1395BL) were used to generate scRNA-seq data across four platforms (10X Genomics, Fluidigm <t>C1,</t> Fluidigm C1 HT, and Takara Bio ICELL8), four testing sites (LLU, NCI, FDA, and TBU). At the LLU and NCI sites (10X), mixed single-cell captures and library constructions were also prepared with either 10% or 5% cancer cells spiked into the B lymphocytes. At the NCI site, single-cell captures and library constructions were also performed with methanol-fixed cell mixtures (5% cancer cells spiked into B lymphocytes, Fixed 1 & 2). One set of 10X scRNA libraries from NCI was also sequenced using a shorter modified sequencing method. Bulk <t>cell</t> <t>RNA-seq</t> was also obtained from these cell lines, each in triplicate. See Methods for details about study design. (b) For both the breast cancer cell line (Sample A) and the B lymphocyte line (Sample B) across 14 pair-wise datasets, percentage of reads mapped to the exonic region (blue), non-exonic region (orange), or not mapped to the human genome (gray). For unique molecular identifier (UMI) methods (10X), dark blue indicates the exonic reads with UMIs. (c) Median number of genes detected per cell at different sequencing read depths.
    C1 Fluidigm System Single Cells, supplied by fluidigm, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mrna+seq+fluidigm/C1+Single-Cell+mRNA+Seq+HT+10-17+%C2%B5m%E2%80%945+IFCs/pmc11245320-490-8-9
    Average 93 stars, based on 1 article reviews
    c1 fluidigm system single cells - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    fluidigm cell fluidigm rna seq analysis
    (a) Schematic overview of the study design (see detailed descriptions and notations in the Methods). Two reference cell lines (Sample A, HCC1395; and Sample B, HCC1395BL) were used to generate scRNA-seq data across four platforms (10X Genomics, Fluidigm <t>C1,</t> Fluidigm C1 HT, and Takara Bio ICELL8), four testing sites (LLU, NCI, FDA, and TBU). At the LLU and NCI sites (10X), mixed single-cell captures and library constructions were also prepared with either 10% or 5% cancer cells spiked into the B lymphocytes. At the NCI site, single-cell captures and library constructions were also performed with methanol-fixed cell mixtures (5% cancer cells spiked into B lymphocytes, Fixed 1 & 2). One set of 10X scRNA libraries from NCI was also sequenced using a shorter modified sequencing method. Bulk <t>cell</t> <t>RNA-seq</t> was also obtained from these cell lines, each in triplicate. See Methods for details about study design. (b) For both the breast cancer cell line (Sample A) and the B lymphocyte line (Sample B) across 14 pair-wise datasets, percentage of reads mapped to the exonic region (blue), non-exonic region (orange), or not mapped to the human genome (gray). For unique molecular identifier (UMI) methods (10X), dark blue indicates the exonic reads with UMIs. (c) Median number of genes detected per cell at different sequencing read depths.
    Cell Fluidigm Rna Seq Analysis, supplied by fluidigm, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mrna+seq+fluidigm/C1+Single-Cell+mRNA+Seq+HT/pmc10792516-1145-18-19
    Average 93 stars, based on 1 article reviews
    cell fluidigm rna seq analysis - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    fluidigm c1 single cell mrna seq ht ifc fluidigm
    (a) Schematic overview of the study design (see detailed descriptions and notations in the Methods). Two reference cell lines (Sample A, HCC1395; and Sample B, HCC1395BL) were used to generate scRNA-seq data across four platforms (10X Genomics, Fluidigm <t>C1,</t> Fluidigm C1 HT, and Takara Bio ICELL8), four testing sites (LLU, NCI, FDA, and TBU). At the LLU and NCI sites (10X), mixed single-cell captures and library constructions were also prepared with either 10% or 5% cancer cells spiked into the B lymphocytes. At the NCI site, single-cell captures and library constructions were also performed with methanol-fixed cell mixtures (5% cancer cells spiked into B lymphocytes, Fixed 1 & 2). One set of 10X scRNA libraries from NCI was also sequenced using a shorter modified sequencing method. Bulk <t>cell</t> <t>RNA-seq</t> was also obtained from these cell lines, each in triplicate. See Methods for details about study design. (b) For both the breast cancer cell line (Sample A) and the B lymphocyte line (Sample B) across 14 pair-wise datasets, percentage of reads mapped to the exonic region (blue), non-exonic region (orange), or not mapped to the human genome (gray). For unique molecular identifier (UMI) methods (10X), dark blue indicates the exonic reads with UMIs. (c) Median number of genes detected per cell at different sequencing read depths.
    C1 Single Cell Mrna Seq Ht Ifc Fluidigm, supplied by fluidigm, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mrna+seq+fluidigm/C1+Single-Cell+mRNA+Seq+HT/pm37433294-245-98-104
    Average 93 stars, based on 1 article reviews
    c1 single cell mrna seq ht ifc fluidigm - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    fluidigm mrna seq fluidigm
    (a) Schematic overview of the study design (see detailed descriptions and notations in the Methods). Two reference cell lines (Sample A, HCC1395; and Sample B, HCC1395BL) were used to generate scRNA-seq data across four platforms (10X Genomics, Fluidigm <t>C1,</t> Fluidigm C1 HT, and Takara Bio ICELL8), four testing sites (LLU, NCI, FDA, and TBU). At the LLU and NCI sites (10X), mixed single-cell captures and library constructions were also prepared with either 10% or 5% cancer cells spiked into the B lymphocytes. At the NCI site, single-cell captures and library constructions were also performed with methanol-fixed cell mixtures (5% cancer cells spiked into B lymphocytes, Fixed 1 & 2). One set of 10X scRNA libraries from NCI was also sequenced using a shorter modified sequencing method. Bulk <t>cell</t> <t>RNA-seq</t> was also obtained from these cell lines, each in triplicate. See Methods for details about study design. (b) For both the breast cancer cell line (Sample A) and the B lymphocyte line (Sample B) across 14 pair-wise datasets, percentage of reads mapped to the exonic region (blue), non-exonic region (orange), or not mapped to the human genome (gray). For unique molecular identifier (UMI) methods (10X), dark blue indicates the exonic reads with UMIs. (c) Median number of genes detected per cell at different sequencing read depths.
    Mrna Seq Fluidigm, supplied by fluidigm, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mrna+seq+fluidigm/C1+Single-Cell+Reagent+Kit+for+mRNA+Seq/pm35120598-315-53-55
    Average 93 stars, based on 1 article reviews
    mrna seq fluidigm - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    92
    fluidigm fluidigm integrated fluidics chip
    (a) Schematic overview of the study design (see detailed descriptions and notations in the Methods). Two reference cell lines (Sample A, HCC1395; and Sample B, HCC1395BL) were used to generate scRNA-seq data across four platforms (10X Genomics, Fluidigm <t>C1,</t> Fluidigm C1 HT, and Takara Bio ICELL8), four testing sites (LLU, NCI, FDA, and TBU). At the LLU and NCI sites (10X), mixed single-cell captures and library constructions were also prepared with either 10% or 5% cancer cells spiked into the B lymphocytes. At the NCI site, single-cell captures and library constructions were also performed with methanol-fixed cell mixtures (5% cancer cells spiked into B lymphocytes, Fixed 1 & 2). One set of 10X scRNA libraries from NCI was also sequenced using a shorter modified sequencing method. Bulk <t>cell</t> <t>RNA-seq</t> was also obtained from these cell lines, each in triplicate. See Methods for details about study design. (b) For both the breast cancer cell line (Sample A) and the B lymphocyte line (Sample B) across 14 pair-wise datasets, percentage of reads mapped to the exonic region (blue), non-exonic region (orange), or not mapped to the human genome (gray). For unique molecular identifier (UMI) methods (10X), dark blue indicates the exonic reads with UMIs. (c) Median number of genes detected per cell at different sequencing read depths.
    Fluidigm Integrated Fluidics Chip, supplied by fluidigm, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mrna+seq+fluidigm/C1+Single-Cell+mRNA+Seq+IFC/pmc09169651__pnas__2108760119__sapp-41-9-9
    Average 92 stars, based on 1 article reviews
    fluidigm integrated fluidics chip - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    94
    fluidigm 5760 fluidigm c1 suspension reagent fluidigm
    (a) Schematic overview of the study design (see detailed descriptions and notations in the Methods). Two reference cell lines (Sample A, HCC1395; and Sample B, HCC1395BL) were used to generate scRNA-seq data across four platforms (10X Genomics, Fluidigm <t>C1,</t> Fluidigm C1 HT, and Takara Bio ICELL8), four testing sites (LLU, NCI, FDA, and TBU). At the LLU and NCI sites (10X), mixed single-cell captures and library constructions were also prepared with either 10% or 5% cancer cells spiked into the B lymphocytes. At the NCI site, single-cell captures and library constructions were also performed with methanol-fixed cell mixtures (5% cancer cells spiked into B lymphocytes, Fixed 1 & 2). One set of 10X scRNA libraries from NCI was also sequenced using a shorter modified sequencing method. Bulk <t>cell</t> <t>RNA-seq</t> was also obtained from these cell lines, each in triplicate. See Methods for details about study design. (b) For both the breast cancer cell line (Sample A) and the B lymphocyte line (Sample B) across 14 pair-wise datasets, percentage of reads mapped to the exonic region (blue), non-exonic region (orange), or not mapped to the human genome (gray). For unique molecular identifier (UMI) methods (10X), dark blue indicates the exonic reads with UMIs. (c) Median number of genes detected per cell at different sequencing read depths.
    5760 Fluidigm C1 Suspension Reagent Fluidigm, supplied by fluidigm, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mrna+seq+fluidigm/C1+Single-Cell+mRNA+Seq+IFC/pm35021086-199-198-199
    Average 94 stars, based on 1 article reviews
    5760 fluidigm c1 suspension reagent fluidigm - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    Image Search Results


    (a) Schematic overview of the study design (see detailed descriptions and notations in the Methods). Two reference cell lines (Sample A, HCC1395; and Sample B, HCC1395BL) were used to generate scRNA-seq data across four platforms (10X Genomics, Fluidigm C1, Fluidigm C1 HT, and Takara Bio ICELL8), four testing sites (LLU, NCI, FDA, and TBU). At the LLU and NCI sites (10X), mixed single-cell captures and library constructions were also prepared with either 10% or 5% cancer cells spiked into the B lymphocytes. At the NCI site, single-cell captures and library constructions were also performed with methanol-fixed cell mixtures (5% cancer cells spiked into B lymphocytes, Fixed 1 & 2). One set of 10X scRNA libraries from NCI was also sequenced using a shorter modified sequencing method. Bulk cell RNA-seq was also obtained from these cell lines, each in triplicate. See Methods for details about study design. (b) For both the breast cancer cell line (Sample A) and the B lymphocyte line (Sample B) across 14 pair-wise datasets, percentage of reads mapped to the exonic region (blue), non-exonic region (orange), or not mapped to the human genome (gray). For unique molecular identifier (UMI) methods (10X), dark blue indicates the exonic reads with UMIs. (c) Median number of genes detected per cell at different sequencing read depths.

    Journal: Nature biotechnology

    Article Title: A multi-center study benchmarking single-cell RNA sequencing technologies using reference samples

    doi: 10.1038/s41587-020-00748-9

    Figure Lengend Snippet: (a) Schematic overview of the study design (see detailed descriptions and notations in the Methods). Two reference cell lines (Sample A, HCC1395; and Sample B, HCC1395BL) were used to generate scRNA-seq data across four platforms (10X Genomics, Fluidigm C1, Fluidigm C1 HT, and Takara Bio ICELL8), four testing sites (LLU, NCI, FDA, and TBU). At the LLU and NCI sites (10X), mixed single-cell captures and library constructions were also prepared with either 10% or 5% cancer cells spiked into the B lymphocytes. At the NCI site, single-cell captures and library constructions were also performed with methanol-fixed cell mixtures (5% cancer cells spiked into B lymphocytes, Fixed 1 & 2). One set of 10X scRNA libraries from NCI was also sequenced using a shorter modified sequencing method. Bulk cell RNA-seq was also obtained from these cell lines, each in triplicate. See Methods for details about study design. (b) For both the breast cancer cell line (Sample A) and the B lymphocyte line (Sample B) across 14 pair-wise datasets, percentage of reads mapped to the exonic region (blue), non-exonic region (orange), or not mapped to the human genome (gray). For unique molecular identifier (UMI) methods (10X), dark blue indicates the exonic reads with UMIs. (c) Median number of genes detected per cell at different sequencing read depths.

    Article Snippet: Single-cell full-length cDNA generation and RNA-seq using the C1 Fluidigm system Single cells were loaded on a medium-sized (10–17 μm) RNA-seq integrated fluidic circuit (IFC) at a concentration of 200 cells/μl.

    Techniques: Modification, Sequencing, RNA Sequencing

    (a) Batch-effect correction in Scenario #1, where all 20 scRNA-seq datasets were combined, including mixed and non-mixed, with large proportions of two dissimilar types of cells (Sample A, breast cancer cell line HCC1395; and Sample B, B-lymphocyte line HCC1395BL). Datasets from 10X were down-sampled to 1200 cells per dataset. (b) Batch-effect correction in Scenario #2, where five scRNA-seq datasets (10X_LLU_A, 10X_NCI_A, C1_FDA_HT_A, C1_LLU_A, and ICELL8_SE_A) from the breast cancer cells were generated separately at the four centers (LLU, NCI, FDA, and TBU) on four platforms (10X, Fluidigm C1, Fluidigm C1_HT, and TBU ICELL8); (c) Batch-effect correction in Scenario #3, where five scRNA-seq datasets (10X_LLU_B, 10X_NCI_B, C1_FDA_HT_B, C1_LLU_B, and ICELL8_SE_B) from the B lymphocytes were generated separately at the four centers on the same four platforms; (d) Batch-effect correction in Scenario #4, where four datasets (10X_LLU_Mix10, 10X_NCI_M_Mix5, 10X_NCI_M_Mix5_F, 10X_NCI_M_Mix5_F2) were generated from 5% or 10% breast cancer cells spiked into B lymphocytes, and analyzed with the 10X Genomics platform at two centers in four different batches. Each dataset is indicated by a unique color in panels (a) to (d). Idealized projection of cells for the four different scenarios is presented on the left. *Note for BBKNN, only UMAP is available and shown. Silhouette width score quantifying the clusterability for (e) Scenario #1 or (f) Scenario #4, corresponding to panels (a) and (d), respectively. (g) kBET acceptance score quantifying the mixability, calculated using the cross-platform/center scRNA-seq data acquired either from breast cancer cells only or from B-lymphocytes only for all four scenarios (a-d, also labeled as Scenarios #1–#4).

    Journal: Nature biotechnology

    Article Title: A multi-center study benchmarking single-cell RNA sequencing technologies using reference samples

    doi: 10.1038/s41587-020-00748-9

    Figure Lengend Snippet: (a) Batch-effect correction in Scenario #1, where all 20 scRNA-seq datasets were combined, including mixed and non-mixed, with large proportions of two dissimilar types of cells (Sample A, breast cancer cell line HCC1395; and Sample B, B-lymphocyte line HCC1395BL). Datasets from 10X were down-sampled to 1200 cells per dataset. (b) Batch-effect correction in Scenario #2, where five scRNA-seq datasets (10X_LLU_A, 10X_NCI_A, C1_FDA_HT_A, C1_LLU_A, and ICELL8_SE_A) from the breast cancer cells were generated separately at the four centers (LLU, NCI, FDA, and TBU) on four platforms (10X, Fluidigm C1, Fluidigm C1_HT, and TBU ICELL8); (c) Batch-effect correction in Scenario #3, where five scRNA-seq datasets (10X_LLU_B, 10X_NCI_B, C1_FDA_HT_B, C1_LLU_B, and ICELL8_SE_B) from the B lymphocytes were generated separately at the four centers on the same four platforms; (d) Batch-effect correction in Scenario #4, where four datasets (10X_LLU_Mix10, 10X_NCI_M_Mix5, 10X_NCI_M_Mix5_F, 10X_NCI_M_Mix5_F2) were generated from 5% or 10% breast cancer cells spiked into B lymphocytes, and analyzed with the 10X Genomics platform at two centers in four different batches. Each dataset is indicated by a unique color in panels (a) to (d). Idealized projection of cells for the four different scenarios is presented on the left. *Note for BBKNN, only UMAP is available and shown. Silhouette width score quantifying the clusterability for (e) Scenario #1 or (f) Scenario #4, corresponding to panels (a) and (d), respectively. (g) kBET acceptance score quantifying the mixability, calculated using the cross-platform/center scRNA-seq data acquired either from breast cancer cells only or from B-lymphocytes only for all four scenarios (a-d, also labeled as Scenarios #1–#4).

    Article Snippet: Single-cell full-length cDNA generation and RNA-seq using the C1 Fluidigm system Single cells were loaded on a medium-sized (10–17 μm) RNA-seq integrated fluidic circuit (IFC) at a concentration of 200 cells/μl.

    Techniques: Generated, Labeling

    Batch-effect corrections were performed for the following four scenarios: (a) Scenario 1, where all 20 scRNA-seq datasets were combined, including mixed and non-mixed, with large proportions of two dissimilar types of cells (Sample A, breast cancer cell line HCC1395 and Sample B, B-lymphocyte line HCC1395BL); Datasets from 10X were down-sampled to 1200 cells per dataset. (b) Scenario 2, where five datasets (10X_LLU_A, 10X_NCI_A, C1_FDA_HT_A, C1_LLU_A, and ICELL8_SE_A) from the breast cancer cells (Sample A, HCC1395) were generated separately at four centers (LLU, NCI, FDA, and TBU) on four platforms (10X, Fluidigm C1, Fluidigm C1_HT, and TBU ICELL8); (c) Scenario 3, where five datasets (10X_LLU_B, 10X_NCI_B, C1_FDA_HT_B, C1_LLU_B, and ICELL8_SE_B) from B-lymphocytes (Sample B, HCC1395BL) were generated separately at four centers (LLU, NCI, FDA, and TBU) on four platforms (10X, Fluidigm C1, Fluidigm C1_HT, and TBU ICELL8); and (d) Scenario 4, where four datasets (10X_LLU_Mix10, 10X_NCI_M_Mix5, 10X_NCI_M_Mix5_F, 10X_NCI_M_Mix5_F2) were generated from 5% or 10% of breast cancer cells (Sample A, HCC1395) spiked into the B-lymphocytes (Sample B, HCC1395BL) and analyzed with the 10X Genomics platform at two centers (LLU and NCI) in four different batches. *For BBKNN, only UMAPs were available and shown in (a-d). The HCC1395 breast cancer cells (Sample A) were labeled in red and the HCC1395BL B lymphocytes (Sample B) were labeled in blue. Batch correction methods included Seurat v3.1, fastMNN (SeuratWrappers v0.1.0), Scanorama V1.4, BBKNN V1.3.5, Harmony V0.99.9, limma V3.40.4, and Combat (sva V3.32.1). The top 2000 HVGs were used as the gene set for batch correction. All the 10X data were preprocessed using CellRanger 3.1.

    Journal: Nature biotechnology

    Article Title: A multi-center study benchmarking single-cell RNA sequencing technologies using reference samples

    doi: 10.1038/s41587-020-00748-9

    Figure Lengend Snippet: Batch-effect corrections were performed for the following four scenarios: (a) Scenario 1, where all 20 scRNA-seq datasets were combined, including mixed and non-mixed, with large proportions of two dissimilar types of cells (Sample A, breast cancer cell line HCC1395 and Sample B, B-lymphocyte line HCC1395BL); Datasets from 10X were down-sampled to 1200 cells per dataset. (b) Scenario 2, where five datasets (10X_LLU_A, 10X_NCI_A, C1_FDA_HT_A, C1_LLU_A, and ICELL8_SE_A) from the breast cancer cells (Sample A, HCC1395) were generated separately at four centers (LLU, NCI, FDA, and TBU) on four platforms (10X, Fluidigm C1, Fluidigm C1_HT, and TBU ICELL8); (c) Scenario 3, where five datasets (10X_LLU_B, 10X_NCI_B, C1_FDA_HT_B, C1_LLU_B, and ICELL8_SE_B) from B-lymphocytes (Sample B, HCC1395BL) were generated separately at four centers (LLU, NCI, FDA, and TBU) on four platforms (10X, Fluidigm C1, Fluidigm C1_HT, and TBU ICELL8); and (d) Scenario 4, where four datasets (10X_LLU_Mix10, 10X_NCI_M_Mix5, 10X_NCI_M_Mix5_F, 10X_NCI_M_Mix5_F2) were generated from 5% or 10% of breast cancer cells (Sample A, HCC1395) spiked into the B-lymphocytes (Sample B, HCC1395BL) and analyzed with the 10X Genomics platform at two centers (LLU and NCI) in four different batches. *For BBKNN, only UMAPs were available and shown in (a-d). The HCC1395 breast cancer cells (Sample A) were labeled in red and the HCC1395BL B lymphocytes (Sample B) were labeled in blue. Batch correction methods included Seurat v3.1, fastMNN (SeuratWrappers v0.1.0), Scanorama V1.4, BBKNN V1.3.5, Harmony V0.99.9, limma V3.40.4, and Combat (sva V3.32.1). The top 2000 HVGs were used as the gene set for batch correction. All the 10X data were preprocessed using CellRanger 3.1.

    Article Snippet: Single-cell full-length cDNA generation and RNA-seq using the C1 Fluidigm system Single cells were loaded on a medium-sized (10–17 μm) RNA-seq integrated fluidic circuit (IFC) at a concentration of 200 cells/μl.

    Techniques: Generated, Labeling

    Boxplot of silhouette values stratified by eight normalization methods across 14 datasets, including (a) 10X_LLU, (b) 10X_NCI, (c) 10X_NCI_M, (d) C1_FDA_HT, (e) C1_LLU, (f) ICELL8_PE, and (g) ICELL8_SE in breast cancer cells (HCC1395; Sample A) and B lymphocytes (HCC1395BL; Sample B). Eight normalization methods included SCTransform, Scran Deconvolution, CPM, LogCPM, TMM, DESeq, Quantile, and Linnorm. For each dataset, reads of each cell were down-sampled to two different read depths (10K and 100K per cell) before calculating the silhouette width values. LogCPM normalization performed fairly well and was used as the default normalization for our subsequent batch-effect correction analyses. Two normalization methods developed for bulk cell RNA-seq (TMM and Quantile) had the lowest scores. The sample sizes (n) used to derive statistics were: 10X_LLU_A, n= 3560 cells, 10X_LLU_B, n=1770 cells; 10X_NCI_A, n=4284 cells, 10X_NCI_B, n=4136 cells; 10X_NCI_M_A, n=1372 cells, 10X_NCI_M_B, n=2082 cells; C1_LLU_A, n=160 cells, C1_LLU_B, n=132 cells; C1_FDA_HT_A, n=318 cells, C1_FDA_HT_B, n=374 cells; ICELL8_SE_A, n=1134 cells, ICELL8_SE_B, n=1078 cells; ICELL8_PE_A, n=980 cells, ICELL8_PE_B, n=954 cells). For detailed statistics regarding minima, maxima, centre, bounds of box and whiskers and percentile related to the figure, please refer to Supplementary Table 6.

    Journal: Nature biotechnology

    Article Title: A multi-center study benchmarking single-cell RNA sequencing technologies using reference samples

    doi: 10.1038/s41587-020-00748-9

    Figure Lengend Snippet: Boxplot of silhouette values stratified by eight normalization methods across 14 datasets, including (a) 10X_LLU, (b) 10X_NCI, (c) 10X_NCI_M, (d) C1_FDA_HT, (e) C1_LLU, (f) ICELL8_PE, and (g) ICELL8_SE in breast cancer cells (HCC1395; Sample A) and B lymphocytes (HCC1395BL; Sample B). Eight normalization methods included SCTransform, Scran Deconvolution, CPM, LogCPM, TMM, DESeq, Quantile, and Linnorm. For each dataset, reads of each cell were down-sampled to two different read depths (10K and 100K per cell) before calculating the silhouette width values. LogCPM normalization performed fairly well and was used as the default normalization for our subsequent batch-effect correction analyses. Two normalization methods developed for bulk cell RNA-seq (TMM and Quantile) had the lowest scores. The sample sizes (n) used to derive statistics were: 10X_LLU_A, n= 3560 cells, 10X_LLU_B, n=1770 cells; 10X_NCI_A, n=4284 cells, 10X_NCI_B, n=4136 cells; 10X_NCI_M_A, n=1372 cells, 10X_NCI_M_B, n=2082 cells; C1_LLU_A, n=160 cells, C1_LLU_B, n=132 cells; C1_FDA_HT_A, n=318 cells, C1_FDA_HT_B, n=374 cells; ICELL8_SE_A, n=1134 cells, ICELL8_SE_B, n=1078 cells; ICELL8_PE_A, n=980 cells, ICELL8_PE_B, n=954 cells). For detailed statistics regarding minima, maxima, centre, bounds of box and whiskers and percentile related to the figure, please refer to Supplementary Table 6.

    Article Snippet: Single-cell full-length cDNA generation and RNA-seq using the C1 Fluidigm system Single cells were loaded on a medium-sized (10–17 μm) RNA-seq integrated fluidic circuit (IFC) at a concentration of 200 cells/μl.

    Techniques: RNA Sequencing

    Batch-effect corrections were performed for the following four scenarios: (a) Scenario 1, where all 20 scRNA-seq datasets were combined, including mixed and non-mixed, with large proportions of two dissimilar types of cells (Sample A, breast cancer cell line HCC1395 and Sample B, B-lymphocyte line HCC1395BL); Datasets from 10X were down-sampled to 1200 cells per dataset. (b) Scenario 2, where five datasets (10X_LLU_A, 10X_NCI_A, C1_FDA_HT_A, C1_LLU_A, and ICELL8_SE_A) from the breast cancer cells (Sample A, HCC1395) were generated separately at four centers (LLU, NCI, FDA, and TBU) on four platforms (10X, Fluidigm C1, Fluidigm C1_HT, and TBU ICELL8); (c) Scenario 3, where five datasets (10X_LLU_B, 10X_NCI_B, C1_FDA_HT_B, C1_LLU_B, and ICELL8_SE_B) from B-lymphocytes (Sample B, HCC1395BL) were generated separately at four centers (LLU, NCI, FDA, and TBU) on four platforms (10X, Fluidigm C1, Fluidigm C1_HT, and TBU ICELL8); and (d) Scenario 4, where four datasets (10X_LLU_Mix10, 10X_NCI_M_Mix5, 10X_NCI_M_Mix5_F, and 10X_NCI_M_Mix5_F2) were generated from 5% or 10% of breast cancer cells (Sample A, HCC1395), spiked into the B-lymphocytes (Sample B, HCC1395BL), and analyzed with the 10X Genomics platform at two centers (LLU and NCI) in four different batches. Batch correction methods included Seurat v3.1, fastMNN (SeuratWrappers v0.1.0), Scanorama V1.4, BBKNN V1.3.5, Harmony V0.99.9, limma V3.40.4, and Combat (sva V3.32.1). The top 2000 highly variable genes (HVGs) of these datasets were used as the gene set for batch correction. All the 10X data were preprocessed using CellRanger 3.1.

    Journal: Nature biotechnology

    Article Title: A multi-center study benchmarking single-cell RNA sequencing technologies using reference samples

    doi: 10.1038/s41587-020-00748-9

    Figure Lengend Snippet: Batch-effect corrections were performed for the following four scenarios: (a) Scenario 1, where all 20 scRNA-seq datasets were combined, including mixed and non-mixed, with large proportions of two dissimilar types of cells (Sample A, breast cancer cell line HCC1395 and Sample B, B-lymphocyte line HCC1395BL); Datasets from 10X were down-sampled to 1200 cells per dataset. (b) Scenario 2, where five datasets (10X_LLU_A, 10X_NCI_A, C1_FDA_HT_A, C1_LLU_A, and ICELL8_SE_A) from the breast cancer cells (Sample A, HCC1395) were generated separately at four centers (LLU, NCI, FDA, and TBU) on four platforms (10X, Fluidigm C1, Fluidigm C1_HT, and TBU ICELL8); (c) Scenario 3, where five datasets (10X_LLU_B, 10X_NCI_B, C1_FDA_HT_B, C1_LLU_B, and ICELL8_SE_B) from B-lymphocytes (Sample B, HCC1395BL) were generated separately at four centers (LLU, NCI, FDA, and TBU) on four platforms (10X, Fluidigm C1, Fluidigm C1_HT, and TBU ICELL8); and (d) Scenario 4, where four datasets (10X_LLU_Mix10, 10X_NCI_M_Mix5, 10X_NCI_M_Mix5_F, and 10X_NCI_M_Mix5_F2) were generated from 5% or 10% of breast cancer cells (Sample A, HCC1395), spiked into the B-lymphocytes (Sample B, HCC1395BL), and analyzed with the 10X Genomics platform at two centers (LLU and NCI) in four different batches. Batch correction methods included Seurat v3.1, fastMNN (SeuratWrappers v0.1.0), Scanorama V1.4, BBKNN V1.3.5, Harmony V0.99.9, limma V3.40.4, and Combat (sva V3.32.1). The top 2000 highly variable genes (HVGs) of these datasets were used as the gene set for batch correction. All the 10X data were preprocessed using CellRanger 3.1.

    Article Snippet: Single-cell full-length cDNA generation and RNA-seq using the C1 Fluidigm system Single cells were loaded on a medium-sized (10–17 μm) RNA-seq integrated fluidic circuit (IFC) at a concentration of 200 cells/μl.

    Techniques: Generated

    Scatter plots displaying the gene expression profile correlations between each of seven scRNA-seq datasets (10X_LLU, 10X_NCI, 10X_NCI_M, C1_FDA, C1_LLU, ICELL8_SE, and ICELL8_PE) vs. their corresponding bulk RNA-seq dataset (BK_RNA-seq) for either (a) breast cancer cells or (b) B lymphocytes. The commonly detected transcripts [(log(CPM +1) normalized] across all datasets were used (15,553 genes for breast cancer cells and 15,201 genes for B lymphocytes) to generate the scatter plots. Each dot represents each gene as a point in each scatterplot; x,y values represent the gene expression variation in a pair of compared datasets. The middle diagonal bar charts display the distribution of the most abundant or rare genes in each dataset and also provide the labels for the respective datasets. The Pearson correlation coefficient R between each of the datasets compared is shown to display the consistency of the different RNA-seq datasets.

    Journal: Nature biotechnology

    Article Title: A multi-center study benchmarking single-cell RNA sequencing technologies using reference samples

    doi: 10.1038/s41587-020-00748-9

    Figure Lengend Snippet: Scatter plots displaying the gene expression profile correlations between each of seven scRNA-seq datasets (10X_LLU, 10X_NCI, 10X_NCI_M, C1_FDA, C1_LLU, ICELL8_SE, and ICELL8_PE) vs. their corresponding bulk RNA-seq dataset (BK_RNA-seq) for either (a) breast cancer cells or (b) B lymphocytes. The commonly detected transcripts [(log(CPM +1) normalized] across all datasets were used (15,553 genes for breast cancer cells and 15,201 genes for B lymphocytes) to generate the scatter plots. Each dot represents each gene as a point in each scatterplot; x,y values represent the gene expression variation in a pair of compared datasets. The middle diagonal bar charts display the distribution of the most abundant or rare genes in each dataset and also provide the labels for the respective datasets. The Pearson correlation coefficient R between each of the datasets compared is shown to display the consistency of the different RNA-seq datasets.

    Article Snippet: Single-cell full-length cDNA generation and RNA-seq using the C1 Fluidigm system Single cells were loaded on a medium-sized (10–17 μm) RNA-seq integrated fluidic circuit (IFC) at a concentration of 200 cells/μl.

    Techniques: Gene Expression, RNA Sequencing