Control:Article Title: An interphase actin wave promotes mitochondrial content mixing and organelle homeostasis
Article Snippet: Dyes used were: Phalloidin Alexa Fluor 647 (ThermoFisher Scientific, A22287), Phalloidin Alexa Fluor 488 (ThermoFisher, A22287), MitoTracker Deep Red FM (ThermoFisher Scientific, M22426), MitoTracker CMXRos(Cell Signaling, 9082 P), TMRE (Molecular Probes, T-669), CellROX Green (ThermoFisher Scientific, C10444), and Cell Mask Deep Red (ThermoFisher Scientific, C10046), JF SNAP-647 ligand (provided by Luke Lavis, Janelia Farms). .. The plasmids used in this study are as follows: Lifeact-EGFP (ref. ), Lifeact-mScarlet-N1 (Addgene, 85054), GFP-FMNL1 (subcloned from ref. ), GFP-FMNL1 S1031A (subcloned), GFP-FMNL1 S1031E (subcloned), mito-sBFP2-C1 (ref. ), GCaMP6s (Addgene, 40753), Lifeact-miRFP (Addgene, 79993), Mito-DsRed2 (gift from T. Schwarz, Harvard Medical School, Boston), Halo-Sec61B (Addgene, 123285), mito-SNAP (subcloned from Mito-DsRed2 in pSNAPf [New England Biolabs]), and Mito-paGFP (Addgene, 23348). siRNAs utilized were: Control (ON-TARGETplus, Horizon, D-001810-01-20), FMNL1 (Santa Cruz, sc-62325), Alternative FMNL1 (Horizon pool: CCUCAAACGGGCUGGUGCAUU, GAGCCUGGCCUGUAACUUAUU, and AAGCUGGAUUUCCGAGGCUUU), FMNL2 (Santa Cruz, sc-62327), FMNL3 (Santa Cruz, sc-62329), ARP3 (Santa Cruz, sc-29739), WHAMM (Horizon, L-022415-01), CDK1 (Dharmacon; GUAUAAGGGUAGACACAAAUU). .. The following drugs were employed in this study: nocodazole (Sigma, M1404), Ro3305 (Sigma, SML0569), CGP74514a (Enzo, 5472), Adovosertib (MedChemExpress, HY-10993), CK-666 (Sigma, SML0006), CCCP (Sigma, C2759), and Seahorse Mito Stress Test drugs (Agilent, 103015-100).
Article Title: Damaged mitochondria recruit the effector NEMO to activate NF-κB signaling
Article Snippet: .. Constructs used were: Mito-DsRed2 (kindly provided by T. Schwarz, Harvard Medical School, Boston) and Mito-SBFP2 (Addgene #187964); untagged Parkin (Addgene #187897); EGFP-NEMO (kindly provided by E. Laplantine, Institut Pasteur, Paris), EGFP-NEMO D304N (Addgene #187898), and Halo-NEMO (Addgene #187899); Halo-OPTN (Addgene #187900); mCherry constructs, vector (Addgene #187983), WT (Addgene #187986), ΔPB1 (Addgene #187985), PB1 AA (Addgene #187982), ΔUBA (Addgene #187984), and LIR AAAA (Addgene #187981) were kindly provided by S. Martens, University of Vienna, Austria, and TIR AAA (Addgene #187901) was generated by site-directed mutagenesis of mCherry-p62 WT ); IKKβ (aka IKK2)-EGFP (Addgene #111195); TFAM-SNAPf (Addgene #187909); and EGFP-Ubiquitin (Addgene #187910). siRNA targeting p62, ON-TARGETplus p62 siRNA (J-010230-05, target sequence GAACAGAUGGUCGGAUA) and scrambled control siRNA were from Horizon Discovery. .. SNAP ligand (SNAP-Cell 647-SiR, S9102S) was from New England BioLabs.
other:Article Title: Actin cables and comet tails organize mitochondrial networks in mitosis
Article Snippet: pLenti-PGK.Lifeact-EGFP:W (Addgene, 51010), F-tractin-EGFP (Addgene, 58473), F-Tractin (ITPKA)-mNeonGreen (Addgene, 98883), mScarlet-I-UtrCH (Addgene, 98823), Lifeact-mScarlet-N1 (Addgene, 85054), Lifeact-mNeonGreen (Addgene, 98877), Rab7a-EGFP, SKL-EGFP, Halo-KDEL, and Halo-Sec61b (Gifts from C. Obara, Ashburn, VA), Emerald-Sec61b (Addgene, 90992), pKillerRed-dMito (Evrogen, PF964), mito-paGFP (Addgene, 23348), mito-Dendra2 (Addgene, 55796), mito-DsRed2 (gift from T. Schwarz, Boston, MA), mito-mTagBFP2 (Addgene, 105011), pLV-mitoGFP (Addgene, 44385), Emerald-FilaminA-N-9 (Addgene, 54098), Emerald-Cortactin-C-12 (Addgene, 54051), Emerald-VASP-5 (Addgene, 54296), AlphaActinin-mNeonGreen (Allele biotech).
Article Title: Actin cables and comet tails organize mitochondrial networks in mitosis.
Article Snippet: Plasmids used were: pLenti-PGK.Lifeact-eGFP:W (Addgene, 51010), F-tractin-eGFP (Addgene, 58473), F-Tractin (ITPKA)-mNeonGreen (Addgene, 98883), mScarlet-I-UtrCH (Addgene, 98823), Lifeact-mScarlet-N1 (Addgene, 85054), Lifeact-mNeonGreen (Addgene, 98877), Rab7a-eGFP, SKL-eGFP, Halo-KDEL and Halo-Sec61b (gifts from C. Obara, Janelia Research Campus), Emerald-Sec61b (Addgene, 90992), pKillerRed-dMito (Evrogen, PF964), mito-paGFP (Addgene, 23348), mito-Dendra2 (Addgene, 55796), mito-dsRed2 (gift from T. Schwarz, Harvard Medical School), mito-mTagBFP2 (Addgene, 105011), pLV-mitoGFP (Addgene, 44385), Emerald-FilaminA-N-9 (Addgene, 54098), Emerald-Cortactin-C-12 (Addgene, 54051), Emerald-VASP-5 (Addgene, 54296) and AlphaActinin-mNeonGreen (Allele biotech).
Cloning:Article Title: Evidence That Dendritic Mitochondria Negatively Regulate Dendritic Branching in Pyramidal Neurons in the Neocortex
Article Snippet: .. The coding sequences for the following proteins were inserted into the multiple cloning site (subcloned by K. Nishida) of the pCAGGS plasmid vector ( Niwa et al., 1991 ): EGFP, EBFP2 ( Ai et al., 2007 ), tandem dimer Tomato (tdTomato), mitochondria-targeted monomeric Cherry (mito-mCherry; tdTomato and mCherry; Shaner et al., 2004 ), mito-DsRed2, GalT-EGFP (Addgene plasmid 11929; Cole et al., 1996 ), mRFP-Rab5 (Addgene plasmid 14437; Vonderheit and Helenius, 2005 ), endoplasmic reticulum (ER)-targeted DsRed1 (ER-DsRed1), Mitochondrial Rho GTPase 1 (Miro1)-binding domain of trafficking kinesin protein 2 (TRAK2; TRAK2-MBD; MacAskill et al., 2009 ), mitofusin 1 (Mfn1), and ER T2 CreER T2 (Addgene plasmid 13777; Matsuda and Cepko, 2007 ). ..
Article Title: Evidence That Dendritic Mitochondria Negatively Regulate Dendritic Branching in Pyramidal Neurons in the Neocortex
Article Snippet: .. The coding sequences for the following proteins were inserted into the multiple cloning site (subcloned by K. Nishida) of the pCAGGS plasmid vector (Niwa et al., 1991): EGFP, EBFP2 (Ai et al., 2007), tandem dimer Tomato (tdTomato), mitochondria-targeted monomeric Cherry (mito-mCherry; tdTomato and mCherry; Shaner et al., 2004), mito-DsRed2, GalT-EGFP (Addgene plasmid 11929; Cole et al., 1996), mRFP-Rab5 (Addgene plasmid 14437; Vonderheit and Helenius, 2005), endoplasmic reticulum (ER)-targeted DsRed1 (ER-DsRed1), Mitochondrial Rho GTPase 1 (Miro1)-binding domain of trafficking kinesin protein 2 (TRAK2; TRAK2-MBD; MacAskill et al., 2009), mitofusin 1 (Mfn1), and ER T2CreER T2 (Addgene plasmid 13777; Matsuda and Cepko, 2007). ..
Plasmid Preparation:Article Title: Evidence That Dendritic Mitochondria Negatively Regulate Dendritic Branching in Pyramidal Neurons in the Neocortex
Article Snippet: .. The coding sequences for the following proteins were inserted into the multiple cloning site (subcloned by K. Nishida) of the pCAGGS plasmid vector ( Niwa et al., 1991 ): EGFP, EBFP2 ( Ai et al., 2007 ), tandem dimer Tomato (tdTomato), mitochondria-targeted monomeric Cherry (mito-mCherry; tdTomato and mCherry; Shaner et al., 2004 ), mito-DsRed2, GalT-EGFP (Addgene plasmid 11929; Cole et al., 1996 ), mRFP-Rab5 (Addgene plasmid 14437; Vonderheit and Helenius, 2005 ), endoplasmic reticulum (ER)-targeted DsRed1 (ER-DsRed1), Mitochondrial Rho GTPase 1 (Miro1)-binding domain of trafficking kinesin protein 2 (TRAK2; TRAK2-MBD; MacAskill et al., 2009 ), mitofusin 1 (Mfn1), and ER T2 CreER T2 (Addgene plasmid 13777; Matsuda and Cepko, 2007 ). ..
Article Title: Evidence That Dendritic Mitochondria Negatively Regulate Dendritic Branching in Pyramidal Neurons in the Neocortex
Article Snippet: .. The coding sequences for the following proteins were inserted into the multiple cloning site (subcloned by K. Nishida) of the pCAGGS plasmid vector (Niwa et al., 1991): EGFP, EBFP2 (Ai et al., 2007), tandem dimer Tomato (tdTomato), mitochondria-targeted monomeric Cherry (mito-mCherry; tdTomato and mCherry; Shaner et al., 2004), mito-DsRed2, GalT-EGFP (Addgene plasmid 11929; Cole et al., 1996), mRFP-Rab5 (Addgene plasmid 14437; Vonderheit and Helenius, 2005), endoplasmic reticulum (ER)-targeted DsRed1 (ER-DsRed1), Mitochondrial Rho GTPase 1 (Miro1)-binding domain of trafficking kinesin protein 2 (TRAK2; TRAK2-MBD; MacAskill et al., 2009), mitofusin 1 (Mfn1), and ER T2CreER T2 (Addgene plasmid 13777; Matsuda and Cepko, 2007). ..
Construct:Article Title: Damaged mitochondria recruit the effector NEMO to activate NF-κB signaling
Article Snippet: .. Constructs used were: Mito-DsRed2 (kindly provided by T. Schwarz, Harvard Medical School, Boston) and Mito-SBFP2 (Addgene #187964); untagged Parkin (Addgene #187897); EGFP-NEMO (kindly provided by E. Laplantine, Institut Pasteur, Paris), EGFP-NEMO D304N (Addgene #187898), and Halo-NEMO (Addgene #187899); Halo-OPTN (Addgene #187900); mCherry constructs, vector (Addgene #187983), WT (Addgene #187986), ΔPB1 (Addgene #187985), PB1 AA (Addgene #187982), ΔUBA (Addgene #187984), and LIR AAAA (Addgene #187981) were kindly provided by S. Martens, University of Vienna, Austria, and TIR AAA (Addgene #187901) was generated by site-directed mutagenesis of mCherry-p62 WT ); IKKβ (aka IKK2)-EGFP (Addgene #111195); TFAM-SNAPf (Addgene #187909); and EGFP-Ubiquitin (Addgene #187910). siRNA targeting p62, ON-TARGETplus p62 siRNA (J-010230-05, target sequence GAACAGAUGGUCGGAUA) and scrambled control siRNA were from Horizon Discovery. .. SNAP ligand (SNAP-Cell 647-SiR, S9102S) was from New England BioLabs.
Article Title: Dynamic actin cycling through mitochondrial subpopulations locally regulates the fission–fusion balance within mitochondrial networks
Article Snippet: .. Constructs used include: EGFP-actin (Clontech), LifeAct-EGFP, F-tractin-EGFP (Addgene), mCherry-LifeAct (Dominguez Lab, University of Pennsylvania), Mito-DsRed2 (gift from T. Schwarz, Harvard Medical School, Boston, MA) recloned into pSBFP2-C1 (Addgene) and SNAP-Tag (NEB), pKillerRed-dMito (Evrogen), Drp1 (Addgene) recloned into pEGFP (Clontech), Drp1-K38A (Addgene), DsRed2-ER (gift from A. Akhmanova, Utrecht University, Utrecht, The Netherlands). .. HeLa-M cells (A. Peden, Cambridge Institute for Medical Research, Cambridge, UK) and COS-7 cells (ATCC) were cultured in DMEM medium (10-027-CV, Corning) supplemented with 10% fetal bovine serum (vol/vol) and 1% glutamax, and maintained at 37 °C in a 5% CO 2 incubator.
Generated:Article Title: Damaged mitochondria recruit the effector NEMO to activate NF-κB signaling
Article Snippet: .. Constructs used were: Mito-DsRed2 (kindly provided by T. Schwarz, Harvard Medical School, Boston) and Mito-SBFP2 (Addgene #187964); untagged Parkin (Addgene #187897); EGFP-NEMO (kindly provided by E. Laplantine, Institut Pasteur, Paris), EGFP-NEMO D304N (Addgene #187898), and Halo-NEMO (Addgene #187899); Halo-OPTN (Addgene #187900); mCherry constructs, vector (Addgene #187983), WT (Addgene #187986), ΔPB1 (Addgene #187985), PB1 AA (Addgene #187982), ΔUBA (Addgene #187984), and LIR AAAA (Addgene #187981) were kindly provided by S. Martens, University of Vienna, Austria, and TIR AAA (Addgene #187901) was generated by site-directed mutagenesis of mCherry-p62 WT ); IKKβ (aka IKK2)-EGFP (Addgene #111195); TFAM-SNAPf (Addgene #187909); and EGFP-Ubiquitin (Addgene #187910). siRNA targeting p62, ON-TARGETplus p62 siRNA (J-010230-05, target sequence GAACAGAUGGUCGGAUA) and scrambled control siRNA were from Horizon Discovery. .. SNAP ligand (SNAP-Cell 647-SiR, S9102S) was from New England BioLabs.
Mutagenesis:Article Title: Damaged mitochondria recruit the effector NEMO to activate NF-κB signaling
Article Snippet: .. Constructs used were: Mito-DsRed2 (kindly provided by T. Schwarz, Harvard Medical School, Boston) and Mito-SBFP2 (Addgene #187964); untagged Parkin (Addgene #187897); EGFP-NEMO (kindly provided by E. Laplantine, Institut Pasteur, Paris), EGFP-NEMO D304N (Addgene #187898), and Halo-NEMO (Addgene #187899); Halo-OPTN (Addgene #187900); mCherry constructs, vector (Addgene #187983), WT (Addgene #187986), ΔPB1 (Addgene #187985), PB1 AA (Addgene #187982), ΔUBA (Addgene #187984), and LIR AAAA (Addgene #187981) were kindly provided by S. Martens, University of Vienna, Austria, and TIR AAA (Addgene #187901) was generated by site-directed mutagenesis of mCherry-p62 WT ); IKKβ (aka IKK2)-EGFP (Addgene #111195); TFAM-SNAPf (Addgene #187909); and EGFP-Ubiquitin (Addgene #187910). siRNA targeting p62, ON-TARGETplus p62 siRNA (J-010230-05, target sequence GAACAGAUGGUCGGAUA) and scrambled control siRNA were from Horizon Discovery. .. SNAP ligand (SNAP-Cell 647-SiR, S9102S) was from New England BioLabs.
Sequencing:Article Title: Damaged mitochondria recruit the effector NEMO to activate NF-κB signaling
Article Snippet: .. Constructs used were: Mito-DsRed2 (kindly provided by T. Schwarz, Harvard Medical School, Boston) and Mito-SBFP2 (Addgene #187964); untagged Parkin (Addgene #187897); EGFP-NEMO (kindly provided by E. Laplantine, Institut Pasteur, Paris), EGFP-NEMO D304N (Addgene #187898), and Halo-NEMO (Addgene #187899); Halo-OPTN (Addgene #187900); mCherry constructs, vector (Addgene #187983), WT (Addgene #187986), ΔPB1 (Addgene #187985), PB1 AA (Addgene #187982), ΔUBA (Addgene #187984), and LIR AAAA (Addgene #187981) were kindly provided by S. Martens, University of Vienna, Austria, and TIR AAA (Addgene #187901) was generated by site-directed mutagenesis of mCherry-p62 WT ); IKKβ (aka IKK2)-EGFP (Addgene #111195); TFAM-SNAPf (Addgene #187909); and EGFP-Ubiquitin (Addgene #187910). siRNA targeting p62, ON-TARGETplus p62 siRNA (J-010230-05, target sequence GAACAGAUGGUCGGAUA) and scrambled control siRNA were from Horizon Discovery. .. SNAP ligand (SNAP-Cell 647-SiR, S9102S) was from New England BioLabs.
|
Addgene inc is a verified supplier 