Review



paavcag pre mgrasp mcerulean 2a nlsmcherry plasmid  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc paavcag pre mgrasp mcerulean 2a nlsmcherry plasmid
    Paavcag Pre Mgrasp Mcerulean 2a Nlsmcherry Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+nls/paavCAG-pre-mGRASP-mCerulean-2A-nls-mCherry+(Plasmid+%2334911)/pm42750047-53-11-15
    Average 93 stars, based on 6 article reviews
    paavcag pre mgrasp mcerulean 2a nlsmcherry plasmid - by Bioz Stars, 2026-10
    93/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Cohesin regulation of genome organization in mature granule neurons in the mouse cerebellum.
    Article Snippet: Antibodies to RAD21 (Abcam, ab992), CTCF (Millipore, 07-729), NeuN (Abcam, ab177487), and mCherry (Abcam, ab205402) for immunohistochemistry or FANS experiments were purchased. .. sgRNA was cloned into the MLM3636 vector (Addgene #43860) using primers containing the target sequence: Rad21: A T G C T T C A T T A C A G T C T G C G (chr15: 51978075-51978094) and control: C G A G A G C A G G T C T G A A A C C C (chr12: 8304558083045599) and G G A G G G T A G A T T A G A T T A G C (chr12: 8304548583045504). mCherry-NLS (addgene #58476) was subcloned into the pCAG vector to generate pCAG-mCherry-NLS. ..

    Article Title: DNA damage induces nuclear envelope rupture through ATR-mediated phosphorylation of lamin A/C
    Article Snippet: To obtain pOZ-VHH(actin)-GFP-NLS, first, VHH(actin)-GFP-NLS was PCR amplified from the Nuclear actin chromobody plasmid (Chromotek, acg-n), using the following primers: pOZ NACB XhoI F and pOZ NACB NotI R. Then this PCR product was cloned into a pOZ vector using BglII and NotI cut sites. .. To obtain pOZ-VHH(actin)-mCherry-NLS, first, VHH(actin) was PCR amplified from the Nuclear actin chromobody plasmid (Chromotek, acg-n) using the following primers: pOZ-actin-VHH-BglII-F and Linker-mCherry-R. Next, it was fused to mCherry-NLS, generated from pLNCX2-mCherry-CHMP4B (Addgene, #116923), using the following primers: Linker mCherry F and mCherry NLS NotI R. Finally, the fusion product, VHH(actin)-mCherry-NLS was cloned into a pOZ vector using BglII and NotI cut sites. siRNA resistant mCherry-Lamin A/C constructs were obtained in the following way. .. To obtain mCherry-Lamin A/C-WT, the custom gene block LMNA-sires-mut (IDT) was cloned into mCherry-LaminA-C-18 (Addgene #55068) using BglII and ApaI cut sites.

    Article Title: Cohesin regulation of genome organization in mature granule neurons in the mouse cerebellum
    Article Snippet: Antibodies to RAD21 (Abcam, ab992), CTCF (Millipore, 07-729), NeuN (Abcam, ab177487), and mCherry (Abcam, ab205402) for immunohistochemistry or FANS experiments were purchased. .. sgRNA was cloned into the MLM3636 vector (Addgene #43860) using primers containing the target sequence: Rad21 : ATGCTTCATTACAGTCTGCG (chr15: 51978075-51978094) and control: CGAGAGCAGGTCTGAAACCC (chr12: 8304558083045599) and GGAGGGTAGATTAGATTAGC (chr12: 8304548583045504). mCherry-NLS (addgene #58476) was subcloned into the pCAG vector to generate pCAG-mCherry-NLS. ..

    Article Title: Protein UFMylation regulates early events during ribosomal DNA-damage response.
    Article Snippet: TCOF1-V5-eGFP was then cloned into pSH-EF-IRES-AtAFB2-mCherry (a gift from Elina Ikonen, Addgene plasmid #129716) using In-Fusion cloning. eGFP-NLS was cloned in a similar manner. sgRNAs were cloned into LentiGuide-Puro (a gift from Feng Zhang, Addgene #52963) or a modified form of LentiGuide-Puro in which Cas9 was replaced by GFP-NLS or mCherry-NLS as previously described.104 His10-UFM1DSC was subcloned from pRK5-HA-UFM1 (a gift from Yihong Ye, Addgene #134639) using PCR and inserted into a modified LentiGuide-Puro GFP by replacing the puromycin selection marker with His10-UFM1DSC using In-Fusion cloning. .. TCOF1-V5-eGFP was then cloned into pSH-EF-IRES-AtAFB2-mCherry (a gift from Elina Ikonen, Addgene plasmid #129716) using In-Fusion cloning. eGFP-NLS was cloned in a similar manner. sgRNAs were cloned into LentiGuide-Puro (a gift from Feng Zhang, Addgene #52963) or a modified form of LentiGuide-Puro in which Cas9 was replaced by GFP-NLS or mCherry-NLS as previously described.104 His10-UFM1DSC was subcloned from pRK5-HA-UFM1 (a gift from Yihong Ye, Addgene #134639) using PCR and inserted into a modified LentiGuide-Puro GFP by replacing the puromycin selection marker with His10-UFM1DSC using In-Fusion cloning. .. All sgRNAs cloned into Lenti-Guide-Puro or Lenti-Guide-GFP vectors were cloned using Zhang lab protocol.109 Lentiviral particles were generated as previously described using second generation lentiviral vectors psPAX2 and pMD2.G (a gift from Didier Trono, Addgene #12260 and #12259).

    Sequencing:

    Article Title: Cohesin regulation of genome organization in mature granule neurons in the mouse cerebellum.
    Article Snippet: Antibodies to RAD21 (Abcam, ab992), CTCF (Millipore, 07-729), NeuN (Abcam, ab177487), and mCherry (Abcam, ab205402) for immunohistochemistry or FANS experiments were purchased. .. sgRNA was cloned into the MLM3636 vector (Addgene #43860) using primers containing the target sequence: Rad21: A T G C T T C A T T A C A G T C T G C G (chr15: 51978075-51978094) and control: C G A G A G C A G G T C T G A A A C C C (chr12: 8304558083045599) and G G A G G G T A G A T T A G A T T A G C (chr12: 8304548583045504). mCherry-NLS (addgene #58476) was subcloned into the pCAG vector to generate pCAG-mCherry-NLS. ..

    Article Title: Cohesin regulation of genome organization in mature granule neurons in the mouse cerebellum
    Article Snippet: Antibodies to RAD21 (Abcam, ab992), CTCF (Millipore, 07-729), NeuN (Abcam, ab177487), and mCherry (Abcam, ab205402) for immunohistochemistry or FANS experiments were purchased. .. sgRNA was cloned into the MLM3636 vector (Addgene #43860) using primers containing the target sequence: Rad21 : ATGCTTCATTACAGTCTGCG (chr15: 51978075-51978094) and control: CGAGAGCAGGTCTGAAACCC (chr12: 8304558083045599) and GGAGGGTAGATTAGATTAGC (chr12: 8304548583045504). mCherry-NLS (addgene #58476) was subcloned into the pCAG vector to generate pCAG-mCherry-NLS. ..

    Control:

    Article Title: Cohesin regulation of genome organization in mature granule neurons in the mouse cerebellum.
    Article Snippet: Antibodies to RAD21 (Abcam, ab992), CTCF (Millipore, 07-729), NeuN (Abcam, ab177487), and mCherry (Abcam, ab205402) for immunohistochemistry or FANS experiments were purchased. .. sgRNA was cloned into the MLM3636 vector (Addgene #43860) using primers containing the target sequence: Rad21: A T G C T T C A T T A C A G T C T G C G (chr15: 51978075-51978094) and control: C G A G A G C A G G T C T G A A A C C C (chr12: 8304558083045599) and G G A G G G T A G A T T A G A T T A G C (chr12: 8304548583045504). mCherry-NLS (addgene #58476) was subcloned into the pCAG vector to generate pCAG-mCherry-NLS. ..

    Article Title: Cohesin regulation of genome organization in mature granule neurons in the mouse cerebellum
    Article Snippet: Antibodies to RAD21 (Abcam, ab992), CTCF (Millipore, 07-729), NeuN (Abcam, ab177487), and mCherry (Abcam, ab205402) for immunohistochemistry or FANS experiments were purchased. .. sgRNA was cloned into the MLM3636 vector (Addgene #43860) using primers containing the target sequence: Rad21 : ATGCTTCATTACAGTCTGCG (chr15: 51978075-51978094) and control: CGAGAGCAGGTCTGAAACCC (chr12: 8304558083045599) and GGAGGGTAGATTAGATTAGC (chr12: 8304548583045504). mCherry-NLS (addgene #58476) was subcloned into the pCAG vector to generate pCAG-mCherry-NLS. ..

    Plasmid Preparation:

    Article Title: Cohesin regulation of genome organization in mature granule neurons in the mouse cerebellum.
    Article Snippet: Antibodies to RAD21 (Abcam, ab992), CTCF (Millipore, 07-729), NeuN (Abcam, ab177487), and mCherry (Abcam, ab205402) for immunohistochemistry or FANS experiments were purchased. .. sgRNA was cloned into the MLM3636 vector (Addgene #43860) using primers containing the target sequence: Rad21: A T G C T T C A T T A C A G T C T G C G (chr15: 51978075-51978094) and control: C G A G A G C A G G T C T G A A A C C C (chr12: 8304558083045599) and G G A G G G T A G A T T A G A T T A G C (chr12: 8304548583045504). mCherry-NLS (addgene #58476) was subcloned into the pCAG vector to generate pCAG-mCherry-NLS. ..

    Article Title: DNA damage induces nuclear envelope rupture through ATR-mediated phosphorylation of lamin A/C
    Article Snippet: To obtain pOZ-VHH(actin)-GFP-NLS, first, VHH(actin)-GFP-NLS was PCR amplified from the Nuclear actin chromobody plasmid (Chromotek, acg-n), using the following primers: pOZ NACB XhoI F and pOZ NACB NotI R. Then this PCR product was cloned into a pOZ vector using BglII and NotI cut sites. .. To obtain pOZ-VHH(actin)-mCherry-NLS, first, VHH(actin) was PCR amplified from the Nuclear actin chromobody plasmid (Chromotek, acg-n) using the following primers: pOZ-actin-VHH-BglII-F and Linker-mCherry-R. Next, it was fused to mCherry-NLS, generated from pLNCX2-mCherry-CHMP4B (Addgene, #116923), using the following primers: Linker mCherry F and mCherry NLS NotI R. Finally, the fusion product, VHH(actin)-mCherry-NLS was cloned into a pOZ vector using BglII and NotI cut sites. siRNA resistant mCherry-Lamin A/C constructs were obtained in the following way. .. To obtain mCherry-Lamin A/C-WT, the custom gene block LMNA-sires-mut (IDT) was cloned into mCherry-LaminA-C-18 (Addgene #55068) using BglII and ApaI cut sites.

    Article Title: Cohesin regulation of genome organization in mature granule neurons in the mouse cerebellum
    Article Snippet: Antibodies to RAD21 (Abcam, ab992), CTCF (Millipore, 07-729), NeuN (Abcam, ab177487), and mCherry (Abcam, ab205402) for immunohistochemistry or FANS experiments were purchased. .. sgRNA was cloned into the MLM3636 vector (Addgene #43860) using primers containing the target sequence: Rad21 : ATGCTTCATTACAGTCTGCG (chr15: 51978075-51978094) and control: CGAGAGCAGGTCTGAAACCC (chr12: 8304558083045599) and GGAGGGTAGATTAGATTAGC (chr12: 8304548583045504). mCherry-NLS (addgene #58476) was subcloned into the pCAG vector to generate pCAG-mCherry-NLS. ..

    Article Title: Protein UFMylation regulates early events during ribosomal DNA-damage response.
    Article Snippet: TCOF1-V5-eGFP was then cloned into pSH-EF-IRES-AtAFB2-mCherry (a gift from Elina Ikonen, Addgene plasmid #129716) using In-Fusion cloning. eGFP-NLS was cloned in a similar manner. sgRNAs were cloned into LentiGuide-Puro (a gift from Feng Zhang, Addgene #52963) or a modified form of LentiGuide-Puro in which Cas9 was replaced by GFP-NLS or mCherry-NLS as previously described.104 His10-UFM1DSC was subcloned from pRK5-HA-UFM1 (a gift from Yihong Ye, Addgene #134639) using PCR and inserted into a modified LentiGuide-Puro GFP by replacing the puromycin selection marker with His10-UFM1DSC using In-Fusion cloning. .. TCOF1-V5-eGFP was then cloned into pSH-EF-IRES-AtAFB2-mCherry (a gift from Elina Ikonen, Addgene plasmid #129716) using In-Fusion cloning. eGFP-NLS was cloned in a similar manner. sgRNAs were cloned into LentiGuide-Puro (a gift from Feng Zhang, Addgene #52963) or a modified form of LentiGuide-Puro in which Cas9 was replaced by GFP-NLS or mCherry-NLS as previously described.104 His10-UFM1DSC was subcloned from pRK5-HA-UFM1 (a gift from Yihong Ye, Addgene #134639) using PCR and inserted into a modified LentiGuide-Puro GFP by replacing the puromycin selection marker with His10-UFM1DSC using In-Fusion cloning. .. All sgRNAs cloned into Lenti-Guide-Puro or Lenti-Guide-GFP vectors were cloned using Zhang lab protocol.109 Lentiviral particles were generated as previously described using second generation lentiviral vectors psPAX2 and pMD2.G (a gift from Didier Trono, Addgene #12260 and #12259).

    Polymerase Chain Reaction:

    Article Title: DNA damage induces nuclear envelope rupture through ATR-mediated phosphorylation of lamin A/C
    Article Snippet: To obtain pOZ-VHH(actin)-GFP-NLS, first, VHH(actin)-GFP-NLS was PCR amplified from the Nuclear actin chromobody plasmid (Chromotek, acg-n), using the following primers: pOZ NACB XhoI F and pOZ NACB NotI R. Then this PCR product was cloned into a pOZ vector using BglII and NotI cut sites. .. To obtain pOZ-VHH(actin)-mCherry-NLS, first, VHH(actin) was PCR amplified from the Nuclear actin chromobody plasmid (Chromotek, acg-n) using the following primers: pOZ-actin-VHH-BglII-F and Linker-mCherry-R. Next, it was fused to mCherry-NLS, generated from pLNCX2-mCherry-CHMP4B (Addgene, #116923), using the following primers: Linker mCherry F and mCherry NLS NotI R. Finally, the fusion product, VHH(actin)-mCherry-NLS was cloned into a pOZ vector using BglII and NotI cut sites. siRNA resistant mCherry-Lamin A/C constructs were obtained in the following way. .. To obtain mCherry-Lamin A/C-WT, the custom gene block LMNA-sires-mut (IDT) was cloned into mCherry-LaminA-C-18 (Addgene #55068) using BglII and ApaI cut sites.

    Article Title: Protein UFMylation regulates early events during ribosomal DNA-damage response.
    Article Snippet: TCOF1-V5-eGFP was then cloned into pSH-EF-IRES-AtAFB2-mCherry (a gift from Elina Ikonen, Addgene plasmid #129716) using In-Fusion cloning. eGFP-NLS was cloned in a similar manner. sgRNAs were cloned into LentiGuide-Puro (a gift from Feng Zhang, Addgene #52963) or a modified form of LentiGuide-Puro in which Cas9 was replaced by GFP-NLS or mCherry-NLS as previously described.104 His10-UFM1DSC was subcloned from pRK5-HA-UFM1 (a gift from Yihong Ye, Addgene #134639) using PCR and inserted into a modified LentiGuide-Puro GFP by replacing the puromycin selection marker with His10-UFM1DSC using In-Fusion cloning. .. TCOF1-V5-eGFP was then cloned into pSH-EF-IRES-AtAFB2-mCherry (a gift from Elina Ikonen, Addgene plasmid #129716) using In-Fusion cloning. eGFP-NLS was cloned in a similar manner. sgRNAs were cloned into LentiGuide-Puro (a gift from Feng Zhang, Addgene #52963) or a modified form of LentiGuide-Puro in which Cas9 was replaced by GFP-NLS or mCherry-NLS as previously described.104 His10-UFM1DSC was subcloned from pRK5-HA-UFM1 (a gift from Yihong Ye, Addgene #134639) using PCR and inserted into a modified LentiGuide-Puro GFP by replacing the puromycin selection marker with His10-UFM1DSC using In-Fusion cloning. .. All sgRNAs cloned into Lenti-Guide-Puro or Lenti-Guide-GFP vectors were cloned using Zhang lab protocol.109 Lentiviral particles were generated as previously described using second generation lentiviral vectors psPAX2 and pMD2.G (a gift from Didier Trono, Addgene #12260 and #12259).

    Amplification:

    Article Title: DNA damage induces nuclear envelope rupture through ATR-mediated phosphorylation of lamin A/C
    Article Snippet: To obtain pOZ-VHH(actin)-GFP-NLS, first, VHH(actin)-GFP-NLS was PCR amplified from the Nuclear actin chromobody plasmid (Chromotek, acg-n), using the following primers: pOZ NACB XhoI F and pOZ NACB NotI R. Then this PCR product was cloned into a pOZ vector using BglII and NotI cut sites. .. To obtain pOZ-VHH(actin)-mCherry-NLS, first, VHH(actin) was PCR amplified from the Nuclear actin chromobody plasmid (Chromotek, acg-n) using the following primers: pOZ-actin-VHH-BglII-F and Linker-mCherry-R. Next, it was fused to mCherry-NLS, generated from pLNCX2-mCherry-CHMP4B (Addgene, #116923), using the following primers: Linker mCherry F and mCherry NLS NotI R. Finally, the fusion product, VHH(actin)-mCherry-NLS was cloned into a pOZ vector using BglII and NotI cut sites. siRNA resistant mCherry-Lamin A/C constructs were obtained in the following way. .. To obtain mCherry-Lamin A/C-WT, the custom gene block LMNA-sires-mut (IDT) was cloned into mCherry-LaminA-C-18 (Addgene #55068) using BglII and ApaI cut sites.

    Generated:

    Article Title: DNA damage induces nuclear envelope rupture through ATR-mediated phosphorylation of lamin A/C
    Article Snippet: To obtain pOZ-VHH(actin)-GFP-NLS, first, VHH(actin)-GFP-NLS was PCR amplified from the Nuclear actin chromobody plasmid (Chromotek, acg-n), using the following primers: pOZ NACB XhoI F and pOZ NACB NotI R. Then this PCR product was cloned into a pOZ vector using BglII and NotI cut sites. .. To obtain pOZ-VHH(actin)-mCherry-NLS, first, VHH(actin) was PCR amplified from the Nuclear actin chromobody plasmid (Chromotek, acg-n) using the following primers: pOZ-actin-VHH-BglII-F and Linker-mCherry-R. Next, it was fused to mCherry-NLS, generated from pLNCX2-mCherry-CHMP4B (Addgene, #116923), using the following primers: Linker mCherry F and mCherry NLS NotI R. Finally, the fusion product, VHH(actin)-mCherry-NLS was cloned into a pOZ vector using BglII and NotI cut sites. siRNA resistant mCherry-Lamin A/C constructs were obtained in the following way. .. To obtain mCherry-Lamin A/C-WT, the custom gene block LMNA-sires-mut (IDT) was cloned into mCherry-LaminA-C-18 (Addgene #55068) using BglII and ApaI cut sites.

    Construct:

    Article Title: DNA damage induces nuclear envelope rupture through ATR-mediated phosphorylation of lamin A/C
    Article Snippet: To obtain pOZ-VHH(actin)-GFP-NLS, first, VHH(actin)-GFP-NLS was PCR amplified from the Nuclear actin chromobody plasmid (Chromotek, acg-n), using the following primers: pOZ NACB XhoI F and pOZ NACB NotI R. Then this PCR product was cloned into a pOZ vector using BglII and NotI cut sites. .. To obtain pOZ-VHH(actin)-mCherry-NLS, first, VHH(actin) was PCR amplified from the Nuclear actin chromobody plasmid (Chromotek, acg-n) using the following primers: pOZ-actin-VHH-BglII-F and Linker-mCherry-R. Next, it was fused to mCherry-NLS, generated from pLNCX2-mCherry-CHMP4B (Addgene, #116923), using the following primers: Linker mCherry F and mCherry NLS NotI R. Finally, the fusion product, VHH(actin)-mCherry-NLS was cloned into a pOZ vector using BglII and NotI cut sites. siRNA resistant mCherry-Lamin A/C constructs were obtained in the following way. .. To obtain mCherry-Lamin A/C-WT, the custom gene block LMNA-sires-mut (IDT) was cloned into mCherry-LaminA-C-18 (Addgene #55068) using BglII and ApaI cut sites.

    other:

    Article Title: DNA damage induces nuclear envelope rupture through ATR-mediated phosphorylation of lamin A/C
    Article Snippet: cGAS-GFP expressing were obtained by lentiviral transduction, using pTRIP-CMV-GFP-FLAG-cGAS E225A-D227A (Addgene #86674) followed by cell sorting.

    Article Title: DNA damage induces nuclear envelope rupture through ATR-mediated phosphorylation of lamin A/C.
    Article Snippet: proteomexchange.org) via the PRIDE partner repository55 with the dataset identifiers PXD040857 and PXD043990.

    Article Title: DNA damage induces nuclear envelope rupture through ATR-mediated phosphorylation of lamin A/C.
    Article Snippet: All media were supplemented with 10% fetal bovine serum (Sigma-Aldrich) (20% fo CAPAN-1), except for MCF10A cells, and 1% penicillin-streptomycin (Sigma-Aldrich).

    Cloning:

    Article Title: Protein UFMylation regulates early events during ribosomal DNA-damage response.
    Article Snippet: TCOF1-V5-eGFP was then cloned into pSH-EF-IRES-AtAFB2-mCherry (a gift from Elina Ikonen, Addgene plasmid #129716) using In-Fusion cloning. eGFP-NLS was cloned in a similar manner. sgRNAs were cloned into LentiGuide-Puro (a gift from Feng Zhang, Addgene #52963) or a modified form of LentiGuide-Puro in which Cas9 was replaced by GFP-NLS or mCherry-NLS as previously described.104 His10-UFM1DSC was subcloned from pRK5-HA-UFM1 (a gift from Yihong Ye, Addgene #134639) using PCR and inserted into a modified LentiGuide-Puro GFP by replacing the puromycin selection marker with His10-UFM1DSC using In-Fusion cloning. .. TCOF1-V5-eGFP was then cloned into pSH-EF-IRES-AtAFB2-mCherry (a gift from Elina Ikonen, Addgene plasmid #129716) using In-Fusion cloning. eGFP-NLS was cloned in a similar manner. sgRNAs were cloned into LentiGuide-Puro (a gift from Feng Zhang, Addgene #52963) or a modified form of LentiGuide-Puro in which Cas9 was replaced by GFP-NLS or mCherry-NLS as previously described.104 His10-UFM1DSC was subcloned from pRK5-HA-UFM1 (a gift from Yihong Ye, Addgene #134639) using PCR and inserted into a modified LentiGuide-Puro GFP by replacing the puromycin selection marker with His10-UFM1DSC using In-Fusion cloning. .. All sgRNAs cloned into Lenti-Guide-Puro or Lenti-Guide-GFP vectors were cloned using Zhang lab protocol.109 Lentiviral particles were generated as previously described using second generation lentiviral vectors psPAX2 and pMD2.G (a gift from Didier Trono, Addgene #12260 and #12259).

    Modification:

    Article Title: Protein UFMylation regulates early events during ribosomal DNA-damage response.
    Article Snippet: TCOF1-V5-eGFP was then cloned into pSH-EF-IRES-AtAFB2-mCherry (a gift from Elina Ikonen, Addgene plasmid #129716) using In-Fusion cloning. eGFP-NLS was cloned in a similar manner. sgRNAs were cloned into LentiGuide-Puro (a gift from Feng Zhang, Addgene #52963) or a modified form of LentiGuide-Puro in which Cas9 was replaced by GFP-NLS or mCherry-NLS as previously described.104 His10-UFM1DSC was subcloned from pRK5-HA-UFM1 (a gift from Yihong Ye, Addgene #134639) using PCR and inserted into a modified LentiGuide-Puro GFP by replacing the puromycin selection marker with His10-UFM1DSC using In-Fusion cloning. .. TCOF1-V5-eGFP was then cloned into pSH-EF-IRES-AtAFB2-mCherry (a gift from Elina Ikonen, Addgene plasmid #129716) using In-Fusion cloning. eGFP-NLS was cloned in a similar manner. sgRNAs were cloned into LentiGuide-Puro (a gift from Feng Zhang, Addgene #52963) or a modified form of LentiGuide-Puro in which Cas9 was replaced by GFP-NLS or mCherry-NLS as previously described.104 His10-UFM1DSC was subcloned from pRK5-HA-UFM1 (a gift from Yihong Ye, Addgene #134639) using PCR and inserted into a modified LentiGuide-Puro GFP by replacing the puromycin selection marker with His10-UFM1DSC using In-Fusion cloning. .. All sgRNAs cloned into Lenti-Guide-Puro or Lenti-Guide-GFP vectors were cloned using Zhang lab protocol.109 Lentiviral particles were generated as previously described using second generation lentiviral vectors psPAX2 and pMD2.G (a gift from Didier Trono, Addgene #12260 and #12259).

    Selection:

    Article Title: Protein UFMylation regulates early events during ribosomal DNA-damage response.
    Article Snippet: TCOF1-V5-eGFP was then cloned into pSH-EF-IRES-AtAFB2-mCherry (a gift from Elina Ikonen, Addgene plasmid #129716) using In-Fusion cloning. eGFP-NLS was cloned in a similar manner. sgRNAs were cloned into LentiGuide-Puro (a gift from Feng Zhang, Addgene #52963) or a modified form of LentiGuide-Puro in which Cas9 was replaced by GFP-NLS or mCherry-NLS as previously described.104 His10-UFM1DSC was subcloned from pRK5-HA-UFM1 (a gift from Yihong Ye, Addgene #134639) using PCR and inserted into a modified LentiGuide-Puro GFP by replacing the puromycin selection marker with His10-UFM1DSC using In-Fusion cloning. .. TCOF1-V5-eGFP was then cloned into pSH-EF-IRES-AtAFB2-mCherry (a gift from Elina Ikonen, Addgene plasmid #129716) using In-Fusion cloning. eGFP-NLS was cloned in a similar manner. sgRNAs were cloned into LentiGuide-Puro (a gift from Feng Zhang, Addgene #52963) or a modified form of LentiGuide-Puro in which Cas9 was replaced by GFP-NLS or mCherry-NLS as previously described.104 His10-UFM1DSC was subcloned from pRK5-HA-UFM1 (a gift from Yihong Ye, Addgene #134639) using PCR and inserted into a modified LentiGuide-Puro GFP by replacing the puromycin selection marker with His10-UFM1DSC using In-Fusion cloning. .. All sgRNAs cloned into Lenti-Guide-Puro or Lenti-Guide-GFP vectors were cloned using Zhang lab protocol.109 Lentiviral particles were generated as previously described using second generation lentiviral vectors psPAX2 and pMD2.G (a gift from Didier Trono, Addgene #12260 and #12259).

    Marker:

    Article Title: Protein UFMylation regulates early events during ribosomal DNA-damage response.
    Article Snippet: TCOF1-V5-eGFP was then cloned into pSH-EF-IRES-AtAFB2-mCherry (a gift from Elina Ikonen, Addgene plasmid #129716) using In-Fusion cloning. eGFP-NLS was cloned in a similar manner. sgRNAs were cloned into LentiGuide-Puro (a gift from Feng Zhang, Addgene #52963) or a modified form of LentiGuide-Puro in which Cas9 was replaced by GFP-NLS or mCherry-NLS as previously described.104 His10-UFM1DSC was subcloned from pRK5-HA-UFM1 (a gift from Yihong Ye, Addgene #134639) using PCR and inserted into a modified LentiGuide-Puro GFP by replacing the puromycin selection marker with His10-UFM1DSC using In-Fusion cloning. .. TCOF1-V5-eGFP was then cloned into pSH-EF-IRES-AtAFB2-mCherry (a gift from Elina Ikonen, Addgene plasmid #129716) using In-Fusion cloning. eGFP-NLS was cloned in a similar manner. sgRNAs were cloned into LentiGuide-Puro (a gift from Feng Zhang, Addgene #52963) or a modified form of LentiGuide-Puro in which Cas9 was replaced by GFP-NLS or mCherry-NLS as previously described.104 His10-UFM1DSC was subcloned from pRK5-HA-UFM1 (a gift from Yihong Ye, Addgene #134639) using PCR and inserted into a modified LentiGuide-Puro GFP by replacing the puromycin selection marker with His10-UFM1DSC using In-Fusion cloning. .. All sgRNAs cloned into Lenti-Guide-Puro or Lenti-Guide-GFP vectors were cloned using Zhang lab protocol.109 Lentiviral particles were generated as previously described using second generation lentiviral vectors psPAX2 and pMD2.G (a gift from Didier Trono, Addgene #12260 and #12259).



    Similar Products

    paavcag pre mgrasp mcerulean 2a nlsmcherry plasmid  (Addgene inc)
    93
    Addgene inc paavcag pre mgrasp mcerulean 2a nlsmcherry plasmid
    Paavcag Pre Mgrasp Mcerulean 2a Nlsmcherry Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+nls/paavCAG-pre-mGRASP-mCerulean-2A-nls-mCherry+(Plasmid+%2334911)/pm42750047-53-11-15
    Average 93 stars, based on 1 article reviews
    paavcag pre mgrasp mcerulean 2a nlsmcherry plasmid - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    csii pref1a mcherry3×nls  (Addgene inc)
    92
    Addgene inc csii pref1a mcherry3×nls
    Csii Pref1a Mcherry3×Nls, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+nls/CSII-prEF1a-mCherry-3xNLS+(Plasmid+%23125262)/pm41826758-595-21-27
    Average 92 stars, based on 1 article reviews
    csii pref1a mcherry3×nls - by Bioz Stars, 2026-10
    92/100 stars
    		  Buy from Supplier
    pcdna5 mts tagbfpp2at2a egfp nls p2at2a mcherry pts1  (Addgene inc)
    94
    Addgene inc pcdna5 mts tagbfpp2at2a egfp nls p2at2a mcherry pts1
    Pcdna5 Mts Tagbfpp2at2a Egfp Nls P2at2a Mcherry Pts1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+nls/pcDNA3%2E1+Makona+EBOV+AB'3+(Plasmid+%2387813)/pm41786974-47-16-17
    Average 94 stars, based on 1 article reviews
    pcdna5 mts tagbfpp2at2a egfp nls p2at2a mcherry pts1 - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    pcdna5 mts tagbfp p2at2a egfp nls p2at2a mcherry pts1  (Addgene inc)
    94
    Addgene inc pcdna5 mts tagbfp p2at2a egfp nls p2at2a mcherry pts1
    Pcdna5 Mts Tagbfp P2at2a Egfp Nls P2at2a Mcherry Pts1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+nls/pcDNA3%2E1+Makona+EBOV+AB'3+(Plasmid+%2387813)/pmc13049093-43-16-17
    Average 94 stars, based on 1 article reviews
    pcdna5 mts tagbfp p2at2a egfp nls p2at2a mcherry pts1 - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    lentiguide puro nls mcherry vector  (Addgene inc)
    96
    Addgene inc lentiguide puro nls mcherry vector
    Lentiguide Puro Nls Mcherry Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+nls/lentiGuide-Puro+(Plasmid+%2352963)/pm41671082-214-58-60
    Average 96 stars, based on 1 article reviews
    lentiguide puro nls mcherry vector - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    nls mcherry lexy pdn122  (Addgene inc)
    93
    Addgene inc nls mcherry lexy pdn122
    Nls Mcherry Lexy Pdn122, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+nls/NLS-mCherry-LEXY+(pDN122)+(Plasmid+%2372655)/bio_rxiv__64898__2026__02__03__703609-153-5-18
    Average 93 stars, based on 1 article reviews
    nls mcherry lexy pdn122 - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    mcherry nls plasmids  (Addgene inc)
    98
    Addgene inc mcherry nls plasmids
    (A and B) Analysis of nuclear pore formation in control telophase cells and cells fixed at different time points after cell-cell fusion and respective fluorescence intensity quantification. Magenta square shows nuclear envelope membranes on condensed chromosomes but no nuclear pore protein accumulation. Control, n=19 cells; 20 min, n=20 cells; 30 min, n=22 cells; 40 min, n=27 cells; 50 min, n=32 cells and 60 min, n=26 cells. Statistics, non-parametric Mann-Whitney test. (C) Time-lapse <t>of</t> <t>mCherry-NLS</t> in control and mitotic fused cells shows efficient import of the NLS signal in control and fused interphase nucleus (cyan arrow), but not in mitotic fused nucleus (magenta arrows). Time is in h:min. Scale bar is 10μm. (D) Ratio of nuclear and cytoplasmic NLS signal of the examples shown in (C).
    Mcherry Nls Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+nls/pMD2%2EG+(Plasmid+%2312259)/bio_rxiv__64898__2026__01__27__700572-155-5-10
    Average 98 stars, based on 1 article reviews
    mcherry nls plasmids - by Bioz Stars, 2026-10
    98/100 stars
    		  Buy from Supplier
    plasmid mcherry c1  (Addgene inc)
    94
    Addgene inc plasmid mcherry c1
    PARP inhibitors increase MMEJ at ISceI-mediated deDSBs. ( A, B ) Schematic ( A ) and experimental timeline ( B ) of MMEJ reporter used in panels (C)–(F), Figs and , , , and E, and , and and . Cutting the reporter with ISceI and repair by microhomology annealing to an in-frame, functional <t>mCherry</t> gene. Flow cytometry was used to identify the mCherry + cells (MMEJ+) within the BFP+ (ISceI+) population. ( C–E ) MMEJ quantification using reporter and timeline from panel (A) and (B) in HT1080 cells. Values are normalized to DMSO. Drugs used were olaparib (5 µM or as indicated), DNA-PKcsi (NU7441, 1 µM), Polθi (ART558 10 µM), niraparib (2.5 µM), rucaparib (2.5 µM), and talazoparib (2.5 µM). ( F ) MMEJ quantification in HT1080 parental cells compared to isogenic POLQ -KO cells following olaparib treatment. Values are normalized to wild-type DMSO. Statistical analyses for panels (C)–(F): Data represent three independent experiments, each the average of three technical replicates. Data are mean ± SEM. Statistical test, one way ANOVA with multiple comparison correction. ns: nonsignificant, * P <.05, ** P <.01, *** P <.001, **** P <.0001.
    Plasmid Mcherry C1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+nls/pmCherry-C1+mCherry-NLS+(Plasmid+%2358476)/pmc12774638-73-29-38
    Average 94 stars, based on 1 article reviews
    plasmid mcherry c1 - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    aavretro hsyn nls mcherry  (Vigene Biosciences)
    86
    Vigene Biosciences aavretro hsyn nls mcherry
    PARP inhibitors increase MMEJ at ISceI-mediated deDSBs. ( A, B ) Schematic ( A ) and experimental timeline ( B ) of MMEJ reporter used in panels (C)–(F), Figs and , , , and E, and , and and . Cutting the reporter with ISceI and repair by microhomology annealing to an in-frame, functional <t>mCherry</t> gene. Flow cytometry was used to identify the mCherry + cells (MMEJ+) within the BFP+ (ISceI+) population. ( C–E ) MMEJ quantification using reporter and timeline from panel (A) and (B) in HT1080 cells. Values are normalized to DMSO. Drugs used were olaparib (5 µM or as indicated), DNA-PKcsi (NU7441, 1 µM), Polθi (ART558 10 µM), niraparib (2.5 µM), rucaparib (2.5 µM), and talazoparib (2.5 µM). ( F ) MMEJ quantification in HT1080 parental cells compared to isogenic POLQ -KO cells following olaparib treatment. Values are normalized to wild-type DMSO. Statistical analyses for panels (C)–(F): Data represent three independent experiments, each the average of three technical replicates. Data are mean ± SEM. Statistical test, one way ANOVA with multiple comparison correction. ns: nonsignificant, * P <.05, ** P <.01, *** P <.001, **** P <.0001.
    Aavretro Hsyn Nls Mcherry, supplied by Vigene Biosciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+nls/hsyn+mcherry+plasmid/10__1523_slash_jneurosci__2258___24__2026-48-8-9
    Average 86 stars, based on 1 article reviews
    aavretro hsyn nls mcherry - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    pmcherry c1 actin  (Addgene inc)
    94
    Addgene inc pmcherry c1 actin
    (A) Cells were transfected with <t>the</t> <t>pmCherry-C1</t> <t>actin-3×NLS</t> P2A mCherry construct. After transfection, the cells were fixed with 3.7% paraformaldehyde and subjected to immunofluorescence staining for FNBP4. FNBP4 was detected using an anti-FNBP4 antibody, and nuclei were counterstained with DAPI. The representative image shows a single optical section from the middle of the Z-stack. Scale bar: 20 µm. (B) Quantification of FNBP4 and actin colocalization using Manders’ Colocalization Coefficient. The scatter dot plot shows the distribution of data points along with standard deviations.
    Pmcherry C1 Actin, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+nls/pmCherry-C1+actin-3XNLS+P2A+mCherry+(Plasmid+%2358475)/bio_rxiv__64898__2026__01__05__697755-226-4-12
    Average 94 stars, based on 1 article reviews
    pmcherry c1 actin - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier

    Image Search Results


    (A and B) Analysis of nuclear pore formation in control telophase cells and cells fixed at different time points after cell-cell fusion and respective fluorescence intensity quantification. Magenta square shows nuclear envelope membranes on condensed chromosomes but no nuclear pore protein accumulation. Control, n=19 cells; 20 min, n=20 cells; 30 min, n=22 cells; 40 min, n=27 cells; 50 min, n=32 cells and 60 min, n=26 cells. Statistics, non-parametric Mann-Whitney test. (C) Time-lapse of mCherry-NLS in control and mitotic fused cells shows efficient import of the NLS signal in control and fused interphase nucleus (cyan arrow), but not in mitotic fused nucleus (magenta arrows). Time is in h:min. Scale bar is 10μm. (D) Ratio of nuclear and cytoplasmic NLS signal of the examples shown in (C).

    Journal: bioRxiv

    Article Title: Live dynamics of induced cell-cell fusion between mitotic and interphasic cells

    doi: 10.64898/2026.01.27.700572

    Figure Lengend Snippet: (A and B) Analysis of nuclear pore formation in control telophase cells and cells fixed at different time points after cell-cell fusion and respective fluorescence intensity quantification. Magenta square shows nuclear envelope membranes on condensed chromosomes but no nuclear pore protein accumulation. Control, n=19 cells; 20 min, n=20 cells; 30 min, n=22 cells; 40 min, n=27 cells; 50 min, n=32 cells and 60 min, n=26 cells. Statistics, non-parametric Mann-Whitney test. (C) Time-lapse of mCherry-NLS in control and mitotic fused cells shows efficient import of the NLS signal in control and fused interphase nucleus (cyan arrow), but not in mitotic fused nucleus (magenta arrows). Time is in h:min. Scale bar is 10μm. (D) Ratio of nuclear and cytoplasmic NLS signal of the examples shown in (C).

    Article Snippet: The VSV-G (#12259), BFP and mCherry-NLS plasmids were obtained from Addgene.

    Techniques: Control, Fluorescence, MANN-WHITNEY

    PARP inhibitors increase MMEJ at ISceI-mediated deDSBs. ( A, B ) Schematic ( A ) and experimental timeline ( B ) of MMEJ reporter used in panels (C)–(F), Figs and , , , and E, and , and and . Cutting the reporter with ISceI and repair by microhomology annealing to an in-frame, functional mCherry gene. Flow cytometry was used to identify the mCherry + cells (MMEJ+) within the BFP+ (ISceI+) population. ( C–E ) MMEJ quantification using reporter and timeline from panel (A) and (B) in HT1080 cells. Values are normalized to DMSO. Drugs used were olaparib (5 µM or as indicated), DNA-PKcsi (NU7441, 1 µM), Polθi (ART558 10 µM), niraparib (2.5 µM), rucaparib (2.5 µM), and talazoparib (2.5 µM). ( F ) MMEJ quantification in HT1080 parental cells compared to isogenic POLQ -KO cells following olaparib treatment. Values are normalized to wild-type DMSO. Statistical analyses for panels (C)–(F): Data represent three independent experiments, each the average of three technical replicates. Data are mean ± SEM. Statistical test, one way ANOVA with multiple comparison correction. ns: nonsignificant, * P <.05, ** P <.01, *** P <.001, **** P <.0001.

    Journal: Nucleic Acids Research

    Article Title: PARP1 and PARP2 are dispensable for DNA repair by microhomology-mediated end-joining at double-ended DSBs

    doi: 10.1093/nar/gkaf1437

    Figure Lengend Snippet: PARP inhibitors increase MMEJ at ISceI-mediated deDSBs. ( A, B ) Schematic ( A ) and experimental timeline ( B ) of MMEJ reporter used in panels (C)–(F), Figs and , , , and E, and , and and . Cutting the reporter with ISceI and repair by microhomology annealing to an in-frame, functional mCherry gene. Flow cytometry was used to identify the mCherry + cells (MMEJ+) within the BFP+ (ISceI+) population. ( C–E ) MMEJ quantification using reporter and timeline from panel (A) and (B) in HT1080 cells. Values are normalized to DMSO. Drugs used were olaparib (5 µM or as indicated), DNA-PKcsi (NU7441, 1 µM), Polθi (ART558 10 µM), niraparib (2.5 µM), rucaparib (2.5 µM), and talazoparib (2.5 µM). ( F ) MMEJ quantification in HT1080 parental cells compared to isogenic POLQ -KO cells following olaparib treatment. Values are normalized to wild-type DMSO. Statistical analyses for panels (C)–(F): Data represent three independent experiments, each the average of three technical replicates. Data are mean ± SEM. Statistical test, one way ANOVA with multiple comparison correction. ns: nonsignificant, * P <.05, ** P <.01, *** P <.001, **** P <.0001.

    Article Snippet: The PARP2 plasmid used to complement PARP2 -KO clones was a generous gift from the Karolin Luger lab and was derived by cloning the human PARP2 coding region into plasmid mCherry C1 (obtained from Dyche Mullins [ ], Addgene #58476).

    Techniques: Functional Assay, Flow Cytometry, Comparison

    PARPi-dependent MMEJ increase does not occur at Cas9-induced DSBs. ( A, B ) Schematic ( A ) and experimental timeline ( B ) of MMEJ reporter used in panels (C)–(E), Figs and . Repair of the Cas9-induced cut with microhomology annealing leads to an in-frame, functional mCherry gene. Flow cytometry was used to identify the mCherry + cells (MMEJ+) within the GFP+ (Cas9+) population. ( C–E ) MMEJ quantification using the reporter and timeline from panels (A) and (B) in HT1080 cells. Values are normalized to DMSO. Drugs used were olaparib (5 µM or indicated dose), DNA-PKcsi (NU7441, 1 µM), Polθi (ART558, 10 µM). ( F ) HR quantification using the DR-GFP reporter in HT1080 cells after an ISceI- or Cas9-induced DSB, ± olaparib treatment (5 µM). Statistical analyses ( C–F ): Data represent three (D–F) or four ( C ) independent experiments, each the average of three technical replicates. Data are mean ± SEM. Statistical test, one way ANOVA with multiple comparison correction. ns: nonsignificant, * P <.05, ** P <.01, *** P <.001, **** P <.0001.

    Journal: Nucleic Acids Research

    Article Title: PARP1 and PARP2 are dispensable for DNA repair by microhomology-mediated end-joining at double-ended DSBs

    doi: 10.1093/nar/gkaf1437

    Figure Lengend Snippet: PARPi-dependent MMEJ increase does not occur at Cas9-induced DSBs. ( A, B ) Schematic ( A ) and experimental timeline ( B ) of MMEJ reporter used in panels (C)–(E), Figs and . Repair of the Cas9-induced cut with microhomology annealing leads to an in-frame, functional mCherry gene. Flow cytometry was used to identify the mCherry + cells (MMEJ+) within the GFP+ (Cas9+) population. ( C–E ) MMEJ quantification using the reporter and timeline from panels (A) and (B) in HT1080 cells. Values are normalized to DMSO. Drugs used were olaparib (5 µM or indicated dose), DNA-PKcsi (NU7441, 1 µM), Polθi (ART558, 10 µM). ( F ) HR quantification using the DR-GFP reporter in HT1080 cells after an ISceI- or Cas9-induced DSB, ± olaparib treatment (5 µM). Statistical analyses ( C–F ): Data represent three (D–F) or four ( C ) independent experiments, each the average of three technical replicates. Data are mean ± SEM. Statistical test, one way ANOVA with multiple comparison correction. ns: nonsignificant, * P <.05, ** P <.01, *** P <.001, **** P <.0001.

    Article Snippet: The PARP2 plasmid used to complement PARP2 -KO clones was a generous gift from the Karolin Luger lab and was derived by cloning the human PARP2 coding region into plasmid mCherry C1 (obtained from Dyche Mullins [ ], Addgene #58476).

    Techniques: Functional Assay, Flow Cytometry, Comparison

    (A) Cells were transfected with the pmCherry-C1 actin-3×NLS P2A mCherry construct. After transfection, the cells were fixed with 3.7% paraformaldehyde and subjected to immunofluorescence staining for FNBP4. FNBP4 was detected using an anti-FNBP4 antibody, and nuclei were counterstained with DAPI. The representative image shows a single optical section from the middle of the Z-stack. Scale bar: 20 µm. (B) Quantification of FNBP4 and actin colocalization using Manders’ Colocalization Coefficient. The scatter dot plot shows the distribution of data points along with standard deviations.

    Journal: bioRxiv

    Article Title: Dual Regulatory Role of Nuclear FNBP4 in Actin Binding and Formin FMN1 Inhibition

    doi: 10.64898/2026.01.05.697755

    Figure Lengend Snippet: (A) Cells were transfected with the pmCherry-C1 actin-3×NLS P2A mCherry construct. After transfection, the cells were fixed with 3.7% paraformaldehyde and subjected to immunofluorescence staining for FNBP4. FNBP4 was detected using an anti-FNBP4 antibody, and nuclei were counterstained with DAPI. The representative image shows a single optical section from the middle of the Z-stack. Scale bar: 20 µm. (B) Quantification of FNBP4 and actin colocalization using Manders’ Colocalization Coefficient. The scatter dot plot shows the distribution of data points along with standard deviations.

    Article Snippet: For transfection studies, the pmCherry-C1 actin-3×NLS P2A mCherry plasmid was obtained from Addgene (RRID:Addgene_58475; deposited by Dyche Mullins).

    Techniques: Transfection, Construct, Immunofluorescence, Staining