Review



mcherry mrna  (TriLink)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    TriLink mcherry mrna
    Mcherry Mrna, supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+mrna/mcherry+mrna/us12331264-1368-46-49
    Average 90 stars, based on 1 article reviews
    mcherry mrna - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Luciferase:

    Article Title: Branched endosomal disruptor (BEND) lipids mediate delivery of mRNA and CRISPR-Cas9 ribonucleoprotein complex for hepatic gene editing and T cell engineering.
    Article Snippet: All non-IL LNP lipid excipients as well as lipids to make the artificial endosomes were purchased from Avanti Polar Lipids (Alabaster, AL, USA). .. Cas9, firefly luciferase, and mCherry mRNA were purchased from TriLink Biotechnologies (San Diego, CA, USA) with 5-methoxyuridine substitutions for Cas9 and firefly luciferase and N1methylpseudouridine substitutions formCherry. .. Cy3 EGFPmRNAwith 5-methoxyuridine substitutions was purchased from APExBIO (Houston, TX, USA).

    Article Title: Branched endosomal disruptor (BEND) lipids mediate delivery of mRNA and CRISPR-Cas9 ribonucleoprotein complex for hepatic gene editing and T cell engineering
    Article Snippet: All non-IL LNP lipid excipients as well as lipids to make the artificial endosomes were purchased from Avanti Polar Lipids (Alabaster, AL, USA). .. Cas9, firefly luciferase, and mCherry mRNA were purchased from TriLink Biotechnologies (San Diego, CA, USA) with 5-methoxyuridine substitutions for Cas9 and firefly luciferase and N1-methylpseudouridine substitutions for mCherry. .. Cy3 EGFP mRNA with 5-methoxyuridine substitutions was purchased from APExBIO (Houston, TX, USA).

    other:

    Article Title: Lipid nanoparticles for delivery of nucleic acids and methods of use thereof
    Article Snippet: For example, an LNP formulation of AKG-UO-1/DSPC/DSPS/Chol/PEG-DMG (50/2.5/7.5/38.5/1.5 mol %), with an N/P of 5 contained 1500 nmol AKG-UO-1, 75 nmol DSPC, 225 nmol DSPS, 1155 nmol Chol and 45 nmol PEG-DMG for every 100 μg of mRNA used. mRNA solutions were prepared by thawing frozen mRNA (mCherry mRNA, Trilink) vials and diluting mRNA in 6.25 mM sodium acetate (pH 5.0) to a final concentration of 0.033 mg/mL.

    Sequencing:

    Article Title: Ionizable cationic lipids
    Article Snippet: .. The open reading frame sequence for the mCherry mRNA from TriLink (Cat #L-7203) corresponds to SEQ ID NO: 1: AUGGUGAGCAAGGGCGAGGAGGACAACAUGGCCAUCAUCAAGGAGUUCAU GCGGUUCAAGGUGCACAUGGAGGGCAGCGUGAACGGCCACGAGUUCGAGA UCGAGGGCGAGGGCGAGGGCCGGCCCUACGAGGGCACCCAGACCGCCAAG CUGAAGGUGACCAAGGGCGGCCCCCUGCCCUUCGCCUGGGACAUCCUGAG CCCCCAGUUCAUGUACGGCAGCAAGGCCUACGUGAAGCACCCCGCCGACA UCCCCGACUACCUGAAGCUGAGCUUCCCCGAGGGCUUCAAGUGGGAGCGG GUGAUGAACUUCGAGGACGGCGGCGUGGUGACCGUGACCCAGGACAGCAG CCUGCAGGACGGCGAGUUCAUCUACAAGGUGAAGCUGCGGGGCACCAACU UCCCCAGCGACGGCCCCGUGAUGCAGAAGAAGACCAUGGGCUGGGAGGCC AGCAGCGAGCGGAUGUACCCCGAGGACGGCGCCCUGAAGGGCGAGAUCAA GCAGCGGCUGAAGCUGAAGGACGGCGGCCACUACGACGCCGAGGUGAAGA CCACCUACAAGGCCAAGAAGCCCGUGCAGCUGCCCGGCGCCUACAACGUG AACAUCAAGCUGGACAUCACCAGCCACAACGAGGACUACACCAUCGUGGA GCAGUACGAGCGGGCCGAGGGCCGGCACAGCACCGGCGGCAUGGACGAGC UGUACAAGAGCGGCAACUGA Stock solutions of each lipid were prepared. .. Ionizable lipids were weighed out in 4 mL glass vials (Thermo B7999-2) and dissolved in ethanol (Sigma-Aldrich 200 proof, RNase free) to a final concentration of 10 mM.

    Article Title: Lipid nanoparticles for delivery of nucleic acids and methods of use thereof
    Article Snippet: .. The open reading frame sequence for the mCherry mRNA from TriLink (Cat #L-7203) corresponds to SEO ID NO: 1: AUGGUGAGCAAGGGCGAGGAGGACAACAUGGCCAUCAUCAAGGAGUUCA UGCGGUUCAAGGUGCACAUGGAGGGCAGCGUGAACGGCCACGAGUUCGA GAUCGAGGGCGAGGGCGAGGGCCGGCCCUACGAGGGCACCCAGACCGCC AAGCUGAAGGUGACCAAGGGCGGCCCCCUGCCCUUCGCCUGGGACAUCC UGAGCCCCCAGUUCAUGUACGGCAGCAAGGCCUACGUGAAGCACCCCGC CGACAUCCCCGACUACCUGAAGCUGAGCUUCCCCGAGGGCUUCAAGUGG GAGCGGGUGAUGAACUUCGAGGACGGCGGCGUGGUGACCGUGACCCAGG ACAGCAGCCUGCAGGACGGCGAGUUCAUCUACAAGGUGAAGCUGCGGGG CACCAACUUCCCCAGCGACGGCCCCGUGAUGCAGAAGAAGACCAUGGGC UGGGAGGCCAGCAGCGAGCGGAUGUACCCCGAGGACGGCGCCCUGAAGG GCGAGAUCAAGCAGCGGCUGAAGCUGAAGGACGGCGGCCACUACGACGC CGAGGUGAAGACCACCUACAAGGCCAAGAAGCCCGUGCAGCUGCCCGGC GCCUACAACGUGAACAUCAAGCUGGACAUCACCAGCCACAACGAGGACU ACACCAUCGUGGAGCAGUACGAGCGGGCCGAGGGCCGGCACAGCACCGG CGGCAUGGACGAGCUGUACAAGAGCGGCAACUGA Stock solutions of each lipid were prepared. .. Ionizable lipids were weighed out in 4 mL glass vials (Thermo B7999-2) and dissolved in ethanol (Sigma-Aldrich 200 proof, RNase free) to a final concentration of 10 mM.

    Incubation:

    Article Title: SCORT–Cas13d Nanotherapy Precisely Targets the ‘Undruggable’ Transcription Factor HoxB13 in Metastatic Prostate Cancer In Vivo
    Article Snippet: .. They were then separately incubated with SCORT LNP candidates encapsulating 1 μg of EGFP mRNA (TriLink, no. L‐7601) or mCherry mRNA (TriLink, no. L‐7203) for 24 h. Subsequently, fluorescence analysis was conducted using the Fortessa x20 Analyzer (BD). ..

    Fluorescence:

    Article Title: SCORT–Cas13d Nanotherapy Precisely Targets the ‘Undruggable’ Transcription Factor HoxB13 in Metastatic Prostate Cancer In Vivo
    Article Snippet: .. They were then separately incubated with SCORT LNP candidates encapsulating 1 μg of EGFP mRNA (TriLink, no. L‐7601) or mCherry mRNA (TriLink, no. L‐7203) for 24 h. Subsequently, fluorescence analysis was conducted using the Fortessa x20 Analyzer (BD). ..



    Similar Products

    mcherry mrna lnps  (Moderna)
    86
    Moderna mcherry mrna lnps
    Mcherry Mrna Lnps, supplied by Moderna, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+mrna/lnps+mrna/pm40885402-167-1-22
    Average 86 stars, based on 1 article reviews
    mcherry mrna lnps - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    cas9 mrna  (Addgene inc)
    96
    Addgene inc cas9 mrna
    CSPG4 expression in skeletal muscle of the rats. (A) Representative image of immunostaining for CSPG4 and laminin of TA muscles from WT rats. White arrow, blood vessel. Black arrow, perineurium. White arrowheads, CSPG4‐positive mononucleated stromal cells. Scale bar = 100 μm (upper) and 20 μm (lower), respectively. (B) Representative image of immunostaining for CSPG4 and laminin of TA muscles from DMD rats. White arrowheads, CSPG4‐positive cells on the outer side of the basement membrane. Black arrowheads, CSPG4‐positive cells on the inner side of the basement membrane. White arrow, regenerating myofiber surrounded by CSPG4. Scale bars = 100 μm (upper) and 20 μm (lower), respectively. (C) Quantitative analysis of CSPG4‐positive mononuclear cells inside and outside of myofibers in sections from WT ( n = 3) and DMD rats ( n = 10). Data are mean ± SEM. ** p < 0.01, unpaired Student's t test. (D) Representative image of immunostaining for CSPG4 and laminin of BPVC‐injected regenerating TA muscles. White arrowheads, CSPG4‐positive cells on the outer side of the basement membrane. Black arrowheads, CSPG4‐positive cells on the inner side of the basement membrane. White arrow, regenerating myofiber surrounded by CSPG4. Scale bar = 100 μm. (E) Quantitative analysis of CSPG4‐positive mononuclear stromal cells in sections from BPVC‐injected regenerating TA muscles ( n = 4 at each time point). Data are mean ± SEM. ** p < 0.01 versus intact, Dunnett's t test. (F) Quantitative analysis of the myofibers surrounded by CSPG4 in sections from BPVC‐injected regenerating TA muscles ( n = 4 at each time point). Data are mean ± SEM. ** p < 0.01 versus intact, Dunnett's t test. (G) Representative image of in situ hybridization for Cspg4 <t>mRNA</t> of BPVC‐injected regenerating TA muscle. Regenerating myofibers are surrounded by dotted white lines. Scale bar = 50 μm. White arrowheads, Cspg4 mRNA expressed inside myofibers.
    Cas9 Mrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+mrna/pU6-(BbsI)_CBh-Cas9-T2A-mCherry+(Plasmid+%2364324)/pmc12328044-38-3-17
    Average 96 stars, based on 1 article reviews
    cas9 mrna - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    mrna encoding mcherry mtrim21  (Addgene inc)
    93
    Addgene inc mrna encoding mcherry mtrim21
    CSPG4 expression in skeletal muscle of the rats. (A) Representative image of immunostaining for CSPG4 and laminin of TA muscles from WT rats. White arrow, blood vessel. Black arrow, perineurium. White arrowheads, CSPG4‐positive mononucleated stromal cells. Scale bar = 100 μm (upper) and 20 μm (lower), respectively. (B) Representative image of immunostaining for CSPG4 and laminin of TA muscles from DMD rats. White arrowheads, CSPG4‐positive cells on the outer side of the basement membrane. Black arrowheads, CSPG4‐positive cells on the inner side of the basement membrane. White arrow, regenerating myofiber surrounded by CSPG4. Scale bars = 100 μm (upper) and 20 μm (lower), respectively. (C) Quantitative analysis of CSPG4‐positive mononuclear cells inside and outside of myofibers in sections from WT ( n = 3) and DMD rats ( n = 10). Data are mean ± SEM. ** p < 0.01, unpaired Student's t test. (D) Representative image of immunostaining for CSPG4 and laminin of BPVC‐injected regenerating TA muscles. White arrowheads, CSPG4‐positive cells on the outer side of the basement membrane. Black arrowheads, CSPG4‐positive cells on the inner side of the basement membrane. White arrow, regenerating myofiber surrounded by CSPG4. Scale bar = 100 μm. (E) Quantitative analysis of CSPG4‐positive mononuclear stromal cells in sections from BPVC‐injected regenerating TA muscles ( n = 4 at each time point). Data are mean ± SEM. ** p < 0.01 versus intact, Dunnett's t test. (F) Quantitative analysis of the myofibers surrounded by CSPG4 in sections from BPVC‐injected regenerating TA muscles ( n = 4 at each time point). Data are mean ± SEM. ** p < 0.01 versus intact, Dunnett's t test. (G) Representative image of in situ hybridization for Cspg4 <t>mRNA</t> of BPVC‐injected regenerating TA muscle. Regenerating myofibers are surrounded by dotted white lines. Scale bar = 50 μm. White arrowheads, Cspg4 mRNA expressed inside myofibers.
    Mrna Encoding Mcherry Mtrim21, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+mrna/pGEMHE-mCherry-mTrim21+(Plasmid+%23105522)/pmc10470461__JCB_202211029_review_history-139-4-7
    Average 93 stars, based on 1 article reviews
    mrna encoding mcherry mtrim21 - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    mcherry mrna  (TriLink)
    90
    TriLink mcherry mrna
    CSPG4 expression in skeletal muscle of the rats. (A) Representative image of immunostaining for CSPG4 and laminin of TA muscles from WT rats. White arrow, blood vessel. Black arrow, perineurium. White arrowheads, CSPG4‐positive mononucleated stromal cells. Scale bar = 100 μm (upper) and 20 μm (lower), respectively. (B) Representative image of immunostaining for CSPG4 and laminin of TA muscles from DMD rats. White arrowheads, CSPG4‐positive cells on the outer side of the basement membrane. Black arrowheads, CSPG4‐positive cells on the inner side of the basement membrane. White arrow, regenerating myofiber surrounded by CSPG4. Scale bars = 100 μm (upper) and 20 μm (lower), respectively. (C) Quantitative analysis of CSPG4‐positive mononuclear cells inside and outside of myofibers in sections from WT ( n = 3) and DMD rats ( n = 10). Data are mean ± SEM. ** p < 0.01, unpaired Student's t test. (D) Representative image of immunostaining for CSPG4 and laminin of BPVC‐injected regenerating TA muscles. White arrowheads, CSPG4‐positive cells on the outer side of the basement membrane. Black arrowheads, CSPG4‐positive cells on the inner side of the basement membrane. White arrow, regenerating myofiber surrounded by CSPG4. Scale bar = 100 μm. (E) Quantitative analysis of CSPG4‐positive mononuclear stromal cells in sections from BPVC‐injected regenerating TA muscles ( n = 4 at each time point). Data are mean ± SEM. ** p < 0.01 versus intact, Dunnett's t test. (F) Quantitative analysis of the myofibers surrounded by CSPG4 in sections from BPVC‐injected regenerating TA muscles ( n = 4 at each time point). Data are mean ± SEM. ** p < 0.01 versus intact, Dunnett's t test. (G) Representative image of in situ hybridization for Cspg4 <t>mRNA</t> of BPVC‐injected regenerating TA muscle. Regenerating myofibers are surrounded by dotted white lines. Scale bar = 50 μm. White arrowheads, Cspg4 mRNA expressed inside myofibers.
    Mcherry Mrna, supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+mrna/mcherry+mrna/us12331264-1368-46-49
    Average 90 stars, based on 1 article reviews
    mcherry mrna - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    mrna modified with 5-methoxyuridine (5mou) and coding for mcherry  (TriLink)
    90
    TriLink mrna modified with 5-methoxyuridine (5mou) and coding for mcherry
    CSPG4 expression in skeletal muscle of the rats. (A) Representative image of immunostaining for CSPG4 and laminin of TA muscles from WT rats. White arrow, blood vessel. Black arrow, perineurium. White arrowheads, CSPG4‐positive mononucleated stromal cells. Scale bar = 100 μm (upper) and 20 μm (lower), respectively. (B) Representative image of immunostaining for CSPG4 and laminin of TA muscles from DMD rats. White arrowheads, CSPG4‐positive cells on the outer side of the basement membrane. Black arrowheads, CSPG4‐positive cells on the inner side of the basement membrane. White arrow, regenerating myofiber surrounded by CSPG4. Scale bars = 100 μm (upper) and 20 μm (lower), respectively. (C) Quantitative analysis of CSPG4‐positive mononuclear cells inside and outside of myofibers in sections from WT ( n = 3) and DMD rats ( n = 10). Data are mean ± SEM. ** p < 0.01, unpaired Student's t test. (D) Representative image of immunostaining for CSPG4 and laminin of BPVC‐injected regenerating TA muscles. White arrowheads, CSPG4‐positive cells on the outer side of the basement membrane. Black arrowheads, CSPG4‐positive cells on the inner side of the basement membrane. White arrow, regenerating myofiber surrounded by CSPG4. Scale bar = 100 μm. (E) Quantitative analysis of CSPG4‐positive mononuclear stromal cells in sections from BPVC‐injected regenerating TA muscles ( n = 4 at each time point). Data are mean ± SEM. ** p < 0.01 versus intact, Dunnett's t test. (F) Quantitative analysis of the myofibers surrounded by CSPG4 in sections from BPVC‐injected regenerating TA muscles ( n = 4 at each time point). Data are mean ± SEM. ** p < 0.01 versus intact, Dunnett's t test. (G) Representative image of in situ hybridization for Cspg4 <t>mRNA</t> of BPVC‐injected regenerating TA muscle. Regenerating myofibers are surrounded by dotted white lines. Scale bar = 50 μm. White arrowheads, Cspg4 mRNA expressed inside myofibers.
    Mrna Modified With 5 Methoxyuridine (5mou) And Coding For Mcherry, supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+mrna/firefly+luciferase+mrna/us12331264-1359-8-14
    Average 90 stars, based on 1 article reviews
    mrna modified with 5-methoxyuridine (5mou) and coding for mcherry - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    cleancap® mcherry mrna containing 5-methoxyuridine base modifications  (TriLink)
    90
    TriLink cleancap® mcherry mrna containing 5-methoxyuridine base modifications
    CSPG4 expression in skeletal muscle of the rats. (A) Representative image of immunostaining for CSPG4 and laminin of TA muscles from WT rats. White arrow, blood vessel. Black arrow, perineurium. White arrowheads, CSPG4‐positive mononucleated stromal cells. Scale bar = 100 μm (upper) and 20 μm (lower), respectively. (B) Representative image of immunostaining for CSPG4 and laminin of TA muscles from DMD rats. White arrowheads, CSPG4‐positive cells on the outer side of the basement membrane. Black arrowheads, CSPG4‐positive cells on the inner side of the basement membrane. White arrow, regenerating myofiber surrounded by CSPG4. Scale bars = 100 μm (upper) and 20 μm (lower), respectively. (C) Quantitative analysis of CSPG4‐positive mononuclear cells inside and outside of myofibers in sections from WT ( n = 3) and DMD rats ( n = 10). Data are mean ± SEM. ** p < 0.01, unpaired Student's t test. (D) Representative image of immunostaining for CSPG4 and laminin of BPVC‐injected regenerating TA muscles. White arrowheads, CSPG4‐positive cells on the outer side of the basement membrane. Black arrowheads, CSPG4‐positive cells on the inner side of the basement membrane. White arrow, regenerating myofiber surrounded by CSPG4. Scale bar = 100 μm. (E) Quantitative analysis of CSPG4‐positive mononuclear stromal cells in sections from BPVC‐injected regenerating TA muscles ( n = 4 at each time point). Data are mean ± SEM. ** p < 0.01 versus intact, Dunnett's t test. (F) Quantitative analysis of the myofibers surrounded by CSPG4 in sections from BPVC‐injected regenerating TA muscles ( n = 4 at each time point). Data are mean ± SEM. ** p < 0.01 versus intact, Dunnett's t test. (G) Representative image of in situ hybridization for Cspg4 <t>mRNA</t> of BPVC‐injected regenerating TA muscle. Regenerating myofibers are surrounded by dotted white lines. Scale bar = 50 μm. White arrowheads, Cspg4 mRNA expressed inside myofibers.
    Cleancap® Mcherry Mrna Containing 5 Methoxyuridine Base Modifications, supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+mrna/mcherry+mrna/pmc12122926-193-18-24
    Average 90 stars, based on 1 article reviews
    cleancap® mcherry mrna containing 5-methoxyuridine base modifications - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    cleancap mcherry-mrna  (TriLink)
    90
    TriLink cleancap mcherry-mrna
    CSPG4 expression in skeletal muscle of the rats. (A) Representative image of immunostaining for CSPG4 and laminin of TA muscles from WT rats. White arrow, blood vessel. Black arrow, perineurium. White arrowheads, CSPG4‐positive mononucleated stromal cells. Scale bar = 100 μm (upper) and 20 μm (lower), respectively. (B) Representative image of immunostaining for CSPG4 and laminin of TA muscles from DMD rats. White arrowheads, CSPG4‐positive cells on the outer side of the basement membrane. Black arrowheads, CSPG4‐positive cells on the inner side of the basement membrane. White arrow, regenerating myofiber surrounded by CSPG4. Scale bars = 100 μm (upper) and 20 μm (lower), respectively. (C) Quantitative analysis of CSPG4‐positive mononuclear cells inside and outside of myofibers in sections from WT ( n = 3) and DMD rats ( n = 10). Data are mean ± SEM. ** p < 0.01, unpaired Student's t test. (D) Representative image of immunostaining for CSPG4 and laminin of BPVC‐injected regenerating TA muscles. White arrowheads, CSPG4‐positive cells on the outer side of the basement membrane. Black arrowheads, CSPG4‐positive cells on the inner side of the basement membrane. White arrow, regenerating myofiber surrounded by CSPG4. Scale bar = 100 μm. (E) Quantitative analysis of CSPG4‐positive mononuclear stromal cells in sections from BPVC‐injected regenerating TA muscles ( n = 4 at each time point). Data are mean ± SEM. ** p < 0.01 versus intact, Dunnett's t test. (F) Quantitative analysis of the myofibers surrounded by CSPG4 in sections from BPVC‐injected regenerating TA muscles ( n = 4 at each time point). Data are mean ± SEM. ** p < 0.01 versus intact, Dunnett's t test. (G) Representative image of in situ hybridization for Cspg4 <t>mRNA</t> of BPVC‐injected regenerating TA muscle. Regenerating myofibers are surrounded by dotted white lines. Scale bar = 50 μm. White arrowheads, Cspg4 mRNA expressed inside myofibers.
    Cleancap Mcherry Mrna, supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+mrna/mcherry+mrna/pm40437895-133-10-12
    Average 90 stars, based on 1 article reviews
    cleancap mcherry-mrna - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    CSPG4 expression in skeletal muscle of the rats. (A) Representative image of immunostaining for CSPG4 and laminin of TA muscles from WT rats. White arrow, blood vessel. Black arrow, perineurium. White arrowheads, CSPG4‐positive mononucleated stromal cells. Scale bar = 100 μm (upper) and 20 μm (lower), respectively. (B) Representative image of immunostaining for CSPG4 and laminin of TA muscles from DMD rats. White arrowheads, CSPG4‐positive cells on the outer side of the basement membrane. Black arrowheads, CSPG4‐positive cells on the inner side of the basement membrane. White arrow, regenerating myofiber surrounded by CSPG4. Scale bars = 100 μm (upper) and 20 μm (lower), respectively. (C) Quantitative analysis of CSPG4‐positive mononuclear cells inside and outside of myofibers in sections from WT ( n = 3) and DMD rats ( n = 10). Data are mean ± SEM. ** p < 0.01, unpaired Student's t test. (D) Representative image of immunostaining for CSPG4 and laminin of BPVC‐injected regenerating TA muscles. White arrowheads, CSPG4‐positive cells on the outer side of the basement membrane. Black arrowheads, CSPG4‐positive cells on the inner side of the basement membrane. White arrow, regenerating myofiber surrounded by CSPG4. Scale bar = 100 μm. (E) Quantitative analysis of CSPG4‐positive mononuclear stromal cells in sections from BPVC‐injected regenerating TA muscles ( n = 4 at each time point). Data are mean ± SEM. ** p < 0.01 versus intact, Dunnett's t test. (F) Quantitative analysis of the myofibers surrounded by CSPG4 in sections from BPVC‐injected regenerating TA muscles ( n = 4 at each time point). Data are mean ± SEM. ** p < 0.01 versus intact, Dunnett's t test. (G) Representative image of in situ hybridization for Cspg4 mRNA of BPVC‐injected regenerating TA muscle. Regenerating myofibers are surrounded by dotted white lines. Scale bar = 50 μm. White arrowheads, Cspg4 mRNA expressed inside myofibers.

    Journal: Animal Science Journal = Nihon Chikusan Gakkaiho

    Article Title: Possible Involvement of CSPG4 in Promoting Endothelial Cell Migration and Contributing to Angiogenesis during Skeletal Muscle Regeneration and Development in the Rat

    doi: 10.1111/asj.70097

    Figure Lengend Snippet: CSPG4 expression in skeletal muscle of the rats. (A) Representative image of immunostaining for CSPG4 and laminin of TA muscles from WT rats. White arrow, blood vessel. Black arrow, perineurium. White arrowheads, CSPG4‐positive mononucleated stromal cells. Scale bar = 100 μm (upper) and 20 μm (lower), respectively. (B) Representative image of immunostaining for CSPG4 and laminin of TA muscles from DMD rats. White arrowheads, CSPG4‐positive cells on the outer side of the basement membrane. Black arrowheads, CSPG4‐positive cells on the inner side of the basement membrane. White arrow, regenerating myofiber surrounded by CSPG4. Scale bars = 100 μm (upper) and 20 μm (lower), respectively. (C) Quantitative analysis of CSPG4‐positive mononuclear cells inside and outside of myofibers in sections from WT ( n = 3) and DMD rats ( n = 10). Data are mean ± SEM. ** p < 0.01, unpaired Student's t test. (D) Representative image of immunostaining for CSPG4 and laminin of BPVC‐injected regenerating TA muscles. White arrowheads, CSPG4‐positive cells on the outer side of the basement membrane. Black arrowheads, CSPG4‐positive cells on the inner side of the basement membrane. White arrow, regenerating myofiber surrounded by CSPG4. Scale bar = 100 μm. (E) Quantitative analysis of CSPG4‐positive mononuclear stromal cells in sections from BPVC‐injected regenerating TA muscles ( n = 4 at each time point). Data are mean ± SEM. ** p < 0.01 versus intact, Dunnett's t test. (F) Quantitative analysis of the myofibers surrounded by CSPG4 in sections from BPVC‐injected regenerating TA muscles ( n = 4 at each time point). Data are mean ± SEM. ** p < 0.01 versus intact, Dunnett's t test. (G) Representative image of in situ hybridization for Cspg4 mRNA of BPVC‐injected regenerating TA muscle. Regenerating myofibers are surrounded by dotted white lines. Scale bar = 50 μm. White arrowheads, Cspg4 mRNA expressed inside myofibers.

    Article Snippet: A plasmid for Cas9 mRNA and gRNA was created by ligation of 5′‐ ATCTTGTGGAAAGGACGAAACACCGGCCAGGGCTGGAGCTGACAGGTTTTAGAGCTAGAAATAGCAAGTT‐3′ to pU6‐(BbsI)_CBh‐Cas9‐T2A‐mCherry (#64324; Addgene, MA, USA) after restriction enzyme treatment by BbsI .

    Techniques: Expressing, Immunostaining, Muscles, Membrane, Injection, In Situ Hybridization