plenticrispr v2 vector (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
plenticrispr v2 vector
Plenticrispr V2 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 6191 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lenticrispr+vector/lentiCRISPR+v2+(Plasmid+%2352961)/pm42844288-314-9-12
Average 96 stars, based on 6191 article reviews
Plenticrispr V2 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 6191 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lenticrispr+vector/lentiCRISPR+v2+(Plasmid+%2352961)/pm42844288-314-9-12
Average 96 stars, based on 6191 article reviews
plenticrispr v2 vector - by Bioz Stars,
2026-10
96/100 stars
Images
Related Articles
Clone Assay:Article Title: Increased mRNA translation delays lung adenocarcinoma initiation and exposes a therapeutic vulnerability to MEK inhibitors Article Snippet: For Western blots, the following antibodies were used at a dilution of 1:1000: eIF4A1 (abcam 31217), eIF4A2 (abcam 31218), pmTORC1 (Cell signalling 2971), pPERK (cell signalling 3179), ATF4 (Cell signalling 11815), pAKT (Cell signalling 3787), pERK1/2 (Cell signalling 9106), ERK1/2 (Sigma M5670) GAPDH (Sigma G8795), β-actin (Sigma A1978), p21 (Abcam ab107099), p16 (Abcam ab211542) .. Guide RNA (gRNA) sequences targeting Eif4a2 were cloned into a Article Title: Uridine phosphorylase-1 supports metastasis by altering immune and extracellular matrix landscapes Article Snippet: .. Guide RNA (gRNA) sequences were designed to target Upp1 (mUPP1 Guide 1 F: CACCGCACCAACCTGGACGCGCAGC; mUPP1 Guide 1R: AAACGCTGCGCGTCCAGGTTGGTGC), and cloned into a Article Title: Metabolic adaptations of micrometastases alter EV production to generate invasive microenvironments. Article Snippet: .. Generation of nSMase and Rab27 CRISPR cells gRNA sequences targeting neutral sphingomyelinases 1 and 2 and Rab27s a and b were cloned into a Article Title: Metabolic adaptations of micrometastases alter EV production to generate invasive microenvironments Article Snippet: .. Guide RNA (gRNA) sequences targeting neutral sphingomyelinases 1 & 2 and Rab27s a and b were cloned into a Article Title: Metabolic adaptations of micrometastases alter EV production to generate invasive microenvironments Article Snippet: .. gRNA sequences targeting neutral sphingomyelinases 1 and 2 and Rab27s a and b were cloned into a Plasmid Preparation:Article Title: Increased mRNA translation delays lung adenocarcinoma initiation and exposes a therapeutic vulnerability to MEK inhibitors Article Snippet: For Western blots, the following antibodies were used at a dilution of 1:1000: eIF4A1 (abcam 31217), eIF4A2 (abcam 31218), pmTORC1 (Cell signalling 2971), pPERK (cell signalling 3179), ATF4 (Cell signalling 11815), pAKT (Cell signalling 3787), pERK1/2 (Cell signalling 9106), ERK1/2 (Sigma M5670) GAPDH (Sigma G8795), β-actin (Sigma A1978), p21 (Abcam ab107099), p16 (Abcam ab211542) .. Guide RNA (gRNA) sequences targeting Eif4a2 were cloned into a Article Title: Uridine phosphorylase-1 supports metastasis by altering immune and extracellular matrix landscapes Article Snippet: .. Guide RNA (gRNA) sequences were designed to target Upp1 (mUPP1 Guide 1 F: CACCGCACCAACCTGGACGCGCAGC; mUPP1 Guide 1R: AAACGCTGCGCGTCCAGGTTGGTGC), and cloned into a Article Title: Metabolic adaptations of micrometastases alter EV production to generate invasive microenvironments. Article Snippet: .. Generation of nSMase and Rab27 CRISPR cells gRNA sequences targeting neutral sphingomyelinases 1 and 2 and Rab27s a and b were cloned into a Article Title: Uridine phosphorylase-1 supports metastasis by altering immune and extracellular matrix landscapes Article Snippet: Recombinant DNA , , . .. Article Title: Metabolic adaptations of micrometastases alter EV production to generate invasive microenvironments Article Snippet: .. Guide RNA (gRNA) sequences targeting neutral sphingomyelinases 1 & 2 and Rab27s a and b were cloned into a Article Title: Mifepristone protects acetaminophen induced liver injury through NRF2/GSH/GST mediated ferroptosis suppression. Article Snippet: Ferroptosis is a form of iron-dependent cell death that has attracted significant attention for its potential role in numerous diseases.. Targeted inhibition of ferroptosis could be of potential use in treating diseases: such as drug induced liver injury (DILI).. Ferroptosis can be antagonized by the xCT/GSH/GPX4, FSP1/CoQ10, DHODH/CoQ10, GCH1/BH4, and NRF2 pathways. Article Title: Metabolic adaptations of micrometastases alter EV production to generate invasive microenvironments Article Snippet: .. gRNA sequences targeting neutral sphingomyelinases 1 and 2 and Rab27s a and b were cloned into a CRISPR:Article Title: Metabolic adaptations of micrometastases alter EV production to generate invasive microenvironments. Article Snippet: .. Generation of nSMase and Rab27 CRISPR cells gRNA sequences targeting neutral sphingomyelinases 1 and 2 and Rab27s a and b were cloned into a Knock-Out:Article Title: Tuning Insulin Receptor Signaling Using De Novo Designed Agonists Article Snippet: Cells were selected with 2 mg/ml of puromycin at 3 days after infection and sorted using FACS sorter (Sony Ma900). .. To generate IGF1R knockout C2C12 cells expressing human IR-A (C2C12-IR), lentiviruses were packaged in 293FT cells by transfecting the cells with Expressing:Article Title: Tuning Insulin Receptor Signaling Using De Novo Designed Agonists Article Snippet: Cells were selected with 2 mg/ml of puromycin at 3 days after infection and sorted using FACS sorter (Sony Ma900). .. To generate IGF1R knockout C2C12 cells expressing human IR-A (C2C12-IR), lentiviruses were packaged in 293FT cells by transfecting the cells with |