Review



lac z vector  (Vector Laboratories)


Bioz Verified Symbol Vector Laboratories is a verified supplier
Bioz Manufacturer Symbol Vector Laboratories manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Vector Laboratories lac z vector
    Lac Z Vector, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 93/100, based on 155 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lac+z+vector/lactose/pmc12860646-68-12-14
    Average 93 stars, based on 155 article reviews
    lac z vector - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Stable Transfection:

    Article Title: Autocrine differentiation of PC12 cells mediated by retroviral vectors.
    Article Snippet: Rat pheochromocytoma PC12 cells have been modified genetically by the use of replication-defective retroviral vectors containing either the bacterial gene for p-galactosidase {lac Z) or cDNAs for mouse p-nerve growth factor (NGF) and the bacterial gene for neomycin resistance.. Using the lac Z vector, clonal lines of PC12 cells were obtained in which almost 100% of cells stably expressed this histochemical marker.. Infection of PCI2 cells or the derived subclone PC12-BAG, which expresses p-galactosidase, with the NGF vectors resulted in autocrine differentiation as assessed by extensive neurite formation, which occurred within hours after infection and was maintained for weeks in culture.

    Marker:

    Article Title: Autocrine differentiation of PC12 cells mediated by retroviral vectors.
    Article Snippet: Rat pheochromocytoma PC12 cells have been modified genetically by the use of replication-defective retroviral vectors containing either the bacterial gene for p-galactosidase {lac Z) or cDNAs for mouse p-nerve growth factor (NGF) and the bacterial gene for neomycin resistance.. Using the lac Z vector, clonal lines of PC12 cells were obtained in which almost 100% of cells stably expressed this histochemical marker.. Infection of PCI2 cells or the derived subclone PC12-BAG, which expresses p-galactosidase, with the NGF vectors resulted in autocrine differentiation as assessed by extensive neurite formation, which occurred within hours after infection and was maintained for weeks in culture.

    Sequencing:

    Article Title: Usage of nanobody-beta-galactosidase fusion in immunoassays and its application in detecting a peanut allergen
    Article Snippet: .. The coding sequence of E. coli β-gal in the pcDNA3.1/ myc -His(−)/ lac Z vector (Invitrogen Carlsbad, CA, USA) was amplified by PCR using primers cgaatccacgtgatagatcccgtcgttttacaa (forward, with Pml I site) and cgaatcctcgagtttttgacaccagaccaact (reverse, with Xho I site). ..

    Amplification:

    Article Title: Usage of nanobody-beta-galactosidase fusion in immunoassays and its application in detecting a peanut allergen
    Article Snippet: .. The coding sequence of E. coli β-gal in the pcDNA3.1/ myc -His(−)/ lac Z vector (Invitrogen Carlsbad, CA, USA) was amplified by PCR using primers cgaatccacgtgatagatcccgtcgttttacaa (forward, with Pml I site) and cgaatcctcgagtttttgacaccagaccaact (reverse, with Xho I site). ..

    Polymerase Chain Reaction:

    Article Title: Usage of nanobody-beta-galactosidase fusion in immunoassays and its application in detecting a peanut allergen
    Article Snippet: .. The coding sequence of E. coli β-gal in the pcDNA3.1/ myc -His(−)/ lac Z vector (Invitrogen Carlsbad, CA, USA) was amplified by PCR using primers cgaatccacgtgatagatcccgtcgttttacaa (forward, with Pml I site) and cgaatcctcgagtttttgacaccagaccaact (reverse, with Xho I site). ..



    Similar Products

    lac z vector  (Vector Laboratories)
    93
    Vector Laboratories lac z vector
    Lac Z Vector, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lac+z+vector/lactose/pmc12860646-68-12-14
    Average 93 stars, based on 1 article reviews
    lac z vector - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    hsp 68 lac z vector  (Addgene inc)
    93
    Addgene inc hsp 68 lac z vector
    Hsp 68 Lac Z Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lac+z+vector/Hsp68-LacZ-Gateway+(Plasmid+%2337843)/pm29543231-67-27-31
    Average 93 stars, based on 1 article reviews
    hsp 68 lac z vector - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    recombinant adenoviral (rad) vectors carrying either the escherichia coli lacz gene (rad-lac-z)  (Regeneron inc)
    90
    Regeneron inc recombinant adenoviral (rad) vectors carrying either the escherichia coli lacz gene (rad-lac-z)
    PPS did not affect the expression of metalloproteinases or VEGF-A in the intestine of mice infected with <t>rAd-LacZ.</t> A: representative pictures of the Western blots done with samples derived from the small intestinal of mice infected with rAd-LacZ vectors and treated with PPS (60 mg/kg) or phosphate-buffered saline (PBS). Only the intestinal expression of ICAM-1 was significantly increased in mice treated with rAd-LacZ + PPS relative to the control mice infected with rAd-LacZ (*P < 0.05; n = 6 samples per group). B: the densitometric analysis corresponding to the Western blots. Results are expressed in arbitrary optical density units as ratio of the beta-actin expression (means ± SE). Samples from 6 different mice were included in each group.
    Recombinant Adenoviral (Rad) Vectors Carrying Either The Escherichia Coli Lacz Gene (Rad Lac Z), supplied by Regeneron inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lac+z+vector/recombinant+adenoviral++rad++vectors+carrying+either+the+escherichia+coli+lacz+gene++rad+lac+z+/pmc04666966-43-8-35
    Average 90 stars, based on 1 article reviews
    recombinant adenoviral (rad) vectors carrying either the escherichia coli lacz gene (rad-lac-z) - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    aav1-cmv-lac z vector  (Agilent technologies)
    90
    Agilent technologies aav1-cmv-lac z vector
    PPS did not affect the expression of metalloproteinases or VEGF-A in the intestine of mice infected with <t>rAd-LacZ.</t> A: representative pictures of the Western blots done with samples derived from the small intestinal of mice infected with rAd-LacZ vectors and treated with PPS (60 mg/kg) or phosphate-buffered saline (PBS). Only the intestinal expression of ICAM-1 was significantly increased in mice treated with rAd-LacZ + PPS relative to the control mice infected with rAd-LacZ (*P < 0.05; n = 6 samples per group). B: the densitometric analysis corresponding to the Western blots. Results are expressed in arbitrary optical density units as ratio of the beta-actin expression (means ± SE). Samples from 6 different mice were included in each group.
    Aav1 Cmv Lac Z Vector, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lac+z+vector/pm24136735-46-4-21
    Average 90 stars, based on 1 article reviews
    aav1-cmv-lac z vector - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    lentiviral vectors carrying a cmv-driven lac z gene  (Thermo Fisher)
    90
    Thermo Fisher lentiviral vectors carrying a cmv-driven lac z gene
    PPS did not affect the expression of metalloproteinases or VEGF-A in the intestine of mice infected with <t>rAd-LacZ.</t> A: representative pictures of the Western blots done with samples derived from the small intestinal of mice infected with rAd-LacZ vectors and treated with PPS (60 mg/kg) or phosphate-buffered saline (PBS). Only the intestinal expression of ICAM-1 was significantly increased in mice treated with rAd-LacZ + PPS relative to the control mice infected with rAd-LacZ (*P < 0.05; n = 6 samples per group). B: the densitometric analysis corresponding to the Western blots. Results are expressed in arbitrary optical density units as ratio of the beta-actin expression (means ± SE). Samples from 6 different mice were included in each group.
    Lentiviral Vectors Carrying A Cmv Driven Lac Z Gene, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lac+z+vector/lentiviral+vectors+carrying+a+cmv+driven+lac+z+gene/pm25924802-43-19-52
    Average 90 stars, based on 1 article reviews
    lentiviral vectors carrying a cmv-driven lac z gene - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    the psv-b-gal control vector containing sv40 early promoter and enhancer driver transcription of the lac z gene, which encodes the b-gal enzyme  (Promega)
    90
    Promega the psv-b-gal control vector containing sv40 early promoter and enhancer driver transcription of the lac z gene, which encodes the b-gal enzyme
    PPS did not affect the expression of metalloproteinases or VEGF-A in the intestine of mice infected with <t>rAd-LacZ.</t> A: representative pictures of the Western blots done with samples derived from the small intestinal of mice infected with rAd-LacZ vectors and treated with PPS (60 mg/kg) or phosphate-buffered saline (PBS). Only the intestinal expression of ICAM-1 was significantly increased in mice treated with rAd-LacZ + PPS relative to the control mice infected with rAd-LacZ (*P < 0.05; n = 6 samples per group). B: the densitometric analysis corresponding to the Western blots. Results are expressed in arbitrary optical density units as ratio of the beta-actin expression (means ± SE). Samples from 6 different mice were included in each group.
    The Psv B Gal Control Vector Containing Sv40 Early Promoter And Enhancer Driver Transcription Of The Lac Z Gene, Which Encodes The B Gal Enzyme, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lac+z+vector/pgl3+basic/pm20180684-41-20-25
    Average 90 stars, based on 1 article reviews
    the psv-b-gal control vector containing sv40 early promoter and enhancer driver transcription of the lac z gene, which encodes the b-gal enzyme - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    pcdna3.1 vector containing he lac-z gene  (Thermo Fisher)
    90
    Thermo Fisher pcdna3.1 vector containing he lac-z gene
    PPS did not affect the expression of metalloproteinases or VEGF-A in the intestine of mice infected with <t>rAd-LacZ.</t> A: representative pictures of the Western blots done with samples derived from the small intestinal of mice infected with rAd-LacZ vectors and treated with PPS (60 mg/kg) or phosphate-buffered saline (PBS). Only the intestinal expression of ICAM-1 was significantly increased in mice treated with rAd-LacZ + PPS relative to the control mice infected with rAd-LacZ (*P < 0.05; n = 6 samples per group). B: the densitometric analysis corresponding to the Western blots. Results are expressed in arbitrary optical density units as ratio of the beta-actin expression (means ± SE). Samples from 6 different mice were included in each group.
    Pcdna3.1 Vector Containing He Lac Z Gene, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lac+z+vector/pm17320573-25-7-9
    Average 90 stars, based on 1 article reviews
    pcdna3.1 vector containing he lac-z gene - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    lac z expression vector  (Vector Laboratories)
    93
    Vector Laboratories lac z expression vector
    PPS did not affect the expression of metalloproteinases or VEGF-A in the intestine of mice infected with <t>rAd-LacZ.</t> A: representative pictures of the Western blots done with samples derived from the small intestinal of mice infected with rAd-LacZ vectors and treated with PPS (60 mg/kg) or phosphate-buffered saline (PBS). Only the intestinal expression of ICAM-1 was significantly increased in mice treated with rAd-LacZ + PPS relative to the control mice infected with rAd-LacZ (*P < 0.05; n = 6 samples per group). B: the densitometric analysis corresponding to the Western blots. Results are expressed in arbitrary optical density units as ratio of the beta-actin expression (means ± SE). Samples from 6 different mice were included in each group.
    Lac Z Expression Vector, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lac+z+vector/lactose/pm15877050-68-39-42
    Average 93 stars, based on 1 article reviews
    lac z expression vector - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    pclmfg-lac z vector (retro max system  (Novus Biologicals)
    90
    Novus Biologicals pclmfg-lac z vector (retro max system
    PPS did not affect the expression of metalloproteinases or VEGF-A in the intestine of mice infected with <t>rAd-LacZ.</t> A: representative pictures of the Western blots done with samples derived from the small intestinal of mice infected with rAd-LacZ vectors and treated with PPS (60 mg/kg) or phosphate-buffered saline (PBS). Only the intestinal expression of ICAM-1 was significantly increased in mice treated with rAd-LacZ + PPS relative to the control mice infected with rAd-LacZ (*P < 0.05; n = 6 samples per group). B: the densitometric analysis corresponding to the Western blots. Results are expressed in arbitrary optical density units as ratio of the beta-actin expression (means ± SE). Samples from 6 different mice were included in each group.
    Pclmfg Lac Z Vector (Retro Max System, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lac+z+vector/pclmfg+lac+z+vector++retro+max+system/pm12554804-38-9-15
    Average 90 stars, based on 1 article reviews
    pclmfg-lac z vector (retro max system - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    lac z b galactosidase cdna  (TaKaRa)
    93
    TaKaRa lac z b galactosidase cdna
    PPS did not affect the expression of metalloproteinases or VEGF-A in the intestine of mice infected with <t>rAd-LacZ.</t> A: representative pictures of the Western blots done with samples derived from the small intestinal of mice infected with rAd-LacZ vectors and treated with PPS (60 mg/kg) or phosphate-buffered saline (PBS). Only the intestinal expression of ICAM-1 was significantly increased in mice treated with rAd-LacZ + PPS relative to the control mice infected with rAd-LacZ (*P < 0.05; n = 6 samples per group). B: the densitometric analysis corresponding to the Western blots. Results are expressed in arbitrary optical density units as ratio of the beta-actin expression (means ± SE). Samples from 6 different mice were included in each group.
    Lac Z B Galactosidase Cdna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lac+z+vector/pCMV-LacZ+Vector/pm10940489-42-6-16
    Average 93 stars, based on 1 article reviews
    lac z b galactosidase cdna - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    PPS did not affect the expression of metalloproteinases or VEGF-A in the intestine of mice infected with rAd-LacZ. A: representative pictures of the Western blots done with samples derived from the small intestinal of mice infected with rAd-LacZ vectors and treated with PPS (60 mg/kg) or phosphate-buffered saline (PBS). Only the intestinal expression of ICAM-1 was significantly increased in mice treated with rAd-LacZ + PPS relative to the control mice infected with rAd-LacZ (*P < 0.05; n = 6 samples per group). B: the densitometric analysis corresponding to the Western blots. Results are expressed in arbitrary optical density units as ratio of the beta-actin expression (means ± SE). Samples from 6 different mice were included in each group.

    Journal: American Journal of Physiology - Heart and Circulatory Physiology

    Article Title: Angiopoietin-1 prevents severe bleeding complications induced by heparin-like drugs and fibroblast growth factor-2 in mice

    doi: 10.1152/ajpheart.00373.2015

    Figure Lengend Snippet: PPS did not affect the expression of metalloproteinases or VEGF-A in the intestine of mice infected with rAd-LacZ. A: representative pictures of the Western blots done with samples derived from the small intestinal of mice infected with rAd-LacZ vectors and treated with PPS (60 mg/kg) or phosphate-buffered saline (PBS). Only the intestinal expression of ICAM-1 was significantly increased in mice treated with rAd-LacZ + PPS relative to the control mice infected with rAd-LacZ (*P < 0.05; n = 6 samples per group). B: the densitometric analysis corresponding to the Western blots. Results are expressed in arbitrary optical density units as ratio of the beta-actin expression (means ± SE). Samples from 6 different mice were included in each group.

    Article Snippet: Recombinant adenoviral (rAd) vectors. rAd-vectors carrying either the Escherichia coli LacZ gene (rAd-Lac-Z), a 700-bp cDNA sequence encoding a secreted form of human recombinant FGF-2 (rAd-FGF-2), or a genetically modified form of angiopoietin-1 (Ang-1*) from Regeneron Pharm (Tarrytown, NY), were generated, amplified, and purified as previously described ( 13 , 21 , 44 , 50 ).

    Techniques: Expressing, Infection, Western Blot, Derivative Assay, Saline, Control