|
Addgene inc
24x ms2v6 cassettes ![]() 24x Ms2v6 Cassettes, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/24x ms2v6 cassettes/product/Addgene inc Average 93 stars, based on 1 article reviews
24x ms2v6 cassettes - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Addgene inc
12x msv6 ![]() 12x Msv6, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/12x msv6/product/Addgene inc Average 93 stars, based on 1 article reviews
12x msv6 - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Addgene inc
k shearwin ![]() K Shearwin, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/k shearwin/product/Addgene inc Average 92 stars, based on 1 article reviews
k shearwin - by Bioz Stars,
2026-04
92/100 stars
|
Buy from Supplier |
|
Addgene inc
pgex6p1 ha mek5 kanr ![]() Pgex6p1 Ha Mek5 Kanr, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgex6p1 ha mek5 kanr/product/Addgene inc Average 93 stars, based on 1 article reviews
pgex6p1 ha mek5 kanr - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Addgene inc
addgene plasmid ![]() Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/addgene plasmid/product/Addgene inc Average 93 stars, based on 1 article reviews
addgene plasmid - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Addgene inc
plasmid pjet1 2 kanr cassette ![]() Plasmid Pjet1 2 Kanr Cassette, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plasmid pjet1 2 kanr cassette/product/Addgene inc Average 93 stars, based on 1 article reviews
plasmid pjet1 2 kanr cassette - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Addgene inc
acgatcgtggccccggaaaagg acc r ![]() Acgatcgtggccccggaaaagg Acc R, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/acgatcgtggccccggaaaagg acc r/product/Addgene inc Average 93 stars, based on 1 article reviews
acgatcgtggccccggaaaagg acc r - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Addgene inc
cacaaacttgaacagctacgga r ![]() Cacaaacttgaacagctacgga R, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cacaaacttgaacagctacgga r/product/Addgene inc Average 93 stars, based on 1 article reviews
cacaaacttgaacagctacgga r - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Addgene inc
ccccagggccccattttggtacc r ![]() Ccccagggccccattttggtacc R, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ccccagggccccattttggtacc r/product/Addgene inc Average 93 stars, based on 1 article reviews
ccccagggccccattttggtacc r - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
Journal: bioRxiv
Article Title: Establishing MS2-MCP-based single-molecule RNA visualization in Schizosaccharomyces pombe
doi: 10.64898/2026.03.09.710516
Figure Lengend Snippet: (A) Vectors to append homology regions upstream and downstream of the MS2V6 repeats; vc591 (24x MS2V6) and vc592 (12x MS2V6) are slightly modified versions of Addgene plasmids # 104393 and # 104392 (Tutucci et al., Nat Methods 2017). An EcoRI site was added downstream of the MS2V6 repeats. Homology regions can be integrated at the BamHI, EcoRI, and XhoI sites. (B,C,D) Strategies to integrate the 12-24x MS2V6 repeats into the genome: (B) CRISPR/Cas9-facilitated integration without resistance gene; (C) replacement of a counterselectable cassette, e.g. when working with a non-essential gene; (D) integration using the kanMX resistance gene present on the vector.
Article Snippet: The vectors containing 12x MSV6 (pET251-pUC 12xMS2V6 Loxp KANr Loxp, Addgene plasmid # 104392) and
Techniques: Modification, CRISPR, Plasmid Preparation
Journal: bioRxiv
Article Title: Establishing MS2-MCP-based single-molecule RNA visualization in Schizosaccharomyces pombe
doi: 10.64898/2026.03.09.710516
Figure Lengend Snippet: (A) The mad2 gene was tagged in the 3’UTR with 24x MS2V6, and MCP-tdSG was expressed from different promoters. (B) Short kymographs from live-cell imaging; longer sequences are shown in Fig. S3. For each MCP-tdSG construct, a strain without integration of MS2 repeats is shown as control. Far left: strain expressing mad2 -24xMS2, but no MCP-tdSG. Images are maximum intensity projections of the Z-stack. Note the different scaling setting for P.cdc2.short-MCP-tdSG. (C) Quantification of the maximum spot intensity over maximum background intensity. Two replicates per strain, 56-162 spots per replicate. Points: individual spots; box plot: summary statistics (center line, median; box boundaries, 1st and 3rd quartiles). (D) The cdc13 gene was internally tagged with circularly permuted superfolder GFP (sfGFPcp) and 12x or 24x MS2V6 cassettes were inserted in the 3’UTR. The construct was expressed under endogenous cdc13 regulatory sequences (promoter, terminator) from the leu1 locus. MCP-tdSG was expressed from the mad3 promoter. (E) Schematic illustrating Cdc13 protein localization. Cdc13 accumulates during interphase and is strongly enriched in the nucleus. Cdc13 localizes to spindle pole bodies and the spindle during early mitosis and becomes degraded at the metaphase-to-anaphase transition. (F,G) Kymographs from live-cell imaging of cells undergoing mitosis; cdc13 -sfGFP tagged with either 24x MS2V6 (F) or 12x MS2V6 (G). A strain without MS2 repeats is shown as control. Images were recorded every 5 sec (F) or 12 sec (G); every second image (every 10 sec, F) or every 10 th image (every 2 min, G) is shown. Images are maximum intensity projections of the Z-stack. (H) Similar to (G), but showing an interphase cell; loss of the nuclear sfGFPcp signal is due to photobleaching, not degradation.
Article Snippet: The vectors containing 12x MSV6 (pET251-pUC 12xMS2V6 Loxp KANr Loxp, Addgene plasmid # 104392) and
Techniques: Live Cell Imaging, Construct, Control, Expressing
Journal: bioRxiv
Article Title: Establishing MS2-MCP-based single-molecule RNA visualization in Schizosaccharomyces pombe
doi: 10.64898/2026.03.09.710516
Figure Lengend Snippet: (A) Vectors to append homology regions upstream and downstream of the MS2V6 repeats; vc591 (24x MS2V6) and vc592 (12x MS2V6) are slightly modified versions of Addgene plasmids # 104393 and # 104392 (Tutucci et al., Nat Methods 2017). An EcoRI site was added downstream of the MS2V6 repeats. Homology regions can be integrated at the BamHI, EcoRI, and XhoI sites. (B,C,D) Strategies to integrate the 12-24x MS2V6 repeats into the genome: (B) CRISPR/Cas9-facilitated integration without resistance gene; (C) replacement of a counterselectable cassette, e.g. when working with a non-essential gene; (D) integration using the kanMX resistance gene present on the vector.
Article Snippet: The vectors containing
Techniques: Modification, CRISPR, Plasmid Preparation
Journal: bioRxiv
Article Title: Establishing MS2-MCP-based single-molecule RNA visualization in Schizosaccharomyces pombe
doi: 10.64898/2026.03.09.710516
Figure Lengend Snippet: (A) The mad2 gene was tagged in the 3’UTR with 24x MS2V6, and MCP-tdSG was expressed from different promoters. (B) Short kymographs from live-cell imaging; longer sequences are shown in Fig. S3. For each MCP-tdSG construct, a strain without integration of MS2 repeats is shown as control. Far left: strain expressing mad2 -24xMS2, but no MCP-tdSG. Images are maximum intensity projections of the Z-stack. Note the different scaling setting for P.cdc2.short-MCP-tdSG. (C) Quantification of the maximum spot intensity over maximum background intensity. Two replicates per strain, 56-162 spots per replicate. Points: individual spots; box plot: summary statistics (center line, median; box boundaries, 1st and 3rd quartiles). (D) The cdc13 gene was internally tagged with circularly permuted superfolder GFP (sfGFPcp) and 12x or 24x MS2V6 cassettes were inserted in the 3’UTR. The construct was expressed under endogenous cdc13 regulatory sequences (promoter, terminator) from the leu1 locus. MCP-tdSG was expressed from the mad3 promoter. (E) Schematic illustrating Cdc13 protein localization. Cdc13 accumulates during interphase and is strongly enriched in the nucleus. Cdc13 localizes to spindle pole bodies and the spindle during early mitosis and becomes degraded at the metaphase-to-anaphase transition. (F,G) Kymographs from live-cell imaging of cells undergoing mitosis; cdc13 -sfGFP tagged with either 24x MS2V6 (F) or 12x MS2V6 (G). A strain without MS2 repeats is shown as control. Images were recorded every 5 sec (F) or 12 sec (G); every second image (every 10 sec, F) or every 10 th image (every 2 min, G) is shown. Images are maximum intensity projections of the Z-stack. (H) Similar to (G), but showing an interphase cell; loss of the nuclear sfGFPcp signal is due to photobleaching, not degradation.
Article Snippet: The vectors containing
Techniques: Live Cell Imaging, Construct, Control, Expressing