kanr Search Results


93
Addgene inc superose6
Superose6, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/superose6/product/Addgene inc
Average 93 stars, based on 1 article reviews
superose6 - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
Addgene inc ptarget cast addgene
Ptarget Cast Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ptarget cast addgene/product/Addgene inc
Average 93 stars, based on 1 article reviews
ptarget cast addgene - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

92
Addgene inc drew endy
Drew Endy, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/drew endy/product/Addgene inc
Average 92 stars, based on 1 article reviews
drew endy - by Bioz Stars, 2026-04
92/100 stars
  Buy from Supplier

93
Addgene inc plasmid posip kh
Plasmid Posip Kh, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmid posip kh/product/Addgene inc
Average 93 stars, based on 1 article reviews
plasmid posip kh - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
Addgene inc pet251 puc 12×ms2v6 loxp kanr loxp
Pet251 Puc 12×Ms2v6 Loxp Kanr Loxp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pet251 puc 12×ms2v6 loxp kanr loxp/product/Addgene inc
Average 93 stars, based on 1 article reviews
pet251 puc 12×ms2v6 loxp kanr loxp - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
Addgene inc plasmid pjet1 2 kanr cassette
Plasmid Pjet1 2 Kanr Cassette, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmid pjet1 2 kanr cassette/product/Addgene inc
Average 93 stars, based on 1 article reviews
plasmid pjet1 2 kanr cassette - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
Addgene inc 24x ms2v6 cassettes
(A) Vectors to append homology regions upstream and downstream of the <t>MS2V6</t> repeats; vc591 <t>(24x</t> MS2V6) and vc592 (12x MS2V6) are slightly modified versions of Addgene plasmids # 104393 and # 104392 (Tutucci et al., Nat Methods 2017). An EcoRI site was added downstream of the MS2V6 repeats. Homology regions can be integrated at the BamHI, EcoRI, and XhoI sites. (B,C,D) Strategies to integrate the 12-24x MS2V6 repeats into the genome: (B) CRISPR/Cas9-facilitated integration without resistance gene; (C) replacement of a counterselectable cassette, e.g. when working with a non-essential gene; (D) integration using the kanMX resistance gene present on the vector.
24x Ms2v6 Cassettes, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/24x ms2v6 cassettes/product/Addgene inc
Average 93 stars, based on 1 article reviews
24x ms2v6 cassettes - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
Addgene inc snap cd59
(A) Vectors to append homology regions upstream and downstream of the <t>MS2V6</t> repeats; vc591 <t>(24x</t> MS2V6) and vc592 (12x MS2V6) are slightly modified versions of Addgene plasmids # 104393 and # 104392 (Tutucci et al., Nat Methods 2017). An EcoRI site was added downstream of the MS2V6 repeats. Homology regions can be integrated at the BamHI, EcoRI, and XhoI sites. (B,C,D) Strategies to integrate the 12-24x MS2V6 repeats into the genome: (B) CRISPR/Cas9-facilitated integration without resistance gene; (C) replacement of a counterselectable cassette, e.g. when working with a non-essential gene; (D) integration using the kanMX resistance gene present on the vector.
Snap Cd59, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/snap cd59/product/Addgene inc
Average 93 stars, based on 1 article reviews
snap cd59 - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
Addgene inc ccccagggccccattttggtacc r
(A) Vectors to append homology regions upstream and downstream of the <t>MS2V6</t> repeats; vc591 <t>(24x</t> MS2V6) and vc592 (12x MS2V6) are slightly modified versions of Addgene plasmids # 104393 and # 104392 (Tutucci et al., Nat Methods 2017). An EcoRI site was added downstream of the MS2V6 repeats. Homology regions can be integrated at the BamHI, EcoRI, and XhoI sites. (B,C,D) Strategies to integrate the 12-24x MS2V6 repeats into the genome: (B) CRISPR/Cas9-facilitated integration without resistance gene; (C) replacement of a counterselectable cassette, e.g. when working with a non-essential gene; (D) integration using the kanMX resistance gene present on the vector.
Ccccagggccccattttggtacc R, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ccccagggccccattttggtacc r/product/Addgene inc
Average 93 stars, based on 1 article reviews
ccccagggccccattttggtacc r - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

92
Addgene inc aac6 sequences
Figure 1. Approach: from Experimental Evolution to Residue Interactions and 3D Structures The experiments involve repeated rounds of mutation and selection, starting from a single sequence (b-lactamase PSE1, 266 residues; or aminoglycoside acetyltransferase <t>AAC6,</t> 148 residues). In each round, mutations are generated by error-prone PCR, followed by selection in E. coli for functional variants at relatively low antibiotic concentration (6 mg/mL ampicillin [Amp] for PSE1 and 10 mg/mL kanamycin [Kan] for AAC6). A large number of full-length sequences at various rounds are obtained by deep sequencing after selection; here, at rounds 10 and 20 for PSE1, and rounds 2, 4 and 8 for AAC6. Residue interactions are inferred from co-evolution patterns in the selected sequences using the evolutionary couplings (EVcouplings (Marks et al., 2011)) maximum entropy model, which are then used as distance constraints to compute 3D structures using distance geometry and simulated annealing molecular dynamics (Brunger, 2007).
Aac6 Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aac6 sequences/product/Addgene inc
Average 92 stars, based on 1 article reviews
aac6 sequences - by Bioz Stars, 2026-04
92/100 stars
  Buy from Supplier

91
Addgene inc buffer c
Figure 1. Approach: from Experimental Evolution to Residue Interactions and 3D Structures The experiments involve repeated rounds of mutation and selection, starting from a single sequence (b-lactamase PSE1, 266 residues; or aminoglycoside acetyltransferase <t>AAC6,</t> 148 residues). In each round, mutations are generated by error-prone PCR, followed by selection in E. coli for functional variants at relatively low antibiotic concentration (6 mg/mL ampicillin [Amp] for PSE1 and 10 mg/mL kanamycin [Kan] for AAC6). A large number of full-length sequences at various rounds are obtained by deep sequencing after selection; here, at rounds 10 and 20 for PSE1, and rounds 2, 4 and 8 for AAC6. Residue interactions are inferred from co-evolution patterns in the selected sequences using the evolutionary couplings (EVcouplings (Marks et al., 2011)) maximum entropy model, which are then used as distance constraints to compute 3D structures using distance geometry and simulated annealing molecular dynamics (Brunger, 2007).
Buffer C, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/buffer c/product/Addgene inc
Average 91 stars, based on 1 article reviews
buffer c - by Bioz Stars, 2026-04
91/100 stars
  Buy from Supplier

93
Addgene inc pcmvδr8 2 helper plasmid
Figure 1. Approach: from Experimental Evolution to Residue Interactions and 3D Structures The experiments involve repeated rounds of mutation and selection, starting from a single sequence (b-lactamase PSE1, 266 residues; or aminoglycoside acetyltransferase <t>AAC6,</t> 148 residues). In each round, mutations are generated by error-prone PCR, followed by selection in E. coli for functional variants at relatively low antibiotic concentration (6 mg/mL ampicillin [Amp] for PSE1 and 10 mg/mL kanamycin [Kan] for AAC6). A large number of full-length sequences at various rounds are obtained by deep sequencing after selection; here, at rounds 10 and 20 for PSE1, and rounds 2, 4 and 8 for AAC6. Residue interactions are inferred from co-evolution patterns in the selected sequences using the evolutionary couplings (EVcouplings (Marks et al., 2011)) maximum entropy model, which are then used as distance constraints to compute 3D structures using distance geometry and simulated annealing molecular dynamics (Brunger, 2007).
Pcmvδr8 2 Helper Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcmvδr8 2 helper plasmid/product/Addgene inc
Average 93 stars, based on 1 article reviews
pcmvδr8 2 helper plasmid - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

Image Search Results


(A) Vectors to append homology regions upstream and downstream of the MS2V6 repeats; vc591 (24x MS2V6) and vc592 (12x MS2V6) are slightly modified versions of Addgene plasmids # 104393 and # 104392 (Tutucci et al., Nat Methods 2017). An EcoRI site was added downstream of the MS2V6 repeats. Homology regions can be integrated at the BamHI, EcoRI, and XhoI sites. (B,C,D) Strategies to integrate the 12-24x MS2V6 repeats into the genome: (B) CRISPR/Cas9-facilitated integration without resistance gene; (C) replacement of a counterselectable cassette, e.g. when working with a non-essential gene; (D) integration using the kanMX resistance gene present on the vector.

Journal: bioRxiv

Article Title: Establishing MS2-MCP-based single-molecule RNA visualization in Schizosaccharomyces pombe

doi: 10.64898/2026.03.09.710516

Figure Lengend Snippet: (A) Vectors to append homology regions upstream and downstream of the MS2V6 repeats; vc591 (24x MS2V6) and vc592 (12x MS2V6) are slightly modified versions of Addgene plasmids # 104393 and # 104392 (Tutucci et al., Nat Methods 2017). An EcoRI site was added downstream of the MS2V6 repeats. Homology regions can be integrated at the BamHI, EcoRI, and XhoI sites. (B,C,D) Strategies to integrate the 12-24x MS2V6 repeats into the genome: (B) CRISPR/Cas9-facilitated integration without resistance gene; (C) replacement of a counterselectable cassette, e.g. when working with a non-essential gene; (D) integration using the kanMX resistance gene present on the vector.

Article Snippet: The vectors containing 12x MSV6 (pET251-pUC 12xMS2V6 Loxp KANr Loxp, Addgene plasmid # 104392) and 24x MS2V6 cassettes (pET264-pUC 24xMS2V6 Loxp KANr Loxp, Addgene plasmid # 104393) were a gift from Robert Singer and Evelina Tutucci ( ).

Techniques: Modification, CRISPR, Plasmid Preparation

(A) The mad2 gene was tagged in the 3’UTR with 24x MS2V6, and MCP-tdSG was expressed from different promoters. (B) Short kymographs from live-cell imaging; longer sequences are shown in Fig. S3. For each MCP-tdSG construct, a strain without integration of MS2 repeats is shown as control. Far left: strain expressing mad2 -24xMS2, but no MCP-tdSG. Images are maximum intensity projections of the Z-stack. Note the different scaling setting for P.cdc2.short-MCP-tdSG. (C) Quantification of the maximum spot intensity over maximum background intensity. Two replicates per strain, 56-162 spots per replicate. Points: individual spots; box plot: summary statistics (center line, median; box boundaries, 1st and 3rd quartiles). (D) The cdc13 gene was internally tagged with circularly permuted superfolder GFP (sfGFPcp) and 12x or 24x MS2V6 cassettes were inserted in the 3’UTR. The construct was expressed under endogenous cdc13 regulatory sequences (promoter, terminator) from the leu1 locus. MCP-tdSG was expressed from the mad3 promoter. (E) Schematic illustrating Cdc13 protein localization. Cdc13 accumulates during interphase and is strongly enriched in the nucleus. Cdc13 localizes to spindle pole bodies and the spindle during early mitosis and becomes degraded at the metaphase-to-anaphase transition. (F,G) Kymographs from live-cell imaging of cells undergoing mitosis; cdc13 -sfGFP tagged with either 24x MS2V6 (F) or 12x MS2V6 (G). A strain without MS2 repeats is shown as control. Images were recorded every 5 sec (F) or 12 sec (G); every second image (every 10 sec, F) or every 10 th image (every 2 min, G) is shown. Images are maximum intensity projections of the Z-stack. (H) Similar to (G), but showing an interphase cell; loss of the nuclear sfGFPcp signal is due to photobleaching, not degradation.

Journal: bioRxiv

Article Title: Establishing MS2-MCP-based single-molecule RNA visualization in Schizosaccharomyces pombe

doi: 10.64898/2026.03.09.710516

Figure Lengend Snippet: (A) The mad2 gene was tagged in the 3’UTR with 24x MS2V6, and MCP-tdSG was expressed from different promoters. (B) Short kymographs from live-cell imaging; longer sequences are shown in Fig. S3. For each MCP-tdSG construct, a strain without integration of MS2 repeats is shown as control. Far left: strain expressing mad2 -24xMS2, but no MCP-tdSG. Images are maximum intensity projections of the Z-stack. Note the different scaling setting for P.cdc2.short-MCP-tdSG. (C) Quantification of the maximum spot intensity over maximum background intensity. Two replicates per strain, 56-162 spots per replicate. Points: individual spots; box plot: summary statistics (center line, median; box boundaries, 1st and 3rd quartiles). (D) The cdc13 gene was internally tagged with circularly permuted superfolder GFP (sfGFPcp) and 12x or 24x MS2V6 cassettes were inserted in the 3’UTR. The construct was expressed under endogenous cdc13 regulatory sequences (promoter, terminator) from the leu1 locus. MCP-tdSG was expressed from the mad3 promoter. (E) Schematic illustrating Cdc13 protein localization. Cdc13 accumulates during interphase and is strongly enriched in the nucleus. Cdc13 localizes to spindle pole bodies and the spindle during early mitosis and becomes degraded at the metaphase-to-anaphase transition. (F,G) Kymographs from live-cell imaging of cells undergoing mitosis; cdc13 -sfGFP tagged with either 24x MS2V6 (F) or 12x MS2V6 (G). A strain without MS2 repeats is shown as control. Images were recorded every 5 sec (F) or 12 sec (G); every second image (every 10 sec, F) or every 10 th image (every 2 min, G) is shown. Images are maximum intensity projections of the Z-stack. (H) Similar to (G), but showing an interphase cell; loss of the nuclear sfGFPcp signal is due to photobleaching, not degradation.

Article Snippet: The vectors containing 12x MSV6 (pET251-pUC 12xMS2V6 Loxp KANr Loxp, Addgene plasmid # 104392) and 24x MS2V6 cassettes (pET264-pUC 24xMS2V6 Loxp KANr Loxp, Addgene plasmid # 104393) were a gift from Robert Singer and Evelina Tutucci ( ).

Techniques: Live Cell Imaging, Construct, Control, Expressing

Figure 1. Approach: from Experimental Evolution to Residue Interactions and 3D Structures The experiments involve repeated rounds of mutation and selection, starting from a single sequence (b-lactamase PSE1, 266 residues; or aminoglycoside acetyltransferase AAC6, 148 residues). In each round, mutations are generated by error-prone PCR, followed by selection in E. coli for functional variants at relatively low antibiotic concentration (6 mg/mL ampicillin [Amp] for PSE1 and 10 mg/mL kanamycin [Kan] for AAC6). A large number of full-length sequences at various rounds are obtained by deep sequencing after selection; here, at rounds 10 and 20 for PSE1, and rounds 2, 4 and 8 for AAC6. Residue interactions are inferred from co-evolution patterns in the selected sequences using the evolutionary couplings (EVcouplings (Marks et al., 2011)) maximum entropy model, which are then used as distance constraints to compute 3D structures using distance geometry and simulated annealing molecular dynamics (Brunger, 2007).

Journal: Cell systems

Article Title: Protein Structure from Experimental Evolution.

doi: 10.1016/j.cels.2019.11.008

Figure Lengend Snippet: Figure 1. Approach: from Experimental Evolution to Residue Interactions and 3D Structures The experiments involve repeated rounds of mutation and selection, starting from a single sequence (b-lactamase PSE1, 266 residues; or aminoglycoside acetyltransferase AAC6, 148 residues). In each round, mutations are generated by error-prone PCR, followed by selection in E. coli for functional variants at relatively low antibiotic concentration (6 mg/mL ampicillin [Amp] for PSE1 and 10 mg/mL kanamycin [Kan] for AAC6). A large number of full-length sequences at various rounds are obtained by deep sequencing after selection; here, at rounds 10 and 20 for PSE1, and rounds 2, 4 and 8 for AAC6. Residue interactions are inferred from co-evolution patterns in the selected sequences using the evolutionary couplings (EVcouplings (Marks et al., 2011)) maximum entropy model, which are then used as distance constraints to compute 3D structures using distance geometry and simulated annealing molecular dynamics (Brunger, 2007).

Article Snippet: Plasmids generated in this study that contain ancestral PSE1 and AAC6 sequences have been deposited at Addgene: 135229 and Addgene: 135230, respectively.

Techniques: Residue, Mutagenesis, Selection, Sequencing, Generated, Functional Assay, Concentration Assay

Figure 4. Agreement between Residue Con- tacts Inferred from Experimental Evolution and Contacts in Crystal Structures (A) Agreement versus number of inferred in- teractions (as fraction of sequence length, L) during experimental evolution of PSE1 (left) and AAC6 (right). PSE1 results evaluated for an equal number (4 3 104) of randomly subsampled unique se- quences from rounds 10 and 20 to illustrate change in agreement with increased rounds of mutation and selection, and all (1.5 3 105) unique sequences at round 20 to illustrate change with increased number of sequences. AAC6 similarly assessed for an equal number (105) of randomly subsampled unique se- quences at rounds 2, 4 and 8, and all (1.3 3 106) unique sequences at round 8. Random is the average result obtained with randomly chosen res- idue pairs. (B) Inferred interactions from PSE1 evolution at round 20 (left) and AAC6 evolution at round 8 (right), overlaid on contact maps of crystal structures. In- ferred interactions either agree with monomer (red) or dimer (blue) contacts in the crystal structure (gray or light blue, respectively), or disagree (black). For PSE1, sequence-distal residue interactions between the N- and C-terminal a-helices and b-strands (lower left corner of contact map and indicated on crystal structure of PSE1) are particu- larly crucial constraints for the correct 3D fold via reduction of chain entropy. Dashed line in (A) and results in (B) are at L/2 inferred interactions; agree- ment of > 50% at L/2 often suffices to compute 3D structures (Hopf et al., 2012; Marks et al., 2012). In (A) and (B), residues in the known crystal structure are defined to be in contact if at least one atom- atom distance is < 5 A˚ ; inferred residue-residue interactions are limited to a primary sequence dis- tance > 5 residues.

Journal: Cell systems

Article Title: Protein Structure from Experimental Evolution.

doi: 10.1016/j.cels.2019.11.008

Figure Lengend Snippet: Figure 4. Agreement between Residue Con- tacts Inferred from Experimental Evolution and Contacts in Crystal Structures (A) Agreement versus number of inferred in- teractions (as fraction of sequence length, L) during experimental evolution of PSE1 (left) and AAC6 (right). PSE1 results evaluated for an equal number (4 3 104) of randomly subsampled unique se- quences from rounds 10 and 20 to illustrate change in agreement with increased rounds of mutation and selection, and all (1.5 3 105) unique sequences at round 20 to illustrate change with increased number of sequences. AAC6 similarly assessed for an equal number (105) of randomly subsampled unique se- quences at rounds 2, 4 and 8, and all (1.3 3 106) unique sequences at round 8. Random is the average result obtained with randomly chosen res- idue pairs. (B) Inferred interactions from PSE1 evolution at round 20 (left) and AAC6 evolution at round 8 (right), overlaid on contact maps of crystal structures. In- ferred interactions either agree with monomer (red) or dimer (blue) contacts in the crystal structure (gray or light blue, respectively), or disagree (black). For PSE1, sequence-distal residue interactions between the N- and C-terminal a-helices and b-strands (lower left corner of contact map and indicated on crystal structure of PSE1) are particu- larly crucial constraints for the correct 3D fold via reduction of chain entropy. Dashed line in (A) and results in (B) are at L/2 inferred interactions; agree- ment of > 50% at L/2 often suffices to compute 3D structures (Hopf et al., 2012; Marks et al., 2012). In (A) and (B), residues in the known crystal structure are defined to be in contact if at least one atom- atom distance is < 5 A˚ ; inferred residue-residue interactions are limited to a primary sequence dis- tance > 5 residues.

Article Snippet: Plasmids generated in this study that contain ancestral PSE1 and AAC6 sequences have been deposited at Addgene: 135229 and Addgene: 135230, respectively.

Techniques: Residue, Sequencing, Mutagenesis, Selection

Figure 6. Variation among Computed 3D Structure Models (A) Template modeling scores (TM-scores [Zhang and Skolnick, 2005]) for all computed models during geometric violation filtering iterations. Computed models are sorted along the x axis by TM-score within each iteration. Overall, structures computed with interactions inferred from experi- mentally evolved sequences have the same gen- eral fold as the crystal structure, with TM-scores of > 0.5 for 72% of PSE1 models (690 total models) and for 63% of AAC6 models (720 total models) in the final iteration for both proteins. (B) Structural variation between computed models. The color and radius of each residue is monotonically related to the RMSD of Ca-Ca dis- tances computed from all-versus-all pairwise su- perposition of models in the largest cluster (MaxCluster [Herbert and Sternberg, 2008]) from the final filtering iteration (STAR Methods).

Journal: Cell systems

Article Title: Protein Structure from Experimental Evolution.

doi: 10.1016/j.cels.2019.11.008

Figure Lengend Snippet: Figure 6. Variation among Computed 3D Structure Models (A) Template modeling scores (TM-scores [Zhang and Skolnick, 2005]) for all computed models during geometric violation filtering iterations. Computed models are sorted along the x axis by TM-score within each iteration. Overall, structures computed with interactions inferred from experi- mentally evolved sequences have the same gen- eral fold as the crystal structure, with TM-scores of > 0.5 for 72% of PSE1 models (690 total models) and for 63% of AAC6 models (720 total models) in the final iteration for both proteins. (B) Structural variation between computed models. The color and radius of each residue is monotonically related to the RMSD of Ca-Ca dis- tances computed from all-versus-all pairwise su- perposition of models in the largest cluster (MaxCluster [Herbert and Sternberg, 2008]) from the final filtering iteration (STAR Methods).

Article Snippet: Plasmids generated in this study that contain ancestral PSE1 and AAC6 sequences have been deposited at Addgene: 135229 and Addgene: 135230, respectively.

Techniques: Residue