Review



mouse anti human clec10a cd301 conjugated  (R&D Systems)


Bioz Verified Symbol R&D Systems is a verified supplier
Bioz Manufacturer Symbol R&D Systems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    R&D Systems mouse anti human clec10a cd301 conjugated
    Mouse Anti Human Clec10a Cd301 Conjugated, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+clec10a/Human+CLEC10A%2FCD301+Antibody/pm41525833-64-53-62
    Average 92 stars, based on 7 article reviews
    mouse anti human clec10a cd301 conjugated - by Bioz Stars, 2026-09
    92/100 stars

    Images

    Related Articles

    Control:

    Article Title: SARS-CoV-2 exacerbates proinflammatory responses in myeloid cells through C-type lectin receptors and Tweety family member 2
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant human IL-4 R&D Systems Cat#: 204-IL Recombinant human TNF-a PeproTech Cat#: 300-01A Lipofectamine 2000 Invitrogen Cat#:11668019 Polyethylenimine (PEI), Linear, MW 25000 Polysciences Cat#: 23966 TMB ELISA Substrate Solution Sino Biological Cat#: SEKCR01 Pierce ECL Western Blotting Substrate Thermo Fisher Scientific Cat#: 32209 Bovine Serum Albumin Sigma Cat#: B4287-25G Ionomycin (free acid), Ca2+ ionophore Abcam Cat#: ab120370 Critical commercial assays PureLink RNA Mini Kit Invitrogen Cat#: 12183025 RNeasy Mini Kit QIAGEN Cat#: 74106 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat#: 4368813 SYBR Green PCR Master Mix Applied Biosystems Cat#: 4309155 TaqMan Universal PCR Master Mix Applied Biosystems Cat#: 4304437 MILLIPLEX MAP Human Cytokine/ Chemokine Magnetic Bead Panel - Premixed 30 Plex - Immunology Multiplex Assay Millipore Cat#: HCYTMAG-60K-PX30 HIV-1 p24 ELISA Assay XpressBio Cat#: XB-1000 Q Buffer Probelife Cat#: 120010 HFC (Anti-HIgG Fc) Probe Probelife Cat#: 160003 Deposited data RNA-sequencing data of human dendritic cells or macrophages infected with SARSCoV-2 GEO Accession#: GSE155106 Experimental models: Cell lines HEK293T ATCC Cat#: CRL-3216; RRID: CVCL_0063 Expi293F Thermo Fisher Scientific Cat#: A14527; RRID: CVCL_D615 293FT Thermo Fisher Scientific Cat#: R70007; RRID: CVCL_6911 Vero CCL81 ATCC Cat#: CCL-81; RRID: CVCL_0059 Vero E6 ATCC Cat#: CRL-1586; RRID: CVCL_0574 THP-1 ATCC Cat#: TIB-202; RRID: CVCL_0006 Oligonucleotides See Table S2 for primer sequences for RT-PCR This paper N/A Non-targeting control shRNA: Forward:CCGGC AACAAGATGAAGAGCACCAAC TCGAGTTGGTGCTCTTCATCTT GTTGTTTTTG; Reverse:AAT TCAAAAACAACAA GATGAAGAGCACCAACTCGAG TTGGTGCTCTTCATCTTGTTG This paper N/A DC-SIGN shRNA#1: Forward:CCGG ACTGGTTGCAAGAGCTCATTTCT CGAGAAATGAGCTCTTGCAACCA GTTTTTTG; Reverse:AATTCAAAAAACTG GTTGCAAGAGCTCATTTCT CGAGAAATGAGCTCTTGCAACCAGT This paper N/A (Continued on next page) ll Article e3 Immunity 54, 1304–1319.e1–e9, June 8, 2021

    Staining:

    Article Title: SARS-CoV-2 exacerbates proinflammatory responses in myeloid cells through C-type lectin receptors and Tweety family member 2
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant human IL-4 R&D Systems Cat#: 204-IL Recombinant human TNF-a PeproTech Cat#: 300-01A Lipofectamine 2000 Invitrogen Cat#:11668019 Polyethylenimine (PEI), Linear, MW 25000 Polysciences Cat#: 23966 TMB ELISA Substrate Solution Sino Biological Cat#: SEKCR01 Pierce ECL Western Blotting Substrate Thermo Fisher Scientific Cat#: 32209 Bovine Serum Albumin Sigma Cat#: B4287-25G Ionomycin (free acid), Ca2+ ionophore Abcam Cat#: ab120370 Critical commercial assays PureLink RNA Mini Kit Invitrogen Cat#: 12183025 RNeasy Mini Kit QIAGEN Cat#: 74106 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat#: 4368813 SYBR Green PCR Master Mix Applied Biosystems Cat#: 4309155 TaqMan Universal PCR Master Mix Applied Biosystems Cat#: 4304437 MILLIPLEX MAP Human Cytokine/ Chemokine Magnetic Bead Panel - Premixed 30 Plex - Immunology Multiplex Assay Millipore Cat#: HCYTMAG-60K-PX30 HIV-1 p24 ELISA Assay XpressBio Cat#: XB-1000 Q Buffer Probelife Cat#: 120010 HFC (Anti-HIgG Fc) Probe Probelife Cat#: 160003 Deposited data RNA-sequencing data of human dendritic cells or macrophages infected with SARSCoV-2 GEO Accession#: GSE155106 Experimental models: Cell lines HEK293T ATCC Cat#: CRL-3216; RRID: CVCL_0063 Expi293F Thermo Fisher Scientific Cat#: A14527; RRID: CVCL_D615 293FT Thermo Fisher Scientific Cat#: R70007; RRID: CVCL_6911 Vero CCL81 ATCC Cat#: CCL-81; RRID: CVCL_0059 Vero E6 ATCC Cat#: CRL-1586; RRID: CVCL_0574 THP-1 ATCC Cat#: TIB-202; RRID: CVCL_0006 Oligonucleotides See Table S2 for primer sequences for RT-PCR This paper N/A Non-targeting control shRNA: Forward:CCGGC AACAAGATGAAGAGCACCAAC TCGAGTTGGTGCTCTTCATCTT GTTGTTTTTG; Reverse:AAT TCAAAAACAACAA GATGAAGAGCACCAACTCGAG TTGGTGCTCTTCATCTTGTTG This paper N/A DC-SIGN shRNA#1: Forward:CCGG ACTGGTTGCAAGAGCTCATTTCT CGAGAAATGAGCTCTTGCAACCA GTTTTTTG; Reverse:AATTCAAAAAACTG GTTGCAAGAGCTCATTTCT CGAGAAATGAGCTCTTGCAACCAGT This paper N/A (Continued on next page) ll Article e3 Immunity 54, 1304–1319.e1–e9, June 8, 2021

    Virus:

    Article Title: SARS-CoV-2 exacerbates proinflammatory responses in myeloid cells through C-type lectin receptors and Tweety family member 2
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant human IL-4 R&D Systems Cat#: 204-IL Recombinant human TNF-a PeproTech Cat#: 300-01A Lipofectamine 2000 Invitrogen Cat#:11668019 Polyethylenimine (PEI), Linear, MW 25000 Polysciences Cat#: 23966 TMB ELISA Substrate Solution Sino Biological Cat#: SEKCR01 Pierce ECL Western Blotting Substrate Thermo Fisher Scientific Cat#: 32209 Bovine Serum Albumin Sigma Cat#: B4287-25G Ionomycin (free acid), Ca2+ ionophore Abcam Cat#: ab120370 Critical commercial assays PureLink RNA Mini Kit Invitrogen Cat#: 12183025 RNeasy Mini Kit QIAGEN Cat#: 74106 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat#: 4368813 SYBR Green PCR Master Mix Applied Biosystems Cat#: 4309155 TaqMan Universal PCR Master Mix Applied Biosystems Cat#: 4304437 MILLIPLEX MAP Human Cytokine/ Chemokine Magnetic Bead Panel - Premixed 30 Plex - Immunology Multiplex Assay Millipore Cat#: HCYTMAG-60K-PX30 HIV-1 p24 ELISA Assay XpressBio Cat#: XB-1000 Q Buffer Probelife Cat#: 120010 HFC (Anti-HIgG Fc) Probe Probelife Cat#: 160003 Deposited data RNA-sequencing data of human dendritic cells or macrophages infected with SARSCoV-2 GEO Accession#: GSE155106 Experimental models: Cell lines HEK293T ATCC Cat#: CRL-3216; RRID: CVCL_0063 Expi293F Thermo Fisher Scientific Cat#: A14527; RRID: CVCL_D615 293FT Thermo Fisher Scientific Cat#: R70007; RRID: CVCL_6911 Vero CCL81 ATCC Cat#: CCL-81; RRID: CVCL_0059 Vero E6 ATCC Cat#: CRL-1586; RRID: CVCL_0574 THP-1 ATCC Cat#: TIB-202; RRID: CVCL_0006 Oligonucleotides See Table S2 for primer sequences for RT-PCR This paper N/A Non-targeting control shRNA: Forward:CCGGC AACAAGATGAAGAGCACCAAC TCGAGTTGGTGCTCTTCATCTT GTTGTTTTTG; Reverse:AAT TCAAAAACAACAA GATGAAGAGCACCAACTCGAG TTGGTGCTCTTCATCTTGTTG This paper N/A DC-SIGN shRNA#1: Forward:CCGG ACTGGTTGCAAGAGCTCATTTCT CGAGAAATGAGCTCTTGCAACCA GTTTTTTG; Reverse:AATTCAAAAAACTG GTTGCAAGAGCTCATTTCT CGAGAAATGAGCTCTTGCAACCAGT This paper N/A (Continued on next page) ll Article e3 Immunity 54, 1304–1319.e1–e9, June 8, 2021

    Recombinant:

    Article Title: SARS-CoV-2 exacerbates proinflammatory responses in myeloid cells through C-type lectin receptors and Tweety family member 2
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant human IL-4 R&D Systems Cat#: 204-IL Recombinant human TNF-a PeproTech Cat#: 300-01A Lipofectamine 2000 Invitrogen Cat#:11668019 Polyethylenimine (PEI), Linear, MW 25000 Polysciences Cat#: 23966 TMB ELISA Substrate Solution Sino Biological Cat#: SEKCR01 Pierce ECL Western Blotting Substrate Thermo Fisher Scientific Cat#: 32209 Bovine Serum Albumin Sigma Cat#: B4287-25G Ionomycin (free acid), Ca2+ ionophore Abcam Cat#: ab120370 Critical commercial assays PureLink RNA Mini Kit Invitrogen Cat#: 12183025 RNeasy Mini Kit QIAGEN Cat#: 74106 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat#: 4368813 SYBR Green PCR Master Mix Applied Biosystems Cat#: 4309155 TaqMan Universal PCR Master Mix Applied Biosystems Cat#: 4304437 MILLIPLEX MAP Human Cytokine/ Chemokine Magnetic Bead Panel - Premixed 30 Plex - Immunology Multiplex Assay Millipore Cat#: HCYTMAG-60K-PX30 HIV-1 p24 ELISA Assay XpressBio Cat#: XB-1000 Q Buffer Probelife Cat#: 120010 HFC (Anti-HIgG Fc) Probe Probelife Cat#: 160003 Deposited data RNA-sequencing data of human dendritic cells or macrophages infected with SARSCoV-2 GEO Accession#: GSE155106 Experimental models: Cell lines HEK293T ATCC Cat#: CRL-3216; RRID: CVCL_0063 Expi293F Thermo Fisher Scientific Cat#: A14527; RRID: CVCL_D615 293FT Thermo Fisher Scientific Cat#: R70007; RRID: CVCL_6911 Vero CCL81 ATCC Cat#: CCL-81; RRID: CVCL_0059 Vero E6 ATCC Cat#: CRL-1586; RRID: CVCL_0574 THP-1 ATCC Cat#: TIB-202; RRID: CVCL_0006 Oligonucleotides See Table S2 for primer sequences for RT-PCR This paper N/A Non-targeting control shRNA: Forward:CCGGC AACAAGATGAAGAGCACCAAC TCGAGTTGGTGCTCTTCATCTT GTTGTTTTTG; Reverse:AAT TCAAAAACAACAA GATGAAGAGCACCAACTCGAG TTGGTGCTCTTCATCTTGTTG This paper N/A DC-SIGN shRNA#1: Forward:CCGG ACTGGTTGCAAGAGCTCATTTCT CGAGAAATGAGCTCTTGCAACCA GTTTTTTG; Reverse:AATTCAAAAAACTG GTTGCAAGAGCTCATTTCT CGAGAAATGAGCTCTTGCAACCAGT This paper N/A (Continued on next page) ll Article e3 Immunity 54, 1304–1319.e1–e9, June 8, 2021



    Similar Products

    92
    R&D Systems mouse anti human clec10a cd301 conjugated
    Mouse Anti Human Clec10a Cd301 Conjugated, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+clec10a/Human+CLEC10A%2FCD301+Antibody/pm41525833-64-53-62
    Average 92 stars, based on 1 article reviews
    mouse anti human clec10a cd301 conjugated - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    93
    R&D Systems biotinylated anti human mgl antibody
    Biotinylated Anti Human Mgl Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+clec10a/Human+CLEC10A%2FCD301+Biotinylated+Antibody/pm41006428-75-14-21
    Average 93 stars, based on 1 article reviews
    biotinylated anti human mgl antibody - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Elabscience Biotechnology recombinant human mgl clec10a protein
    Recombinant Human Mgl Clec10a Protein, supplied by Elabscience Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+clec10a/Recombinant+Human+CLEC10A%2FCD301+Protein/pm41006428-74-26-31
    Average 93 stars, based on 1 article reviews
    recombinant human mgl clec10a protein - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    R&D Systems paper cd301 6xhistidine r d systems 4888 cl 050 l pha
    Paper Cd301 6xhistidine R D Systems 4888 Cl 050 L Pha, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+clec10a/Recombinant+Human+CLEC10A%2FCD301+Protein%2C+CF/pm41005308-640-115-117
    Average 93 stars, based on 1 article reviews
    paper cd301 6xhistidine r d systems 4888 cl 050 l pha - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    94
    OriGene mouse anti human clec10a monoclonal antibody
    Three lectins, Galectin-4 C, Galectin-8 C, and <t>CLEC10A-Fc,</t> were extracted as candidate human endogenous lectins that recognize pancreatic cancer cells. ( a ) Among the 43 lectins, pancreatic cancer-reactive lectins were screened using flow cytometry. The difference (ΔMFI) between the median fluorescence intensity (MFI) of each lectin and the MFI of the control is shown in the heat map. Red arrows indicate lectins that met the criteria of MFI greater than 10 4 for the pancreatic cancer cell lines, Capan-1 or AsPC-1, and less than 10 4 for the pancreatic ductal cell line, hTERT-HPNE. ( b ) Histograms of Galectin-4 C, Galectin-8 C, and CLEC10A-Fc. The gray-filled histogram indicates control cells stained with PE-labeled BSA (for galectins) or PE-labeled anti-Fc antibody (for C-type lectins) used as negative controls, and the cyan line is the histogram of cells incubated with PE-labeled galectins or C-type lectins followed by PE-labeled anti-Fc antibody.
    Mouse Anti Human Clec10a Monoclonal Antibody, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+clec10a/CLEC10A+Mouse+Monoclonal+Antibody/pmc12095740-90-20-28
    Average 94 stars, based on 1 article reviews
    mouse anti human clec10a monoclonal antibody - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    90
    OriGene mouse anti-human clec10a monoclonal antibody oti2b10
    Three lectins, Galectin-4 C, Galectin-8 C, and <t>CLEC10A-Fc,</t> were extracted as candidate human endogenous lectins that recognize pancreatic cancer cells. ( a ) Among the 43 lectins, pancreatic cancer-reactive lectins were screened using flow cytometry. The difference (ΔMFI) between the median fluorescence intensity (MFI) of each lectin and the MFI of the control is shown in the heat map. Red arrows indicate lectins that met the criteria of MFI greater than 10 4 for the pancreatic cancer cell lines, Capan-1 or AsPC-1, and less than 10 4 for the pancreatic ductal cell line, hTERT-HPNE. ( b ) Histograms of Galectin-4 C, Galectin-8 C, and CLEC10A-Fc. The gray-filled histogram indicates control cells stained with PE-labeled BSA (for galectins) or PE-labeled anti-Fc antibody (for C-type lectins) used as negative controls, and the cyan line is the histogram of cells incubated with PE-labeled galectins or C-type lectins followed by PE-labeled anti-Fc antibody.
    Mouse Anti Human Clec10a Monoclonal Antibody Oti2b10, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+clec10a/mouse+anti+human+clec10a+monoclonal+antibody+oti2b10/pmc12095740-96-4-12
    Average 90 stars, based on 1 article reviews
    mouse anti-human clec10a monoclonal antibody oti2b10 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    92
    R&D Systems clec10a cd301 antibody
    Three lectins, Galectin-4 C, Galectin-8 C, and <t>CLEC10A-Fc,</t> were extracted as candidate human endogenous lectins that recognize pancreatic cancer cells. ( a ) Among the 43 lectins, pancreatic cancer-reactive lectins were screened using flow cytometry. The difference (ΔMFI) between the median fluorescence intensity (MFI) of each lectin and the MFI of the control is shown in the heat map. Red arrows indicate lectins that met the criteria of MFI greater than 10 4 for the pancreatic cancer cell lines, Capan-1 or AsPC-1, and less than 10 4 for the pancreatic ductal cell line, hTERT-HPNE. ( b ) Histograms of Galectin-4 C, Galectin-8 C, and CLEC10A-Fc. The gray-filled histogram indicates control cells stained with PE-labeled BSA (for galectins) or PE-labeled anti-Fc antibody (for C-type lectins) used as negative controls, and the cyan line is the histogram of cells incubated with PE-labeled galectins or C-type lectins followed by PE-labeled anti-Fc antibody.
    Clec10a Cd301 Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+clec10a/Human+CLEC10A%2FCD301+Antibody/pm39535430__nl4c04653_si_001-75-33-35
    Average 92 stars, based on 1 article reviews
    clec10a cd301 antibody - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    Image Search Results


    Three lectins, Galectin-4 C, Galectin-8 C, and CLEC10A-Fc, were extracted as candidate human endogenous lectins that recognize pancreatic cancer cells. ( a ) Among the 43 lectins, pancreatic cancer-reactive lectins were screened using flow cytometry. The difference (ΔMFI) between the median fluorescence intensity (MFI) of each lectin and the MFI of the control is shown in the heat map. Red arrows indicate lectins that met the criteria of MFI greater than 10 4 for the pancreatic cancer cell lines, Capan-1 or AsPC-1, and less than 10 4 for the pancreatic ductal cell line, hTERT-HPNE. ( b ) Histograms of Galectin-4 C, Galectin-8 C, and CLEC10A-Fc. The gray-filled histogram indicates control cells stained with PE-labeled BSA (for galectins) or PE-labeled anti-Fc antibody (for C-type lectins) used as negative controls, and the cyan line is the histogram of cells incubated with PE-labeled galectins or C-type lectins followed by PE-labeled anti-Fc antibody.

    Journal: Scientific Reports

    Article Title: Identification of CLEC10A as a human lectin for pancreatic ductal adenocarcinoma

    doi: 10.1038/s41598-025-02404-1

    Figure Lengend Snippet: Three lectins, Galectin-4 C, Galectin-8 C, and CLEC10A-Fc, were extracted as candidate human endogenous lectins that recognize pancreatic cancer cells. ( a ) Among the 43 lectins, pancreatic cancer-reactive lectins were screened using flow cytometry. The difference (ΔMFI) between the median fluorescence intensity (MFI) of each lectin and the MFI of the control is shown in the heat map. Red arrows indicate lectins that met the criteria of MFI greater than 10 4 for the pancreatic cancer cell lines, Capan-1 or AsPC-1, and less than 10 4 for the pancreatic ductal cell line, hTERT-HPNE. ( b ) Histograms of Galectin-4 C, Galectin-8 C, and CLEC10A-Fc. The gray-filled histogram indicates control cells stained with PE-labeled BSA (for galectins) or PE-labeled anti-Fc antibody (for C-type lectins) used as negative controls, and the cyan line is the histogram of cells incubated with PE-labeled galectins or C-type lectins followed by PE-labeled anti-Fc antibody.

    Article Snippet: Sections were blocked using peroxidase blocking solution (Agilent; Cat# K8000) for 5 min, washed in wash buffer, and incubated with mouse anti-human CLEC10A monoclonal antibody (1:500, clone OTI2B10, OriGene, Rockville, MD, USA; Cat# TA810180) for 20 min.

    Techniques: Flow Cytometry, Fluorescence, Control, Staining, Labeling, Incubation

    CLEC10A is a human endogenous lectin with high affinity for pancreatic cancer cells. ( a ) Representative images of pancreatic cancerous and noncancerous tissues stained with three lectins (Galectin-4 C, Galectin-8 C, and CLEC10A-Fc). Scale bars, 10 μm. The arrowhead (▼) indicates the positive staining of the cell membrane. ( b ) Percentage of cases positive for lectin staining in pancreatic cancer cells (C) and pancreatic duct cells (N) in noncancerous tissue compared using Fisher’s exact test (NS: not significant, * P < 0.05).

    Journal: Scientific Reports

    Article Title: Identification of CLEC10A as a human lectin for pancreatic ductal adenocarcinoma

    doi: 10.1038/s41598-025-02404-1

    Figure Lengend Snippet: CLEC10A is a human endogenous lectin with high affinity for pancreatic cancer cells. ( a ) Representative images of pancreatic cancerous and noncancerous tissues stained with three lectins (Galectin-4 C, Galectin-8 C, and CLEC10A-Fc). Scale bars, 10 μm. The arrowhead (▼) indicates the positive staining of the cell membrane. ( b ) Percentage of cases positive for lectin staining in pancreatic cancer cells (C) and pancreatic duct cells (N) in noncancerous tissue compared using Fisher’s exact test (NS: not significant, * P < 0.05).

    Article Snippet: Sections were blocked using peroxidase blocking solution (Agilent; Cat# K8000) for 5 min, washed in wash buffer, and incubated with mouse anti-human CLEC10A monoclonal antibody (1:500, clone OTI2B10, OriGene, Rockville, MD, USA; Cat# TA810180) for 20 min.

    Techniques: Staining, Membrane

    CLEC10A ligand is expressed in 60% of clinical pancreatic cancer cells. ( a ) Representative images of histochemically processed sections of clinical pancreatic cancer tissue analyzed for CLEC10A-Fc staining. Scale bars (Large window) 200 μm, (Small window) 10 μm. Staining intensity was scored according to the percentage of positive cells regardless of staining intensity as follows: 0, 0%; 1+, < 1%; 2+, 1–24; 3+, 25–49%; 4+, 50–74%; 5+, 75–100%. ( b ) A pie chart showing the percentage of each staining score in 113 processed sections of clinical pancreatic cancer tissue stained with CLEC10A-Fc.

    Journal: Scientific Reports

    Article Title: Identification of CLEC10A as a human lectin for pancreatic ductal adenocarcinoma

    doi: 10.1038/s41598-025-02404-1

    Figure Lengend Snippet: CLEC10A ligand is expressed in 60% of clinical pancreatic cancer cells. ( a ) Representative images of histochemically processed sections of clinical pancreatic cancer tissue analyzed for CLEC10A-Fc staining. Scale bars (Large window) 200 μm, (Small window) 10 μm. Staining intensity was scored according to the percentage of positive cells regardless of staining intensity as follows: 0, 0%; 1+, < 1%; 2+, 1–24; 3+, 25–49%; 4+, 50–74%; 5+, 75–100%. ( b ) A pie chart showing the percentage of each staining score in 113 processed sections of clinical pancreatic cancer tissue stained with CLEC10A-Fc.

    Article Snippet: Sections were blocked using peroxidase blocking solution (Agilent; Cat# K8000) for 5 min, washed in wash buffer, and incubated with mouse anti-human CLEC10A monoclonal antibody (1:500, clone OTI2B10, OriGene, Rockville, MD, USA; Cat# TA810180) for 20 min.

    Techniques: Staining

    CLEC10A-expressing monocytic cells in pancreatic cancer stroma. ( a ) Left: Hematoxylin and eosin staining of representative pancreatic cancer tissue. Scale bars, 50 μm. Right: Immunostaining with anti-CLEC10A antibody in representative pancreatic cancer tissue. Scale bars, 50 μm. Cancer duct structures are surrounded by dotted lines (---); CLEC10A-expressing cells are indicated by arrowheads (▼). ( b ) Immunofluorescence staining of CLEC10A (red), CD163 (green), and nuclei (blue) in pancreatic cancer tissue; merge: yellow. Scale bars, 50 μm.

    Journal: Scientific Reports

    Article Title: Identification of CLEC10A as a human lectin for pancreatic ductal adenocarcinoma

    doi: 10.1038/s41598-025-02404-1

    Figure Lengend Snippet: CLEC10A-expressing monocytic cells in pancreatic cancer stroma. ( a ) Left: Hematoxylin and eosin staining of representative pancreatic cancer tissue. Scale bars, 50 μm. Right: Immunostaining with anti-CLEC10A antibody in representative pancreatic cancer tissue. Scale bars, 50 μm. Cancer duct structures are surrounded by dotted lines (---); CLEC10A-expressing cells are indicated by arrowheads (▼). ( b ) Immunofluorescence staining of CLEC10A (red), CD163 (green), and nuclei (blue) in pancreatic cancer tissue; merge: yellow. Scale bars, 50 μm.

    Article Snippet: Sections were blocked using peroxidase blocking solution (Agilent; Cat# K8000) for 5 min, washed in wash buffer, and incubated with mouse anti-human CLEC10A monoclonal antibody (1:500, clone OTI2B10, OriGene, Rockville, MD, USA; Cat# TA810180) for 20 min.

    Techniques: Expressing, Staining, Immunostaining, Immunofluorescence

    Appearance of CLEC10A-expressing monocytic cells and coexistence of CLEC10A ligand on pancreatic cancer cells are poor prognostic factors in stage II and III cases. ( a ) Representative images of formalin-fixed paraffin-embedded (FFPE) sections of clinical pancreatic cancer tissues stained with anti-CLEC10A antibody. Scale bars, 100 μm. Staining intensity was scored according to the number of positive cells in the 20× field of view as follows: 0 (0 fields); 1+ (1–2 fields); 2+ (> 3 fields). ( b ) Classification based on the combination of CLEC10A and CLEC10A ligand expression intensity. ( c ) Kaplan–Meier curve comparing category Low ( n = 23) with category High ( n = 5). Log-rank test (* P < 0.05) was used.

    Journal: Scientific Reports

    Article Title: Identification of CLEC10A as a human lectin for pancreatic ductal adenocarcinoma

    doi: 10.1038/s41598-025-02404-1

    Figure Lengend Snippet: Appearance of CLEC10A-expressing monocytic cells and coexistence of CLEC10A ligand on pancreatic cancer cells are poor prognostic factors in stage II and III cases. ( a ) Representative images of formalin-fixed paraffin-embedded (FFPE) sections of clinical pancreatic cancer tissues stained with anti-CLEC10A antibody. Scale bars, 100 μm. Staining intensity was scored according to the number of positive cells in the 20× field of view as follows: 0 (0 fields); 1+ (1–2 fields); 2+ (> 3 fields). ( b ) Classification based on the combination of CLEC10A and CLEC10A ligand expression intensity. ( c ) Kaplan–Meier curve comparing category Low ( n = 23) with category High ( n = 5). Log-rank test (* P < 0.05) was used.

    Article Snippet: Sections were blocked using peroxidase blocking solution (Agilent; Cat# K8000) for 5 min, washed in wash buffer, and incubated with mouse anti-human CLEC10A monoclonal antibody (1:500, clone OTI2B10, OriGene, Rockville, MD, USA; Cat# TA810180) for 20 min.

    Techniques: Expressing, Formalin-fixed Paraffin-Embedded, Staining

    Three lectins, Galectin-4 C, Galectin-8 C, and CLEC10A-Fc, were extracted as candidate human endogenous lectins that recognize pancreatic cancer cells. ( a ) Among the 43 lectins, pancreatic cancer-reactive lectins were screened using flow cytometry. The difference (ΔMFI) between the median fluorescence intensity (MFI) of each lectin and the MFI of the control is shown in the heat map. Red arrows indicate lectins that met the criteria of MFI greater than 10 4 for the pancreatic cancer cell lines, Capan-1 or AsPC-1, and less than 10 4 for the pancreatic ductal cell line, hTERT-HPNE. ( b ) Histograms of Galectin-4 C, Galectin-8 C, and CLEC10A-Fc. The gray-filled histogram indicates control cells stained with PE-labeled BSA (for galectins) or PE-labeled anti-Fc antibody (for C-type lectins) used as negative controls, and the cyan line is the histogram of cells incubated with PE-labeled galectins or C-type lectins followed by PE-labeled anti-Fc antibody.

    Journal: Scientific Reports

    Article Title: Identification of CLEC10A as a human lectin for pancreatic ductal adenocarcinoma

    doi: 10.1038/s41598-025-02404-1

    Figure Lengend Snippet: Three lectins, Galectin-4 C, Galectin-8 C, and CLEC10A-Fc, were extracted as candidate human endogenous lectins that recognize pancreatic cancer cells. ( a ) Among the 43 lectins, pancreatic cancer-reactive lectins were screened using flow cytometry. The difference (ΔMFI) between the median fluorescence intensity (MFI) of each lectin and the MFI of the control is shown in the heat map. Red arrows indicate lectins that met the criteria of MFI greater than 10 4 for the pancreatic cancer cell lines, Capan-1 or AsPC-1, and less than 10 4 for the pancreatic ductal cell line, hTERT-HPNE. ( b ) Histograms of Galectin-4 C, Galectin-8 C, and CLEC10A-Fc. The gray-filled histogram indicates control cells stained with PE-labeled BSA (for galectins) or PE-labeled anti-Fc antibody (for C-type lectins) used as negative controls, and the cyan line is the histogram of cells incubated with PE-labeled galectins or C-type lectins followed by PE-labeled anti-Fc antibody.

    Article Snippet: Samples were pre-incubated with mouse anti-human CLEC10A monoclonal antibody (1:500, clone OTI2B10, OriGene; Cat# TA810180) and Alexa Fluor 488-conjugated rabbit anti-CD163 monoclonal antibody (1:500, clone EPR19518 , Abcam, Cambridge, UK; Cat# AB313665 ) at room temperature for 30 min.

    Techniques: Flow Cytometry, Fluorescence, Control, Staining, Labeling, Incubation

    CLEC10A is a human endogenous lectin with high affinity for pancreatic cancer cells. ( a ) Representative images of pancreatic cancerous and noncancerous tissues stained with three lectins (Galectin-4 C, Galectin-8 C, and CLEC10A-Fc). Scale bars, 10 μm. The arrowhead (▼) indicates the positive staining of the cell membrane. ( b ) Percentage of cases positive for lectin staining in pancreatic cancer cells (C) and pancreatic duct cells (N) in noncancerous tissue compared using Fisher’s exact test (NS: not significant, * P < 0.05).

    Journal: Scientific Reports

    Article Title: Identification of CLEC10A as a human lectin for pancreatic ductal adenocarcinoma

    doi: 10.1038/s41598-025-02404-1

    Figure Lengend Snippet: CLEC10A is a human endogenous lectin with high affinity for pancreatic cancer cells. ( a ) Representative images of pancreatic cancerous and noncancerous tissues stained with three lectins (Galectin-4 C, Galectin-8 C, and CLEC10A-Fc). Scale bars, 10 μm. The arrowhead (▼) indicates the positive staining of the cell membrane. ( b ) Percentage of cases positive for lectin staining in pancreatic cancer cells (C) and pancreatic duct cells (N) in noncancerous tissue compared using Fisher’s exact test (NS: not significant, * P < 0.05).

    Article Snippet: Samples were pre-incubated with mouse anti-human CLEC10A monoclonal antibody (1:500, clone OTI2B10, OriGene; Cat# TA810180) and Alexa Fluor 488-conjugated rabbit anti-CD163 monoclonal antibody (1:500, clone EPR19518 , Abcam, Cambridge, UK; Cat# AB313665 ) at room temperature for 30 min.

    Techniques: Staining, Membrane

    CLEC10A ligand is expressed in 60% of clinical pancreatic cancer cells. ( a ) Representative images of histochemically processed sections of clinical pancreatic cancer tissue analyzed for CLEC10A-Fc staining. Scale bars (Large window) 200 μm, (Small window) 10 μm. Staining intensity was scored according to the percentage of positive cells regardless of staining intensity as follows: 0, 0%; 1+, < 1%; 2+, 1–24; 3+, 25–49%; 4+, 50–74%; 5+, 75–100%. ( b ) A pie chart showing the percentage of each staining score in 113 processed sections of clinical pancreatic cancer tissue stained with CLEC10A-Fc.

    Journal: Scientific Reports

    Article Title: Identification of CLEC10A as a human lectin for pancreatic ductal adenocarcinoma

    doi: 10.1038/s41598-025-02404-1

    Figure Lengend Snippet: CLEC10A ligand is expressed in 60% of clinical pancreatic cancer cells. ( a ) Representative images of histochemically processed sections of clinical pancreatic cancer tissue analyzed for CLEC10A-Fc staining. Scale bars (Large window) 200 μm, (Small window) 10 μm. Staining intensity was scored according to the percentage of positive cells regardless of staining intensity as follows: 0, 0%; 1+, < 1%; 2+, 1–24; 3+, 25–49%; 4+, 50–74%; 5+, 75–100%. ( b ) A pie chart showing the percentage of each staining score in 113 processed sections of clinical pancreatic cancer tissue stained with CLEC10A-Fc.

    Article Snippet: Samples were pre-incubated with mouse anti-human CLEC10A monoclonal antibody (1:500, clone OTI2B10, OriGene; Cat# TA810180) and Alexa Fluor 488-conjugated rabbit anti-CD163 monoclonal antibody (1:500, clone EPR19518 , Abcam, Cambridge, UK; Cat# AB313665 ) at room temperature for 30 min.

    Techniques: Staining

    CLEC10A-expressing monocytic cells in pancreatic cancer stroma. ( a ) Left: Hematoxylin and eosin staining of representative pancreatic cancer tissue. Scale bars, 50 μm. Right: Immunostaining with anti-CLEC10A antibody in representative pancreatic cancer tissue. Scale bars, 50 μm. Cancer duct structures are surrounded by dotted lines (---); CLEC10A-expressing cells are indicated by arrowheads (▼). ( b ) Immunofluorescence staining of CLEC10A (red), CD163 (green), and nuclei (blue) in pancreatic cancer tissue; merge: yellow. Scale bars, 50 μm.

    Journal: Scientific Reports

    Article Title: Identification of CLEC10A as a human lectin for pancreatic ductal adenocarcinoma

    doi: 10.1038/s41598-025-02404-1

    Figure Lengend Snippet: CLEC10A-expressing monocytic cells in pancreatic cancer stroma. ( a ) Left: Hematoxylin and eosin staining of representative pancreatic cancer tissue. Scale bars, 50 μm. Right: Immunostaining with anti-CLEC10A antibody in representative pancreatic cancer tissue. Scale bars, 50 μm. Cancer duct structures are surrounded by dotted lines (---); CLEC10A-expressing cells are indicated by arrowheads (▼). ( b ) Immunofluorescence staining of CLEC10A (red), CD163 (green), and nuclei (blue) in pancreatic cancer tissue; merge: yellow. Scale bars, 50 μm.

    Article Snippet: Samples were pre-incubated with mouse anti-human CLEC10A monoclonal antibody (1:500, clone OTI2B10, OriGene; Cat# TA810180) and Alexa Fluor 488-conjugated rabbit anti-CD163 monoclonal antibody (1:500, clone EPR19518 , Abcam, Cambridge, UK; Cat# AB313665 ) at room temperature for 30 min.

    Techniques: Expressing, Staining, Immunostaining, Immunofluorescence

    Appearance of CLEC10A-expressing monocytic cells and coexistence of CLEC10A ligand on pancreatic cancer cells are poor prognostic factors in stage II and III cases. ( a ) Representative images of formalin-fixed paraffin-embedded (FFPE) sections of clinical pancreatic cancer tissues stained with anti-CLEC10A antibody. Scale bars, 100 μm. Staining intensity was scored according to the number of positive cells in the 20× field of view as follows: 0 (0 fields); 1+ (1–2 fields); 2+ (> 3 fields). ( b ) Classification based on the combination of CLEC10A and CLEC10A ligand expression intensity. ( c ) Kaplan–Meier curve comparing category Low ( n = 23) with category High ( n = 5). Log-rank test (* P < 0.05) was used.

    Journal: Scientific Reports

    Article Title: Identification of CLEC10A as a human lectin for pancreatic ductal adenocarcinoma

    doi: 10.1038/s41598-025-02404-1

    Figure Lengend Snippet: Appearance of CLEC10A-expressing monocytic cells and coexistence of CLEC10A ligand on pancreatic cancer cells are poor prognostic factors in stage II and III cases. ( a ) Representative images of formalin-fixed paraffin-embedded (FFPE) sections of clinical pancreatic cancer tissues stained with anti-CLEC10A antibody. Scale bars, 100 μm. Staining intensity was scored according to the number of positive cells in the 20× field of view as follows: 0 (0 fields); 1+ (1–2 fields); 2+ (> 3 fields). ( b ) Classification based on the combination of CLEC10A and CLEC10A ligand expression intensity. ( c ) Kaplan–Meier curve comparing category Low ( n = 23) with category High ( n = 5). Log-rank test (* P < 0.05) was used.

    Article Snippet: Samples were pre-incubated with mouse anti-human CLEC10A monoclonal antibody (1:500, clone OTI2B10, OriGene; Cat# TA810180) and Alexa Fluor 488-conjugated rabbit anti-CD163 monoclonal antibody (1:500, clone EPR19518 , Abcam, Cambridge, UK; Cat# AB313665 ) at room temperature for 30 min.

    Techniques: Expressing, Formalin-fixed Paraffin-Embedded, Staining