Review




Structured Review

Bio-Rad bcl 2
a Schematic of the <t>human</t> <t>BCL-2</t> construct and CFP/BCL-2stop fl/+ mouse. b Primary lung fibroblasts from PDGFRα-CFP/BCL-2 + mice express hBCL-2 that co-localizes with Mitotracker Red (63X) ( n = 3 experimental replicates). Additional images show overlays of phalloidin and CFP (40X). By Western Blot, ( c ) fibroblasts from PDGFRα-CFP/BCL-2 + mice express CFP (detected with anti-GFP antibody) and BCL-2 which is located within ( d ) the mitochondrial fraction ( n = 3 experimental replicates). Caspase 3/7 activity in CFP/BCL-2 - and CFP/BCL-2 + fibroblasts after treatment with ( e ) staurosporine ( n = 9 experimental replicates, +/−SD, 2-tailed t test with Welch’s correction, *** p < 0.001) or ( f ) Jo2 +/- TNF-α/IFNγ ( n = 3 experimental replicates, +/-SD, 2-tailed t test with Welch’s correction, ** p < 0.01). g endogenous CFP expression (teal) in naïve lungs of PDGFRα-CFP/BCL-2 + mice co-immunostained BCL-2 (red) or with lineage cell markers (red or yellow) for PDGFRα, PDGFRβ, αSMA, proSPC, CCSP, CD45 and CD31 (20x). h Flow cytometry gating of PDGFRα and PDGFRβ populations from lineage negative cells (CD45 - /CD31 - /EpCAM - ). Broad PDGFRα + gating (pink gate) can be further sub populated into PDGFRα + only (CFP + , orange gate) and PDGFRα + /β + (CFP + , black gate). PDGFRβ + only pericytes (CFP -, red gate) are PDGFRα - . i Geometric mean of CFP expression in lineage sorted lung cell populations ( n = 4 mice/group, +/-SEM, 2-tailed t test with Welch’s correction, *** p < 0.001) and ( j ) flow cytometry histograms. CO = corn oil, Tamox = tamoxifen. Source data for c , d , e , f and i are provided as a Source Data file.
Bcl 2, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+bcl+2/pmc13066449-263-3-4?v=Bio-Rad
Average 93 stars, based on 25 article reviews
bcl 2 - by Bioz Stars, 2026-08
93/100 stars

Images

1) Product Images from "Conditional BCL-2 Expression in Fibroblasts Promotes Persistent Pulmonary Fibrosis which is Reversible by Therapeutic BCL-2 Inhibition"

Article Title: Conditional BCL-2 Expression in Fibroblasts Promotes Persistent Pulmonary Fibrosis which is Reversible by Therapeutic BCL-2 Inhibition

Journal: Nature Communications

doi: 10.1038/s41467-026-69865-4

a Schematic of the human BCL-2 construct and CFP/BCL-2stop fl/+ mouse. b Primary lung fibroblasts from PDGFRα-CFP/BCL-2 + mice express hBCL-2 that co-localizes with Mitotracker Red (63X) ( n = 3 experimental replicates). Additional images show overlays of phalloidin and CFP (40X). By Western Blot, ( c ) fibroblasts from PDGFRα-CFP/BCL-2 + mice express CFP (detected with anti-GFP antibody) and BCL-2 which is located within ( d ) the mitochondrial fraction ( n = 3 experimental replicates). Caspase 3/7 activity in CFP/BCL-2 - and CFP/BCL-2 + fibroblasts after treatment with ( e ) staurosporine ( n = 9 experimental replicates, +/−SD, 2-tailed t test with Welch’s correction, *** p < 0.001) or ( f ) Jo2 +/- TNF-α/IFNγ ( n = 3 experimental replicates, +/-SD, 2-tailed t test with Welch’s correction, ** p < 0.01). g endogenous CFP expression (teal) in naïve lungs of PDGFRα-CFP/BCL-2 + mice co-immunostained BCL-2 (red) or with lineage cell markers (red or yellow) for PDGFRα, PDGFRβ, αSMA, proSPC, CCSP, CD45 and CD31 (20x). h Flow cytometry gating of PDGFRα and PDGFRβ populations from lineage negative cells (CD45 - /CD31 - /EpCAM - ). Broad PDGFRα + gating (pink gate) can be further sub populated into PDGFRα + only (CFP + , orange gate) and PDGFRα + /β + (CFP + , black gate). PDGFRβ + only pericytes (CFP -, red gate) are PDGFRα - . i Geometric mean of CFP expression in lineage sorted lung cell populations ( n = 4 mice/group, +/-SEM, 2-tailed t test with Welch’s correction, *** p < 0.001) and ( j ) flow cytometry histograms. CO = corn oil, Tamox = tamoxifen. Source data for c , d , e , f and i are provided as a Source Data file.
Figure Legend Snippet: a Schematic of the human BCL-2 construct and CFP/BCL-2stop fl/+ mouse. b Primary lung fibroblasts from PDGFRα-CFP/BCL-2 + mice express hBCL-2 that co-localizes with Mitotracker Red (63X) ( n = 3 experimental replicates). Additional images show overlays of phalloidin and CFP (40X). By Western Blot, ( c ) fibroblasts from PDGFRα-CFP/BCL-2 + mice express CFP (detected with anti-GFP antibody) and BCL-2 which is located within ( d ) the mitochondrial fraction ( n = 3 experimental replicates). Caspase 3/7 activity in CFP/BCL-2 - and CFP/BCL-2 + fibroblasts after treatment with ( e ) staurosporine ( n = 9 experimental replicates, +/−SD, 2-tailed t test with Welch’s correction, *** p < 0.001) or ( f ) Jo2 +/- TNF-α/IFNγ ( n = 3 experimental replicates, +/-SD, 2-tailed t test with Welch’s correction, ** p < 0.01). g endogenous CFP expression (teal) in naïve lungs of PDGFRα-CFP/BCL-2 + mice co-immunostained BCL-2 (red) or with lineage cell markers (red or yellow) for PDGFRα, PDGFRβ, αSMA, proSPC, CCSP, CD45 and CD31 (20x). h Flow cytometry gating of PDGFRα and PDGFRβ populations from lineage negative cells (CD45 - /CD31 - /EpCAM - ). Broad PDGFRα + gating (pink gate) can be further sub populated into PDGFRα + only (CFP + , orange gate) and PDGFRα + /β + (CFP + , black gate). PDGFRβ + only pericytes (CFP -, red gate) are PDGFRα - . i Geometric mean of CFP expression in lineage sorted lung cell populations ( n = 4 mice/group, +/-SEM, 2-tailed t test with Welch’s correction, *** p < 0.001) and ( j ) flow cytometry histograms. CO = corn oil, Tamox = tamoxifen. Source data for c , d , e , f and i are provided as a Source Data file.

Techniques Used: Construct, Western Blot, Activity Assay, Expressing, Flow Cytometry

a Schematic of in vivo tamoxifen or corn oil treatment of PDGFRα-CFP/BCL-2 fl/+ mice. b Immunofluorescent staining of PDGFRα (magenta), PDGFRβ (green) and TUNEL (white) in PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice 3 weeks after bleomycin. c Quantification of TUNEL + cells per high power field. Data is mean +/− SEM, n = 5. * p < 0.05, ** p < 0.01, *** p < 0.001. Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons. Upper panels 20X, lower panels 40X. Source data for c is provided as a Source Data file.
Figure Legend Snippet: a Schematic of in vivo tamoxifen or corn oil treatment of PDGFRα-CFP/BCL-2 fl/+ mice. b Immunofluorescent staining of PDGFRα (magenta), PDGFRβ (green) and TUNEL (white) in PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice 3 weeks after bleomycin. c Quantification of TUNEL + cells per high power field. Data is mean +/− SEM, n = 5. * p < 0.05, ** p < 0.01, *** p < 0.001. Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons. Upper panels 20X, lower panels 40X. Source data for c is provided as a Source Data file.

Techniques Used: In Vivo, Staining, TUNEL Assay

a Schematic of in vivo tamoxifen or corn oil treatment and time course of harvest in PDGFRα-CFP/BCL-2 fl/+ mice. b – d Quantification of PDGFRα + and PDGFRα + /β + fibroblasts and PDGFRβ + pericytes over time. e – g Frequency of CFP + PDGFRα + and PDGFRα + /β + fibroblasts and PDGFRβ + pericytes in PDGFRα-CFP/BCL-2 + mice after saline or bleomycin treatment. (h-i upper panels) CFP (teal), PDGFRα (magenta) and PDGFRβ (green) immunofluorescent staining of lungs over time after bleomycin in PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice. h – i lower panels) human BCL-2 (green) immunofluorescent staining of lungs over time after bleomycin in PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice. PDGFRα-CFP/BCL-2 + saline n = 4 mice/time point. PDGFRα-CFP/BCL-2 + bleomycin n = 5 mice/time point. PDGFRα-CFP/BCL-2 - saline n = 6 mice 0wk, 4 mice 3, 6, 12 wk, 5 mice 9 wk. PDGFRα-CFP/BCL-2 - bleomycin n = 5 mice/time point. Data is mean +/- SEM, Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons * p < 0.05, ** p < 0.01, *** p < 0.001 compared to saline. # p < 0.05 9wk PDGFRα-CFP/BCL-2 + compared to other 9-week animals. ## p < 0.01, 6- and 12-week PDGFRα-CFP/BCL-2 + compared to other 6- and 12-week animals respectively. Upper panels 20X, lower panels 40X. Source data for b – g are provided as a Source Data file.
Figure Legend Snippet: a Schematic of in vivo tamoxifen or corn oil treatment and time course of harvest in PDGFRα-CFP/BCL-2 fl/+ mice. b – d Quantification of PDGFRα + and PDGFRα + /β + fibroblasts and PDGFRβ + pericytes over time. e – g Frequency of CFP + PDGFRα + and PDGFRα + /β + fibroblasts and PDGFRβ + pericytes in PDGFRα-CFP/BCL-2 + mice after saline or bleomycin treatment. (h-i upper panels) CFP (teal), PDGFRα (magenta) and PDGFRβ (green) immunofluorescent staining of lungs over time after bleomycin in PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice. h – i lower panels) human BCL-2 (green) immunofluorescent staining of lungs over time after bleomycin in PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice. PDGFRα-CFP/BCL-2 + saline n = 4 mice/time point. PDGFRα-CFP/BCL-2 + bleomycin n = 5 mice/time point. PDGFRα-CFP/BCL-2 - saline n = 6 mice 0wk, 4 mice 3, 6, 12 wk, 5 mice 9 wk. PDGFRα-CFP/BCL-2 - bleomycin n = 5 mice/time point. Data is mean +/- SEM, Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons * p < 0.05, ** p < 0.01, *** p < 0.001 compared to saline. # p < 0.05 9wk PDGFRα-CFP/BCL-2 + compared to other 9-week animals. ## p < 0.01, 6- and 12-week PDGFRα-CFP/BCL-2 + compared to other 6- and 12-week animals respectively. Upper panels 20X, lower panels 40X. Source data for b – g are provided as a Source Data file.

Techniques Used: In Vivo, Saline, Staining

a Hydroxyproline levels in the lungs over time after bleomycin in PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice. PDGFRα-CFP/BCL-2 + saline n = 4 mice/time point. PDGFRαCFP/BCL-2 + bleomycin n = 5 mice/time point. PDGFRα-CFP/BCL-2 - saline n = 6 mice 0wk, 4 mice 3, 6, 12 wk, 5 mice 9 wk. PDGFRα-CFP/BCL-2 - bleomycin n = 5 mice/time point. Data is mean +/− SEM, ** p < 0.01, *** p < 0.001 3wk bleomycin compared to saline. ** p < 0.01 and *** p < 0.01 PDGFRα-CFP/BCL-2 compared to controls. 2-tailed t test with Welch’s correction. b Representative Trichrome stained lung sections over time in PDGFRα-CFP/BCL-2 + and PDGFRα-CFP/BCL-2 + mice. Blue arrows indicate cyst formation. c Quantitation of CCSP + KRT8 + and ( d ) SPC + cells per field over the time course. e Identification of CCSP + (magenta) and Krt8 + (green) transitional cells in saline or bleomycin at 0, 3, 6, 9 and 12 weeks after bleomycin in PDGFRα-CFP/BCL-2 + (upper) and PDGFRα-CFP/BCL-2 - (lower) lungs. f Identification of pro-SPC + (magenta) alveolar epithelial cells in PDGFRα-CFP/BCL-2 + (upper) and PDGFRα-CFP/BCL-2 - (lower) lungs. Aperio scans 2x. Immunofluorescence upper panels 20X, lower panels 40X. Source data for a, c and d are provided as a Source Data file.
Figure Legend Snippet: a Hydroxyproline levels in the lungs over time after bleomycin in PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice. PDGFRα-CFP/BCL-2 + saline n = 4 mice/time point. PDGFRαCFP/BCL-2 + bleomycin n = 5 mice/time point. PDGFRα-CFP/BCL-2 - saline n = 6 mice 0wk, 4 mice 3, 6, 12 wk, 5 mice 9 wk. PDGFRα-CFP/BCL-2 - bleomycin n = 5 mice/time point. Data is mean +/− SEM, ** p < 0.01, *** p < 0.001 3wk bleomycin compared to saline. ** p < 0.01 and *** p < 0.01 PDGFRα-CFP/BCL-2 compared to controls. 2-tailed t test with Welch’s correction. b Representative Trichrome stained lung sections over time in PDGFRα-CFP/BCL-2 + and PDGFRα-CFP/BCL-2 + mice. Blue arrows indicate cyst formation. c Quantitation of CCSP + KRT8 + and ( d ) SPC + cells per field over the time course. e Identification of CCSP + (magenta) and Krt8 + (green) transitional cells in saline or bleomycin at 0, 3, 6, 9 and 12 weeks after bleomycin in PDGFRα-CFP/BCL-2 + (upper) and PDGFRα-CFP/BCL-2 - (lower) lungs. f Identification of pro-SPC + (magenta) alveolar epithelial cells in PDGFRα-CFP/BCL-2 + (upper) and PDGFRα-CFP/BCL-2 - (lower) lungs. Aperio scans 2x. Immunofluorescence upper panels 20X, lower panels 40X. Source data for a, c and d are provided as a Source Data file.

Techniques Used: Saline, Staining, Quantitation Assay, Immunofluorescence

a Dot plot representation of enriched Gene Ontology (GO) terms 3 weeks after bleomycin from PDGFRα-CFP/BCL-2 + fibroblasts compared to PDGFRα-CFP/BCL-2 - fibroblasts. b Differential gene expression associated with ECM organization ( c ) Box-and-whisker plots of ECM and pro-fibrotic genes expressed during non-resolving fibrosis in PDGFRα-CFP/BCL-2 + fibroblasts. Differential gene expression associated with ( d ) senescence regulation and ( e ) p53 signaling. f Box-and-whisker plots of key senescence and p53 associated genes in non-resolving PDGFRα-CFP/BCL-2 + fibroblasts. g Dot plot representation of enriched GO terms 6 weeks after bleomycin from PDGFRα-CFP/BCL-2 + fibroblasts compared to PDGFRα-CFP/BCL-2 - fibroblasts. Differential gene expression associated with ( h ) ECM disassembly and ( i ) box-and-whisker plots of genes expressed during resolving fibrosis in PDGFRα-CFP/BCL-2 - fibroblasts. Differential gene expression associated with ( j ) regulation of apoptotic signaling and ( k ) regulation of Wnt signaling in naïve, PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + fibroblasts. l Box-and-whisker plots of genes expressed during Wnt signaling in naïve, PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + fibroblasts. Heat maps generated with significant differentially expressed genes identified from GO BP pathways. c , f , i , l Box-and-whisker plots ( n = 4 biological replicates/group, mean; whiskers: min to max) are normalized TPM values with pAdj from DE analysis * p < 0.05, ** p < 0.01, *** p < 0.01. ECM, extracellular matrix. Avg NE = Average normalized expression. N Overlap = number of DEGs significantly expressed in the pathway. Source data for a – l are provided as a Source Data file.
Figure Legend Snippet: a Dot plot representation of enriched Gene Ontology (GO) terms 3 weeks after bleomycin from PDGFRα-CFP/BCL-2 + fibroblasts compared to PDGFRα-CFP/BCL-2 - fibroblasts. b Differential gene expression associated with ECM organization ( c ) Box-and-whisker plots of ECM and pro-fibrotic genes expressed during non-resolving fibrosis in PDGFRα-CFP/BCL-2 + fibroblasts. Differential gene expression associated with ( d ) senescence regulation and ( e ) p53 signaling. f Box-and-whisker plots of key senescence and p53 associated genes in non-resolving PDGFRα-CFP/BCL-2 + fibroblasts. g Dot plot representation of enriched GO terms 6 weeks after bleomycin from PDGFRα-CFP/BCL-2 + fibroblasts compared to PDGFRα-CFP/BCL-2 - fibroblasts. Differential gene expression associated with ( h ) ECM disassembly and ( i ) box-and-whisker plots of genes expressed during resolving fibrosis in PDGFRα-CFP/BCL-2 - fibroblasts. Differential gene expression associated with ( j ) regulation of apoptotic signaling and ( k ) regulation of Wnt signaling in naïve, PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + fibroblasts. l Box-and-whisker plots of genes expressed during Wnt signaling in naïve, PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + fibroblasts. Heat maps generated with significant differentially expressed genes identified from GO BP pathways. c , f , i , l Box-and-whisker plots ( n = 4 biological replicates/group, mean; whiskers: min to max) are normalized TPM values with pAdj from DE analysis * p < 0.05, ** p < 0.01, *** p < 0.01. ECM, extracellular matrix. Avg NE = Average normalized expression. N Overlap = number of DEGs significantly expressed in the pathway. Source data for a – l are provided as a Source Data file.

Techniques Used: Gene Expression, Whisker Assay, Generated, Expressing

a Heat maps of differential gene expression associated with regulation of cellular senescence in fibroblasts from PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice 6 weeks after bleomycin. b Senescence gene score ( n = 4 mice/group, mean +/− SEM, * p < 0.01, Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons.) and ( c ) BCL-2 Pearson Correlation maps for 111 senescence associated genes in naïve, PDGFRα-CFP/BCL-2 - , PDGFRα-CFP/BCL-2 + fibroblasts. d – f Quantification of fibroblasts/field for p21, p16 and SA-β-gal from control and persistently fibrotic lungs from PDGFRα-CFP/BCL-2 - , PDGFRα-CFP/BCL-2 + mice ( n = 4 mice/group, mean +/− SEM of 10 individual images/mouse graphed as scatter plot with bar mean +/− SEM, *** p < 0.001, 2-tailed t test with Welch’s correction.). Immunofluorescence images for ( g ) PDGFRα (magenta) and PDGFRβ (green), ( h ) human BCL-2 (green), ( i ) p21 (yellow), ( j ) p16 (magenta) and ( k ) SA-β-gal (white). SA-β-gal, senescence associated-β-galactosidase. White arrow heads indicate shared features in serial sections. Spatial transcriptomic analysis of IPF lung. l H&E section ( m ) spatial map of cellular populations ( n ) BCL-2 expression map (red, individual transcripts) overlayed with myofibroblasts (yellow, cell boundaries) and ( o ) 10 gene senescence module ENV score. [A-C dotted line callouts are enlarged areas to show cell boundary, BCL-2 expression and senescence ENV score overlays]. p Heat maps of differential pro-fibrotic genes and senescence genes between BCL-2 + myofibroblasts and BCL-2 - myofibroblasts from the spatial transcriptomic data. q Myofibroblast cell counts between control IPF and BCL-2 + myofibroblast + counts from control and IPF spatial images (* p < 0.05 and *** p < 0.001, 2-tailed t test with Welch’s correction). r Quantification of α-SMA + myofibroblasts/field for BCL-2 in control and IPF lung sections (individual images graphed as scatter plot with bar mean +/- SEM, *** p < 0.001, 2-tailed t test with Welch’s correction). Immunofluorescent images of control and IPF lungs stained for ( s ) αSMA (magenta) and BCL-2 (green), ( t ) α-SMA (green) and p16 (magenta), ( u ) p21 (yellow), ( v ) SA-β-Gal (white). Images n = 5 subjects/group. Spatial transcript analysis n = 13 controls, n = 15 IPF Immunofluorescence panels 20X. 10 images/mouse for immunofluorescent quantitation. SA-β-gal, senescence associated-β-galactosidase. Cor coe = correlation coefficient. Source data are provided for a – f and p – r as a Source Data file.
Figure Legend Snippet: a Heat maps of differential gene expression associated with regulation of cellular senescence in fibroblasts from PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice 6 weeks after bleomycin. b Senescence gene score ( n = 4 mice/group, mean +/− SEM, * p < 0.01, Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons.) and ( c ) BCL-2 Pearson Correlation maps for 111 senescence associated genes in naïve, PDGFRα-CFP/BCL-2 - , PDGFRα-CFP/BCL-2 + fibroblasts. d – f Quantification of fibroblasts/field for p21, p16 and SA-β-gal from control and persistently fibrotic lungs from PDGFRα-CFP/BCL-2 - , PDGFRα-CFP/BCL-2 + mice ( n = 4 mice/group, mean +/− SEM of 10 individual images/mouse graphed as scatter plot with bar mean +/− SEM, *** p < 0.001, 2-tailed t test with Welch’s correction.). Immunofluorescence images for ( g ) PDGFRα (magenta) and PDGFRβ (green), ( h ) human BCL-2 (green), ( i ) p21 (yellow), ( j ) p16 (magenta) and ( k ) SA-β-gal (white). SA-β-gal, senescence associated-β-galactosidase. White arrow heads indicate shared features in serial sections. Spatial transcriptomic analysis of IPF lung. l H&E section ( m ) spatial map of cellular populations ( n ) BCL-2 expression map (red, individual transcripts) overlayed with myofibroblasts (yellow, cell boundaries) and ( o ) 10 gene senescence module ENV score. [A-C dotted line callouts are enlarged areas to show cell boundary, BCL-2 expression and senescence ENV score overlays]. p Heat maps of differential pro-fibrotic genes and senescence genes between BCL-2 + myofibroblasts and BCL-2 - myofibroblasts from the spatial transcriptomic data. q Myofibroblast cell counts between control IPF and BCL-2 + myofibroblast + counts from control and IPF spatial images (* p < 0.05 and *** p < 0.001, 2-tailed t test with Welch’s correction). r Quantification of α-SMA + myofibroblasts/field for BCL-2 in control and IPF lung sections (individual images graphed as scatter plot with bar mean +/- SEM, *** p < 0.001, 2-tailed t test with Welch’s correction). Immunofluorescent images of control and IPF lungs stained for ( s ) αSMA (magenta) and BCL-2 (green), ( t ) α-SMA (green) and p16 (magenta), ( u ) p21 (yellow), ( v ) SA-β-Gal (white). Images n = 5 subjects/group. Spatial transcript analysis n = 13 controls, n = 15 IPF Immunofluorescence panels 20X. 10 images/mouse for immunofluorescent quantitation. SA-β-gal, senescence associated-β-galactosidase. Cor coe = correlation coefficient. Source data are provided for a – f and p – r as a Source Data file.

Techniques Used: Gene Expression, Control, Immunofluorescence, Expressing, Staining, Quantitation Assay

a Heat maps of differential gene expression associated with regulation of cellular senescence in fibroblasts from two non-resolving models of fibrosis; repetitive bleomycin and Col1a1-Fas -/- . b Quantitative senescence Z-score and ( n = 4 mice/group, mean +/- SEM, ** p < 0.01, Brown-Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons.) c Bcl-2 Pearson Correlation maps for senescence associated genes ( p < 0.05) in repetitive bleomycin and Col1a1-Fas -/- fibroblasts. Immunofluorescent images and quantitation of fibroblasts/per field from control and persistently fibrotic lungs from repetitive bleomycin and Col1a1-Fas -/- mice for ( d ) PDGFRα (magenta) and PDGFRβ (green), ( e ) murine Bcl-2 (green), ( f ) p21 (yellow), ( g ) p16 (magenta) and ( h ) SA-β-Gal (white). d – h 5 mice/group; individual images graphed as scatter plot with bar mean + /-SEM, * p < 0.05, *** p < 0.001 Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons. Immunofluorescence panels 20X. SA-β-gal, senescence associated-β-galactosidase. Avg NE = Average normalized expression. Cor coe = correlation coefficient. nsd = no significant difference. Source data are for a – c and e – h provided as a Source Data file. Data for Col1a1-Fas -/- fibroblasts (GEO: GSE161648 ) were previously published 11 .
Figure Legend Snippet: a Heat maps of differential gene expression associated with regulation of cellular senescence in fibroblasts from two non-resolving models of fibrosis; repetitive bleomycin and Col1a1-Fas -/- . b Quantitative senescence Z-score and ( n = 4 mice/group, mean +/- SEM, ** p < 0.01, Brown-Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons.) c Bcl-2 Pearson Correlation maps for senescence associated genes ( p < 0.05) in repetitive bleomycin and Col1a1-Fas -/- fibroblasts. Immunofluorescent images and quantitation of fibroblasts/per field from control and persistently fibrotic lungs from repetitive bleomycin and Col1a1-Fas -/- mice for ( d ) PDGFRα (magenta) and PDGFRβ (green), ( e ) murine Bcl-2 (green), ( f ) p21 (yellow), ( g ) p16 (magenta) and ( h ) SA-β-Gal (white). d – h 5 mice/group; individual images graphed as scatter plot with bar mean + /-SEM, * p < 0.05, *** p < 0.001 Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons. Immunofluorescence panels 20X. SA-β-gal, senescence associated-β-galactosidase. Avg NE = Average normalized expression. Cor coe = correlation coefficient. nsd = no significant difference. Source data are for a – c and e – h provided as a Source Data file. Data for Col1a1-Fas -/- fibroblasts (GEO: GSE161648 ) were previously published 11 .

Techniques Used: Gene Expression, Quantitation Assay, Control, Immunofluorescence, Expressing

a Schematic of fibrosis induction and therapeutic dosing schedule with ABT-199. b Hydroxyproline content of lungs at 9 weeks, ( c – d ) Quantification of PDGFRα + fibroblasts and PDGFRβ + pericytes. e representative axial images (red overlay indicates disease area) and ( f ) 3D reconstructions (non-aerated fibrotic lung in blue, aerated lung in gray). g arterial oxygen saturation and ( h ) quantified non-aerated lung volume measured by micro-CT. i Representative Trichrome stained lung sections and semi-quantitative histology scoring after vehicle or ABT-199 treatment. b – i n = 5 mice/group, time-course line graphs mean +/− SEM. * p < 0.05, ** p < 0.01, *** p < 0.001, Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons). j – k Representative immunofluorescent staining and quantitation of fibroblasts/per field in vehicle and ABT-199 treated PDGFRα-CFP/BCL-2 + mice for p21 (yellow), p16 (magenta) and SA-β-gal (white). Aperio scans 2x, panels 10x. Immunofluorescence panels 20X. n = 5 mice/group; individual images graphed as scatter plot with bar mean + /−SEM, * p < 0.05, ** p < 0.01, *** p < 0.001, Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons. Source data for b – d , g , h and j are provided as a Source Data file.
Figure Legend Snippet: a Schematic of fibrosis induction and therapeutic dosing schedule with ABT-199. b Hydroxyproline content of lungs at 9 weeks, ( c – d ) Quantification of PDGFRα + fibroblasts and PDGFRβ + pericytes. e representative axial images (red overlay indicates disease area) and ( f ) 3D reconstructions (non-aerated fibrotic lung in blue, aerated lung in gray). g arterial oxygen saturation and ( h ) quantified non-aerated lung volume measured by micro-CT. i Representative Trichrome stained lung sections and semi-quantitative histology scoring after vehicle or ABT-199 treatment. b – i n = 5 mice/group, time-course line graphs mean +/− SEM. * p < 0.05, ** p < 0.01, *** p < 0.001, Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons). j – k Representative immunofluorescent staining and quantitation of fibroblasts/per field in vehicle and ABT-199 treated PDGFRα-CFP/BCL-2 + mice for p21 (yellow), p16 (magenta) and SA-β-gal (white). Aperio scans 2x, panels 10x. Immunofluorescence panels 20X. n = 5 mice/group; individual images graphed as scatter plot with bar mean + /−SEM, * p < 0.05, ** p < 0.01, *** p < 0.001, Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons. Source data for b – d , g , h and j are provided as a Source Data file.

Techniques Used: Micro-CT, Staining, Quantitation Assay, Immunofluorescence



Similar Products

94
Shanghai Korain Biotech Co Ltd human bcl 2 elisa kit
Human Bcl 2 Elisa Kit, supplied by Shanghai Korain Biotech Co Ltd, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+bcl+2/pm41683447-251-21-25?v=Shanghai+Korain+Biotech+Co+Ltd
Average 94 stars, based on 1 article reviews
human bcl 2 elisa kit - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

93
Bio-Rad bcl 2
a Schematic of the <t>human</t> <t>BCL-2</t> construct and CFP/BCL-2stop fl/+ mouse. b Primary lung fibroblasts from PDGFRα-CFP/BCL-2 + mice express hBCL-2 that co-localizes with Mitotracker Red (63X) ( n = 3 experimental replicates). Additional images show overlays of phalloidin and CFP (40X). By Western Blot, ( c ) fibroblasts from PDGFRα-CFP/BCL-2 + mice express CFP (detected with anti-GFP antibody) and BCL-2 which is located within ( d ) the mitochondrial fraction ( n = 3 experimental replicates). Caspase 3/7 activity in CFP/BCL-2 - and CFP/BCL-2 + fibroblasts after treatment with ( e ) staurosporine ( n = 9 experimental replicates, +/−SD, 2-tailed t test with Welch’s correction, *** p < 0.001) or ( f ) Jo2 +/- TNF-α/IFNγ ( n = 3 experimental replicates, +/-SD, 2-tailed t test with Welch’s correction, ** p < 0.01). g endogenous CFP expression (teal) in naïve lungs of PDGFRα-CFP/BCL-2 + mice co-immunostained BCL-2 (red) or with lineage cell markers (red or yellow) for PDGFRα, PDGFRβ, αSMA, proSPC, CCSP, CD45 and CD31 (20x). h Flow cytometry gating of PDGFRα and PDGFRβ populations from lineage negative cells (CD45 - /CD31 - /EpCAM - ). Broad PDGFRα + gating (pink gate) can be further sub populated into PDGFRα + only (CFP + , orange gate) and PDGFRα + /β + (CFP + , black gate). PDGFRβ + only pericytes (CFP -, red gate) are PDGFRα - . i Geometric mean of CFP expression in lineage sorted lung cell populations ( n = 4 mice/group, +/-SEM, 2-tailed t test with Welch’s correction, *** p < 0.001) and ( j ) flow cytometry histograms. CO = corn oil, Tamox = tamoxifen. Source data for c , d , e , f and i are provided as a Source Data file.
Bcl 2, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+bcl+2/pmc13066449-263-3-4?v=Bio-Rad
Average 93 stars, based on 1 article reviews
bcl 2 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

94
R&D Systems aa 2 212
a Schematic of the <t>human</t> <t>BCL-2</t> construct and CFP/BCL-2stop fl/+ mouse. b Primary lung fibroblasts from PDGFRα-CFP/BCL-2 + mice express hBCL-2 that co-localizes with Mitotracker Red (63X) ( n = 3 experimental replicates). Additional images show overlays of phalloidin and CFP (40X). By Western Blot, ( c ) fibroblasts from PDGFRα-CFP/BCL-2 + mice express CFP (detected with anti-GFP antibody) and BCL-2 which is located within ( d ) the mitochondrial fraction ( n = 3 experimental replicates). Caspase 3/7 activity in CFP/BCL-2 - and CFP/BCL-2 + fibroblasts after treatment with ( e ) staurosporine ( n = 9 experimental replicates, +/−SD, 2-tailed t test with Welch’s correction, *** p < 0.001) or ( f ) Jo2 +/- TNF-α/IFNγ ( n = 3 experimental replicates, +/-SD, 2-tailed t test with Welch’s correction, ** p < 0.01). g endogenous CFP expression (teal) in naïve lungs of PDGFRα-CFP/BCL-2 + mice co-immunostained BCL-2 (red) or with lineage cell markers (red or yellow) for PDGFRα, PDGFRβ, αSMA, proSPC, CCSP, CD45 and CD31 (20x). h Flow cytometry gating of PDGFRα and PDGFRβ populations from lineage negative cells (CD45 - /CD31 - /EpCAM - ). Broad PDGFRα + gating (pink gate) can be further sub populated into PDGFRα + only (CFP + , orange gate) and PDGFRα + /β + (CFP + , black gate). PDGFRβ + only pericytes (CFP -, red gate) are PDGFRα - . i Geometric mean of CFP expression in lineage sorted lung cell populations ( n = 4 mice/group, +/-SEM, 2-tailed t test with Welch’s correction, *** p < 0.001) and ( j ) flow cytometry histograms. CO = corn oil, Tamox = tamoxifen. Source data for c , d , e , f and i are provided as a Source Data file.
Aa 2 212, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+bcl+2/pmc13046825-412-21-26?v=R%26D+Systems
Average 94 stars, based on 1 article reviews
aa 2 212 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

94
MedChemExpress human bcl 2
a Schematic of the <t>human</t> <t>BCL-2</t> construct and CFP/BCL-2stop fl/+ mouse. b Primary lung fibroblasts from PDGFRα-CFP/BCL-2 + mice express hBCL-2 that co-localizes with Mitotracker Red (63X) ( n = 3 experimental replicates). Additional images show overlays of phalloidin and CFP (40X). By Western Blot, ( c ) fibroblasts from PDGFRα-CFP/BCL-2 + mice express CFP (detected with anti-GFP antibody) and BCL-2 which is located within ( d ) the mitochondrial fraction ( n = 3 experimental replicates). Caspase 3/7 activity in CFP/BCL-2 - and CFP/BCL-2 + fibroblasts after treatment with ( e ) staurosporine ( n = 9 experimental replicates, +/−SD, 2-tailed t test with Welch’s correction, *** p < 0.001) or ( f ) Jo2 +/- TNF-α/IFNγ ( n = 3 experimental replicates, +/-SD, 2-tailed t test with Welch’s correction, ** p < 0.01). g endogenous CFP expression (teal) in naïve lungs of PDGFRα-CFP/BCL-2 + mice co-immunostained BCL-2 (red) or with lineage cell markers (red or yellow) for PDGFRα, PDGFRβ, αSMA, proSPC, CCSP, CD45 and CD31 (20x). h Flow cytometry gating of PDGFRα and PDGFRβ populations from lineage negative cells (CD45 - /CD31 - /EpCAM - ). Broad PDGFRα + gating (pink gate) can be further sub populated into PDGFRα + only (CFP + , orange gate) and PDGFRα + /β + (CFP + , black gate). PDGFRβ + only pericytes (CFP -, red gate) are PDGFRα - . i Geometric mean of CFP expression in lineage sorted lung cell populations ( n = 4 mice/group, +/-SEM, 2-tailed t test with Welch’s correction, *** p < 0.001) and ( j ) flow cytometry histograms. CO = corn oil, Tamox = tamoxifen. Source data for c , d , e , f and i are provided as a Source Data file.
Human Bcl 2, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+bcl+2/pm41706293-48-4-60?v=MedChemExpress
Average 94 stars, based on 1 article reviews
human bcl 2 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

93
Bio-Rad monoclonal mouse igg anti bcl 2 antibody
a Schematic of the <t>human</t> <t>BCL-2</t> construct and CFP/BCL-2stop fl/+ mouse. b Primary lung fibroblasts from PDGFRα-CFP/BCL-2 + mice express hBCL-2 that co-localizes with Mitotracker Red (63X) ( n = 3 experimental replicates). Additional images show overlays of phalloidin and CFP (40X). By Western Blot, ( c ) fibroblasts from PDGFRα-CFP/BCL-2 + mice express CFP (detected with anti-GFP antibody) and BCL-2 which is located within ( d ) the mitochondrial fraction ( n = 3 experimental replicates). Caspase 3/7 activity in CFP/BCL-2 - and CFP/BCL-2 + fibroblasts after treatment with ( e ) staurosporine ( n = 9 experimental replicates, +/−SD, 2-tailed t test with Welch’s correction, *** p < 0.001) or ( f ) Jo2 +/- TNF-α/IFNγ ( n = 3 experimental replicates, +/-SD, 2-tailed t test with Welch’s correction, ** p < 0.01). g endogenous CFP expression (teal) in naïve lungs of PDGFRα-CFP/BCL-2 + mice co-immunostained BCL-2 (red) or with lineage cell markers (red or yellow) for PDGFRα, PDGFRβ, αSMA, proSPC, CCSP, CD45 and CD31 (20x). h Flow cytometry gating of PDGFRα and PDGFRβ populations from lineage negative cells (CD45 - /CD31 - /EpCAM - ). Broad PDGFRα + gating (pink gate) can be further sub populated into PDGFRα + only (CFP + , orange gate) and PDGFRα + /β + (CFP + , black gate). PDGFRβ + only pericytes (CFP -, red gate) are PDGFRα - . i Geometric mean of CFP expression in lineage sorted lung cell populations ( n = 4 mice/group, +/-SEM, 2-tailed t test with Welch’s correction, *** p < 0.001) and ( j ) flow cytometry histograms. CO = corn oil, Tamox = tamoxifen. Source data for c , d , e , f and i are provided as a Source Data file.
Monoclonal Mouse Igg Anti Bcl 2 Antibody, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+bcl+2/pmc12928586-283-5-12?v=Bio-Rad
Average 93 stars, based on 1 article reviews
monoclonal mouse igg anti bcl 2 antibody - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

94
OriGene bcl 2
Effect of Lycopene and Lyc-Cub-NPs on the gene expression of A PI3K, B AKT, C mTOR, D Caspase-3, and <t>E</t> <t>Bcl-2</t> in the HT-29 cell line using qRT-PCR kits on the IC 50 concentration detected by MTT viability test (IC 50 = 95.25 and 54.04 µgml, respectively, incubation for 48 h). Data were expressed as mean ± SD ( n = 3). * means significant versus the control group, and # means significant versus the Lycopene group. Control: cancer cell without any treatments. Each group differed significantly from the others at p ≤ 0.05.
Bcl 2, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+bcl+2/pmc12895042-25-0-17?v=OriGene
Average 94 stars, based on 1 article reviews
bcl 2 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

bcl  (OriGene)
94
OriGene bcl
Effect of Lycopene and Lyc-Cub-NPs on the gene expression of A PI3K, B AKT, C mTOR, D Caspase-3, and <t>E</t> <t>Bcl-2</t> in the HT-29 cell line using qRT-PCR kits on the IC 50 concentration detected by MTT viability test (IC 50 = 95.25 and 54.04 µgml, respectively, incubation for 48 h). Data were expressed as mean ± SD ( n = 3). * means significant versus the control group, and # means significant versus the Lycopene group. Control: cancer cell without any treatments. Each group differed significantly from the others at p ≤ 0.05.
Bcl, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+bcl+2/pmc12895042-25-7-17?v=OriGene
Average 94 stars, based on 1 article reviews
bcl - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology mouse antibody against human bcl 2
CAR <t>regulates</t> <t>Bcl-2</t> and Bax protein expression in cancer cells. The expression levels of Bcl-2 and active Bax proteins were determined in untreated and CAR-treated HCT116 and HeLa cells at its IC 50 value (30 μM), utilizing flow cytometry after a 48 h period. The histogram bars illustrate the mean fold change in protein expression (MFI) ± SEM and the mean fold change in the Bax/Bcl-2 ratio ± SEM ( n = 3). * p < 0.05 and ** p < 0.01 indicate significant levels compared to the control group (Ctrl).
Mouse Antibody Against Human Bcl 2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+bcl+2/pmc12938579-128-34-39?v=Santa+Cruz+Biotechnology
Average 96 stars, based on 1 article reviews
mouse antibody against human bcl 2 - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

Image Search Results


a Schematic of the human BCL-2 construct and CFP/BCL-2stop fl/+ mouse. b Primary lung fibroblasts from PDGFRα-CFP/BCL-2 + mice express hBCL-2 that co-localizes with Mitotracker Red (63X) ( n = 3 experimental replicates). Additional images show overlays of phalloidin and CFP (40X). By Western Blot, ( c ) fibroblasts from PDGFRα-CFP/BCL-2 + mice express CFP (detected with anti-GFP antibody) and BCL-2 which is located within ( d ) the mitochondrial fraction ( n = 3 experimental replicates). Caspase 3/7 activity in CFP/BCL-2 - and CFP/BCL-2 + fibroblasts after treatment with ( e ) staurosporine ( n = 9 experimental replicates, +/−SD, 2-tailed t test with Welch’s correction, *** p < 0.001) or ( f ) Jo2 +/- TNF-α/IFNγ ( n = 3 experimental replicates, +/-SD, 2-tailed t test with Welch’s correction, ** p < 0.01). g endogenous CFP expression (teal) in naïve lungs of PDGFRα-CFP/BCL-2 + mice co-immunostained BCL-2 (red) or with lineage cell markers (red or yellow) for PDGFRα, PDGFRβ, αSMA, proSPC, CCSP, CD45 and CD31 (20x). h Flow cytometry gating of PDGFRα and PDGFRβ populations from lineage negative cells (CD45 - /CD31 - /EpCAM - ). Broad PDGFRα + gating (pink gate) can be further sub populated into PDGFRα + only (CFP + , orange gate) and PDGFRα + /β + (CFP + , black gate). PDGFRβ + only pericytes (CFP -, red gate) are PDGFRα - . i Geometric mean of CFP expression in lineage sorted lung cell populations ( n = 4 mice/group, +/-SEM, 2-tailed t test with Welch’s correction, *** p < 0.001) and ( j ) flow cytometry histograms. CO = corn oil, Tamox = tamoxifen. Source data for c , d , e , f and i are provided as a Source Data file.

Journal: Nature Communications

Article Title: Conditional BCL-2 Expression in Fibroblasts Promotes Persistent Pulmonary Fibrosis which is Reversible by Therapeutic BCL-2 Inhibition

doi: 10.1038/s41467-026-69865-4

Figure Lengend Snippet: a Schematic of the human BCL-2 construct and CFP/BCL-2stop fl/+ mouse. b Primary lung fibroblasts from PDGFRα-CFP/BCL-2 + mice express hBCL-2 that co-localizes with Mitotracker Red (63X) ( n = 3 experimental replicates). Additional images show overlays of phalloidin and CFP (40X). By Western Blot, ( c ) fibroblasts from PDGFRα-CFP/BCL-2 + mice express CFP (detected with anti-GFP antibody) and BCL-2 which is located within ( d ) the mitochondrial fraction ( n = 3 experimental replicates). Caspase 3/7 activity in CFP/BCL-2 - and CFP/BCL-2 + fibroblasts after treatment with ( e ) staurosporine ( n = 9 experimental replicates, +/−SD, 2-tailed t test with Welch’s correction, *** p < 0.001) or ( f ) Jo2 +/- TNF-α/IFNγ ( n = 3 experimental replicates, +/-SD, 2-tailed t test with Welch’s correction, ** p < 0.01). g endogenous CFP expression (teal) in naïve lungs of PDGFRα-CFP/BCL-2 + mice co-immunostained BCL-2 (red) or with lineage cell markers (red or yellow) for PDGFRα, PDGFRβ, αSMA, proSPC, CCSP, CD45 and CD31 (20x). h Flow cytometry gating of PDGFRα and PDGFRβ populations from lineage negative cells (CD45 - /CD31 - /EpCAM - ). Broad PDGFRα + gating (pink gate) can be further sub populated into PDGFRα + only (CFP + , orange gate) and PDGFRα + /β + (CFP + , black gate). PDGFRβ + only pericytes (CFP -, red gate) are PDGFRα - . i Geometric mean of CFP expression in lineage sorted lung cell populations ( n = 4 mice/group, +/-SEM, 2-tailed t test with Welch’s correction, *** p < 0.001) and ( j ) flow cytometry histograms. CO = corn oil, Tamox = tamoxifen. Source data for c , d , e , f and i are provided as a Source Data file.

Article Snippet: Primary antibodies for BCL-2 (BioRad #MCA1550, mouse, 1:100 Hercules, CA), Bcl-2 (Cell Signaling Technology # 3498, rabbit, 1:500), PDGFRα (Cell Signaling, #3174S rabbit, 1:100), PDGFRβ (R&D Systems #AF1032 goat, 1:100, Minneapolis, MN), GFP (which identifies CFP; AvesLab #GFP-1020, chicken, 1:200), αSMA (Sigma Aldrich #2547, mouse, 1:500), p16 INK (Abcam #ab211542 rabbit, 1:100), p21 WAF (Abcam #ab188224 rabbit, 1:250), β-galactosidase (Cell Signaling #27198 rabbit, 1:200), CCSP (Seven Hills Bioreagents #WRAB-3950 rabbit, 1:200, Cincinnati, OH), pro-SPC (Millipore #AB3786 rabbit, 1:500), Krt8 (DSHB # AB531826 rat, 1:100), CD45 (Invitrogen, 17-0451-82 rat, 1:100), CD31 (Invitrogen, #14-0311-82 rat, 1:100) were incubated overnight at 4 o C followed by incubation with fluorescently tagged goat anti mouse-A647 (A21236), donkey anti-rabbit-A555 (A31572), goat anti rat-A555 (A21434), or donkey anti goat-A647 (A21447) secondary antibodies at 1:100 dilution (Invitrogen, Carlsbad, CA).

Techniques: Construct, Western Blot, Activity Assay, Expressing, Flow Cytometry

a Schematic of in vivo tamoxifen or corn oil treatment of PDGFRα-CFP/BCL-2 fl/+ mice. b Immunofluorescent staining of PDGFRα (magenta), PDGFRβ (green) and TUNEL (white) in PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice 3 weeks after bleomycin. c Quantification of TUNEL + cells per high power field. Data is mean +/− SEM, n = 5. * p < 0.05, ** p < 0.01, *** p < 0.001. Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons. Upper panels 20X, lower panels 40X. Source data for c is provided as a Source Data file.

Journal: Nature Communications

Article Title: Conditional BCL-2 Expression in Fibroblasts Promotes Persistent Pulmonary Fibrosis which is Reversible by Therapeutic BCL-2 Inhibition

doi: 10.1038/s41467-026-69865-4

Figure Lengend Snippet: a Schematic of in vivo tamoxifen or corn oil treatment of PDGFRα-CFP/BCL-2 fl/+ mice. b Immunofluorescent staining of PDGFRα (magenta), PDGFRβ (green) and TUNEL (white) in PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice 3 weeks after bleomycin. c Quantification of TUNEL + cells per high power field. Data is mean +/− SEM, n = 5. * p < 0.05, ** p < 0.01, *** p < 0.001. Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons. Upper panels 20X, lower panels 40X. Source data for c is provided as a Source Data file.

Article Snippet: Primary antibodies for BCL-2 (BioRad #MCA1550, mouse, 1:100 Hercules, CA), Bcl-2 (Cell Signaling Technology # 3498, rabbit, 1:500), PDGFRα (Cell Signaling, #3174S rabbit, 1:100), PDGFRβ (R&D Systems #AF1032 goat, 1:100, Minneapolis, MN), GFP (which identifies CFP; AvesLab #GFP-1020, chicken, 1:200), αSMA (Sigma Aldrich #2547, mouse, 1:500), p16 INK (Abcam #ab211542 rabbit, 1:100), p21 WAF (Abcam #ab188224 rabbit, 1:250), β-galactosidase (Cell Signaling #27198 rabbit, 1:200), CCSP (Seven Hills Bioreagents #WRAB-3950 rabbit, 1:200, Cincinnati, OH), pro-SPC (Millipore #AB3786 rabbit, 1:500), Krt8 (DSHB # AB531826 rat, 1:100), CD45 (Invitrogen, 17-0451-82 rat, 1:100), CD31 (Invitrogen, #14-0311-82 rat, 1:100) were incubated overnight at 4 o C followed by incubation with fluorescently tagged goat anti mouse-A647 (A21236), donkey anti-rabbit-A555 (A31572), goat anti rat-A555 (A21434), or donkey anti goat-A647 (A21447) secondary antibodies at 1:100 dilution (Invitrogen, Carlsbad, CA).

Techniques: In Vivo, Staining, TUNEL Assay

a Schematic of in vivo tamoxifen or corn oil treatment and time course of harvest in PDGFRα-CFP/BCL-2 fl/+ mice. b – d Quantification of PDGFRα + and PDGFRα + /β + fibroblasts and PDGFRβ + pericytes over time. e – g Frequency of CFP + PDGFRα + and PDGFRα + /β + fibroblasts and PDGFRβ + pericytes in PDGFRα-CFP/BCL-2 + mice after saline or bleomycin treatment. (h-i upper panels) CFP (teal), PDGFRα (magenta) and PDGFRβ (green) immunofluorescent staining of lungs over time after bleomycin in PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice. h – i lower panels) human BCL-2 (green) immunofluorescent staining of lungs over time after bleomycin in PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice. PDGFRα-CFP/BCL-2 + saline n = 4 mice/time point. PDGFRα-CFP/BCL-2 + bleomycin n = 5 mice/time point. PDGFRα-CFP/BCL-2 - saline n = 6 mice 0wk, 4 mice 3, 6, 12 wk, 5 mice 9 wk. PDGFRα-CFP/BCL-2 - bleomycin n = 5 mice/time point. Data is mean +/- SEM, Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons * p < 0.05, ** p < 0.01, *** p < 0.001 compared to saline. # p < 0.05 9wk PDGFRα-CFP/BCL-2 + compared to other 9-week animals. ## p < 0.01, 6- and 12-week PDGFRα-CFP/BCL-2 + compared to other 6- and 12-week animals respectively. Upper panels 20X, lower panels 40X. Source data for b – g are provided as a Source Data file.

Journal: Nature Communications

Article Title: Conditional BCL-2 Expression in Fibroblasts Promotes Persistent Pulmonary Fibrosis which is Reversible by Therapeutic BCL-2 Inhibition

doi: 10.1038/s41467-026-69865-4

Figure Lengend Snippet: a Schematic of in vivo tamoxifen or corn oil treatment and time course of harvest in PDGFRα-CFP/BCL-2 fl/+ mice. b – d Quantification of PDGFRα + and PDGFRα + /β + fibroblasts and PDGFRβ + pericytes over time. e – g Frequency of CFP + PDGFRα + and PDGFRα + /β + fibroblasts and PDGFRβ + pericytes in PDGFRα-CFP/BCL-2 + mice after saline or bleomycin treatment. (h-i upper panels) CFP (teal), PDGFRα (magenta) and PDGFRβ (green) immunofluorescent staining of lungs over time after bleomycin in PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice. h – i lower panels) human BCL-2 (green) immunofluorescent staining of lungs over time after bleomycin in PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice. PDGFRα-CFP/BCL-2 + saline n = 4 mice/time point. PDGFRα-CFP/BCL-2 + bleomycin n = 5 mice/time point. PDGFRα-CFP/BCL-2 - saline n = 6 mice 0wk, 4 mice 3, 6, 12 wk, 5 mice 9 wk. PDGFRα-CFP/BCL-2 - bleomycin n = 5 mice/time point. Data is mean +/- SEM, Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons * p < 0.05, ** p < 0.01, *** p < 0.001 compared to saline. # p < 0.05 9wk PDGFRα-CFP/BCL-2 + compared to other 9-week animals. ## p < 0.01, 6- and 12-week PDGFRα-CFP/BCL-2 + compared to other 6- and 12-week animals respectively. Upper panels 20X, lower panels 40X. Source data for b – g are provided as a Source Data file.

Article Snippet: Primary antibodies for BCL-2 (BioRad #MCA1550, mouse, 1:100 Hercules, CA), Bcl-2 (Cell Signaling Technology # 3498, rabbit, 1:500), PDGFRα (Cell Signaling, #3174S rabbit, 1:100), PDGFRβ (R&D Systems #AF1032 goat, 1:100, Minneapolis, MN), GFP (which identifies CFP; AvesLab #GFP-1020, chicken, 1:200), αSMA (Sigma Aldrich #2547, mouse, 1:500), p16 INK (Abcam #ab211542 rabbit, 1:100), p21 WAF (Abcam #ab188224 rabbit, 1:250), β-galactosidase (Cell Signaling #27198 rabbit, 1:200), CCSP (Seven Hills Bioreagents #WRAB-3950 rabbit, 1:200, Cincinnati, OH), pro-SPC (Millipore #AB3786 rabbit, 1:500), Krt8 (DSHB # AB531826 rat, 1:100), CD45 (Invitrogen, 17-0451-82 rat, 1:100), CD31 (Invitrogen, #14-0311-82 rat, 1:100) were incubated overnight at 4 o C followed by incubation with fluorescently tagged goat anti mouse-A647 (A21236), donkey anti-rabbit-A555 (A31572), goat anti rat-A555 (A21434), or donkey anti goat-A647 (A21447) secondary antibodies at 1:100 dilution (Invitrogen, Carlsbad, CA).

Techniques: In Vivo, Saline, Staining

a Hydroxyproline levels in the lungs over time after bleomycin in PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice. PDGFRα-CFP/BCL-2 + saline n = 4 mice/time point. PDGFRαCFP/BCL-2 + bleomycin n = 5 mice/time point. PDGFRα-CFP/BCL-2 - saline n = 6 mice 0wk, 4 mice 3, 6, 12 wk, 5 mice 9 wk. PDGFRα-CFP/BCL-2 - bleomycin n = 5 mice/time point. Data is mean +/− SEM, ** p < 0.01, *** p < 0.001 3wk bleomycin compared to saline. ** p < 0.01 and *** p < 0.01 PDGFRα-CFP/BCL-2 compared to controls. 2-tailed t test with Welch’s correction. b Representative Trichrome stained lung sections over time in PDGFRα-CFP/BCL-2 + and PDGFRα-CFP/BCL-2 + mice. Blue arrows indicate cyst formation. c Quantitation of CCSP + KRT8 + and ( d ) SPC + cells per field over the time course. e Identification of CCSP + (magenta) and Krt8 + (green) transitional cells in saline or bleomycin at 0, 3, 6, 9 and 12 weeks after bleomycin in PDGFRα-CFP/BCL-2 + (upper) and PDGFRα-CFP/BCL-2 - (lower) lungs. f Identification of pro-SPC + (magenta) alveolar epithelial cells in PDGFRα-CFP/BCL-2 + (upper) and PDGFRα-CFP/BCL-2 - (lower) lungs. Aperio scans 2x. Immunofluorescence upper panels 20X, lower panels 40X. Source data for a, c and d are provided as a Source Data file.

Journal: Nature Communications

Article Title: Conditional BCL-2 Expression in Fibroblasts Promotes Persistent Pulmonary Fibrosis which is Reversible by Therapeutic BCL-2 Inhibition

doi: 10.1038/s41467-026-69865-4

Figure Lengend Snippet: a Hydroxyproline levels in the lungs over time after bleomycin in PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice. PDGFRα-CFP/BCL-2 + saline n = 4 mice/time point. PDGFRαCFP/BCL-2 + bleomycin n = 5 mice/time point. PDGFRα-CFP/BCL-2 - saline n = 6 mice 0wk, 4 mice 3, 6, 12 wk, 5 mice 9 wk. PDGFRα-CFP/BCL-2 - bleomycin n = 5 mice/time point. Data is mean +/− SEM, ** p < 0.01, *** p < 0.001 3wk bleomycin compared to saline. ** p < 0.01 and *** p < 0.01 PDGFRα-CFP/BCL-2 compared to controls. 2-tailed t test with Welch’s correction. b Representative Trichrome stained lung sections over time in PDGFRα-CFP/BCL-2 + and PDGFRα-CFP/BCL-2 + mice. Blue arrows indicate cyst formation. c Quantitation of CCSP + KRT8 + and ( d ) SPC + cells per field over the time course. e Identification of CCSP + (magenta) and Krt8 + (green) transitional cells in saline or bleomycin at 0, 3, 6, 9 and 12 weeks after bleomycin in PDGFRα-CFP/BCL-2 + (upper) and PDGFRα-CFP/BCL-2 - (lower) lungs. f Identification of pro-SPC + (magenta) alveolar epithelial cells in PDGFRα-CFP/BCL-2 + (upper) and PDGFRα-CFP/BCL-2 - (lower) lungs. Aperio scans 2x. Immunofluorescence upper panels 20X, lower panels 40X. Source data for a, c and d are provided as a Source Data file.

Article Snippet: Primary antibodies for BCL-2 (BioRad #MCA1550, mouse, 1:100 Hercules, CA), Bcl-2 (Cell Signaling Technology # 3498, rabbit, 1:500), PDGFRα (Cell Signaling, #3174S rabbit, 1:100), PDGFRβ (R&D Systems #AF1032 goat, 1:100, Minneapolis, MN), GFP (which identifies CFP; AvesLab #GFP-1020, chicken, 1:200), αSMA (Sigma Aldrich #2547, mouse, 1:500), p16 INK (Abcam #ab211542 rabbit, 1:100), p21 WAF (Abcam #ab188224 rabbit, 1:250), β-galactosidase (Cell Signaling #27198 rabbit, 1:200), CCSP (Seven Hills Bioreagents #WRAB-3950 rabbit, 1:200, Cincinnati, OH), pro-SPC (Millipore #AB3786 rabbit, 1:500), Krt8 (DSHB # AB531826 rat, 1:100), CD45 (Invitrogen, 17-0451-82 rat, 1:100), CD31 (Invitrogen, #14-0311-82 rat, 1:100) were incubated overnight at 4 o C followed by incubation with fluorescently tagged goat anti mouse-A647 (A21236), donkey anti-rabbit-A555 (A31572), goat anti rat-A555 (A21434), or donkey anti goat-A647 (A21447) secondary antibodies at 1:100 dilution (Invitrogen, Carlsbad, CA).

Techniques: Saline, Staining, Quantitation Assay, Immunofluorescence

a Dot plot representation of enriched Gene Ontology (GO) terms 3 weeks after bleomycin from PDGFRα-CFP/BCL-2 + fibroblasts compared to PDGFRα-CFP/BCL-2 - fibroblasts. b Differential gene expression associated with ECM organization ( c ) Box-and-whisker plots of ECM and pro-fibrotic genes expressed during non-resolving fibrosis in PDGFRα-CFP/BCL-2 + fibroblasts. Differential gene expression associated with ( d ) senescence regulation and ( e ) p53 signaling. f Box-and-whisker plots of key senescence and p53 associated genes in non-resolving PDGFRα-CFP/BCL-2 + fibroblasts. g Dot plot representation of enriched GO terms 6 weeks after bleomycin from PDGFRα-CFP/BCL-2 + fibroblasts compared to PDGFRα-CFP/BCL-2 - fibroblasts. Differential gene expression associated with ( h ) ECM disassembly and ( i ) box-and-whisker plots of genes expressed during resolving fibrosis in PDGFRα-CFP/BCL-2 - fibroblasts. Differential gene expression associated with ( j ) regulation of apoptotic signaling and ( k ) regulation of Wnt signaling in naïve, PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + fibroblasts. l Box-and-whisker plots of genes expressed during Wnt signaling in naïve, PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + fibroblasts. Heat maps generated with significant differentially expressed genes identified from GO BP pathways. c , f , i , l Box-and-whisker plots ( n = 4 biological replicates/group, mean; whiskers: min to max) are normalized TPM values with pAdj from DE analysis * p < 0.05, ** p < 0.01, *** p < 0.01. ECM, extracellular matrix. Avg NE = Average normalized expression. N Overlap = number of DEGs significantly expressed in the pathway. Source data for a – l are provided as a Source Data file.

Journal: Nature Communications

Article Title: Conditional BCL-2 Expression in Fibroblasts Promotes Persistent Pulmonary Fibrosis which is Reversible by Therapeutic BCL-2 Inhibition

doi: 10.1038/s41467-026-69865-4

Figure Lengend Snippet: a Dot plot representation of enriched Gene Ontology (GO) terms 3 weeks after bleomycin from PDGFRα-CFP/BCL-2 + fibroblasts compared to PDGFRα-CFP/BCL-2 - fibroblasts. b Differential gene expression associated with ECM organization ( c ) Box-and-whisker plots of ECM and pro-fibrotic genes expressed during non-resolving fibrosis in PDGFRα-CFP/BCL-2 + fibroblasts. Differential gene expression associated with ( d ) senescence regulation and ( e ) p53 signaling. f Box-and-whisker plots of key senescence and p53 associated genes in non-resolving PDGFRα-CFP/BCL-2 + fibroblasts. g Dot plot representation of enriched GO terms 6 weeks after bleomycin from PDGFRα-CFP/BCL-2 + fibroblasts compared to PDGFRα-CFP/BCL-2 - fibroblasts. Differential gene expression associated with ( h ) ECM disassembly and ( i ) box-and-whisker plots of genes expressed during resolving fibrosis in PDGFRα-CFP/BCL-2 - fibroblasts. Differential gene expression associated with ( j ) regulation of apoptotic signaling and ( k ) regulation of Wnt signaling in naïve, PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + fibroblasts. l Box-and-whisker plots of genes expressed during Wnt signaling in naïve, PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + fibroblasts. Heat maps generated with significant differentially expressed genes identified from GO BP pathways. c , f , i , l Box-and-whisker plots ( n = 4 biological replicates/group, mean; whiskers: min to max) are normalized TPM values with pAdj from DE analysis * p < 0.05, ** p < 0.01, *** p < 0.01. ECM, extracellular matrix. Avg NE = Average normalized expression. N Overlap = number of DEGs significantly expressed in the pathway. Source data for a – l are provided as a Source Data file.

Article Snippet: Primary antibodies for BCL-2 (BioRad #MCA1550, mouse, 1:100 Hercules, CA), Bcl-2 (Cell Signaling Technology # 3498, rabbit, 1:500), PDGFRα (Cell Signaling, #3174S rabbit, 1:100), PDGFRβ (R&D Systems #AF1032 goat, 1:100, Minneapolis, MN), GFP (which identifies CFP; AvesLab #GFP-1020, chicken, 1:200), αSMA (Sigma Aldrich #2547, mouse, 1:500), p16 INK (Abcam #ab211542 rabbit, 1:100), p21 WAF (Abcam #ab188224 rabbit, 1:250), β-galactosidase (Cell Signaling #27198 rabbit, 1:200), CCSP (Seven Hills Bioreagents #WRAB-3950 rabbit, 1:200, Cincinnati, OH), pro-SPC (Millipore #AB3786 rabbit, 1:500), Krt8 (DSHB # AB531826 rat, 1:100), CD45 (Invitrogen, 17-0451-82 rat, 1:100), CD31 (Invitrogen, #14-0311-82 rat, 1:100) were incubated overnight at 4 o C followed by incubation with fluorescently tagged goat anti mouse-A647 (A21236), donkey anti-rabbit-A555 (A31572), goat anti rat-A555 (A21434), or donkey anti goat-A647 (A21447) secondary antibodies at 1:100 dilution (Invitrogen, Carlsbad, CA).

Techniques: Gene Expression, Whisker Assay, Generated, Expressing

a Heat maps of differential gene expression associated with regulation of cellular senescence in fibroblasts from PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice 6 weeks after bleomycin. b Senescence gene score ( n = 4 mice/group, mean +/− SEM, * p < 0.01, Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons.) and ( c ) BCL-2 Pearson Correlation maps for 111 senescence associated genes in naïve, PDGFRα-CFP/BCL-2 - , PDGFRα-CFP/BCL-2 + fibroblasts. d – f Quantification of fibroblasts/field for p21, p16 and SA-β-gal from control and persistently fibrotic lungs from PDGFRα-CFP/BCL-2 - , PDGFRα-CFP/BCL-2 + mice ( n = 4 mice/group, mean +/− SEM of 10 individual images/mouse graphed as scatter plot with bar mean +/− SEM, *** p < 0.001, 2-tailed t test with Welch’s correction.). Immunofluorescence images for ( g ) PDGFRα (magenta) and PDGFRβ (green), ( h ) human BCL-2 (green), ( i ) p21 (yellow), ( j ) p16 (magenta) and ( k ) SA-β-gal (white). SA-β-gal, senescence associated-β-galactosidase. White arrow heads indicate shared features in serial sections. Spatial transcriptomic analysis of IPF lung. l H&E section ( m ) spatial map of cellular populations ( n ) BCL-2 expression map (red, individual transcripts) overlayed with myofibroblasts (yellow, cell boundaries) and ( o ) 10 gene senescence module ENV score. [A-C dotted line callouts are enlarged areas to show cell boundary, BCL-2 expression and senescence ENV score overlays]. p Heat maps of differential pro-fibrotic genes and senescence genes between BCL-2 + myofibroblasts and BCL-2 - myofibroblasts from the spatial transcriptomic data. q Myofibroblast cell counts between control IPF and BCL-2 + myofibroblast + counts from control and IPF spatial images (* p < 0.05 and *** p < 0.001, 2-tailed t test with Welch’s correction). r Quantification of α-SMA + myofibroblasts/field for BCL-2 in control and IPF lung sections (individual images graphed as scatter plot with bar mean +/- SEM, *** p < 0.001, 2-tailed t test with Welch’s correction). Immunofluorescent images of control and IPF lungs stained for ( s ) αSMA (magenta) and BCL-2 (green), ( t ) α-SMA (green) and p16 (magenta), ( u ) p21 (yellow), ( v ) SA-β-Gal (white). Images n = 5 subjects/group. Spatial transcript analysis n = 13 controls, n = 15 IPF Immunofluorescence panels 20X. 10 images/mouse for immunofluorescent quantitation. SA-β-gal, senescence associated-β-galactosidase. Cor coe = correlation coefficient. Source data are provided for a – f and p – r as a Source Data file.

Journal: Nature Communications

Article Title: Conditional BCL-2 Expression in Fibroblasts Promotes Persistent Pulmonary Fibrosis which is Reversible by Therapeutic BCL-2 Inhibition

doi: 10.1038/s41467-026-69865-4

Figure Lengend Snippet: a Heat maps of differential gene expression associated with regulation of cellular senescence in fibroblasts from PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice 6 weeks after bleomycin. b Senescence gene score ( n = 4 mice/group, mean +/− SEM, * p < 0.01, Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons.) and ( c ) BCL-2 Pearson Correlation maps for 111 senescence associated genes in naïve, PDGFRα-CFP/BCL-2 - , PDGFRα-CFP/BCL-2 + fibroblasts. d – f Quantification of fibroblasts/field for p21, p16 and SA-β-gal from control and persistently fibrotic lungs from PDGFRα-CFP/BCL-2 - , PDGFRα-CFP/BCL-2 + mice ( n = 4 mice/group, mean +/− SEM of 10 individual images/mouse graphed as scatter plot with bar mean +/− SEM, *** p < 0.001, 2-tailed t test with Welch’s correction.). Immunofluorescence images for ( g ) PDGFRα (magenta) and PDGFRβ (green), ( h ) human BCL-2 (green), ( i ) p21 (yellow), ( j ) p16 (magenta) and ( k ) SA-β-gal (white). SA-β-gal, senescence associated-β-galactosidase. White arrow heads indicate shared features in serial sections. Spatial transcriptomic analysis of IPF lung. l H&E section ( m ) spatial map of cellular populations ( n ) BCL-2 expression map (red, individual transcripts) overlayed with myofibroblasts (yellow, cell boundaries) and ( o ) 10 gene senescence module ENV score. [A-C dotted line callouts are enlarged areas to show cell boundary, BCL-2 expression and senescence ENV score overlays]. p Heat maps of differential pro-fibrotic genes and senescence genes between BCL-2 + myofibroblasts and BCL-2 - myofibroblasts from the spatial transcriptomic data. q Myofibroblast cell counts between control IPF and BCL-2 + myofibroblast + counts from control and IPF spatial images (* p < 0.05 and *** p < 0.001, 2-tailed t test with Welch’s correction). r Quantification of α-SMA + myofibroblasts/field for BCL-2 in control and IPF lung sections (individual images graphed as scatter plot with bar mean +/- SEM, *** p < 0.001, 2-tailed t test with Welch’s correction). Immunofluorescent images of control and IPF lungs stained for ( s ) αSMA (magenta) and BCL-2 (green), ( t ) α-SMA (green) and p16 (magenta), ( u ) p21 (yellow), ( v ) SA-β-Gal (white). Images n = 5 subjects/group. Spatial transcript analysis n = 13 controls, n = 15 IPF Immunofluorescence panels 20X. 10 images/mouse for immunofluorescent quantitation. SA-β-gal, senescence associated-β-galactosidase. Cor coe = correlation coefficient. Source data are provided for a – f and p – r as a Source Data file.

Article Snippet: Primary antibodies for BCL-2 (BioRad #MCA1550, mouse, 1:100 Hercules, CA), Bcl-2 (Cell Signaling Technology # 3498, rabbit, 1:500), PDGFRα (Cell Signaling, #3174S rabbit, 1:100), PDGFRβ (R&D Systems #AF1032 goat, 1:100, Minneapolis, MN), GFP (which identifies CFP; AvesLab #GFP-1020, chicken, 1:200), αSMA (Sigma Aldrich #2547, mouse, 1:500), p16 INK (Abcam #ab211542 rabbit, 1:100), p21 WAF (Abcam #ab188224 rabbit, 1:250), β-galactosidase (Cell Signaling #27198 rabbit, 1:200), CCSP (Seven Hills Bioreagents #WRAB-3950 rabbit, 1:200, Cincinnati, OH), pro-SPC (Millipore #AB3786 rabbit, 1:500), Krt8 (DSHB # AB531826 rat, 1:100), CD45 (Invitrogen, 17-0451-82 rat, 1:100), CD31 (Invitrogen, #14-0311-82 rat, 1:100) were incubated overnight at 4 o C followed by incubation with fluorescently tagged goat anti mouse-A647 (A21236), donkey anti-rabbit-A555 (A31572), goat anti rat-A555 (A21434), or donkey anti goat-A647 (A21447) secondary antibodies at 1:100 dilution (Invitrogen, Carlsbad, CA).

Techniques: Gene Expression, Control, Immunofluorescence, Expressing, Staining, Quantitation Assay

a Heat maps of differential gene expression associated with regulation of cellular senescence in fibroblasts from two non-resolving models of fibrosis; repetitive bleomycin and Col1a1-Fas -/- . b Quantitative senescence Z-score and ( n = 4 mice/group, mean +/- SEM, ** p < 0.01, Brown-Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons.) c Bcl-2 Pearson Correlation maps for senescence associated genes ( p < 0.05) in repetitive bleomycin and Col1a1-Fas -/- fibroblasts. Immunofluorescent images and quantitation of fibroblasts/per field from control and persistently fibrotic lungs from repetitive bleomycin and Col1a1-Fas -/- mice for ( d ) PDGFRα (magenta) and PDGFRβ (green), ( e ) murine Bcl-2 (green), ( f ) p21 (yellow), ( g ) p16 (magenta) and ( h ) SA-β-Gal (white). d – h 5 mice/group; individual images graphed as scatter plot with bar mean + /-SEM, * p < 0.05, *** p < 0.001 Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons. Immunofluorescence panels 20X. SA-β-gal, senescence associated-β-galactosidase. Avg NE = Average normalized expression. Cor coe = correlation coefficient. nsd = no significant difference. Source data are for a – c and e – h provided as a Source Data file. Data for Col1a1-Fas -/- fibroblasts (GEO: GSE161648 ) were previously published 11 .

Journal: Nature Communications

Article Title: Conditional BCL-2 Expression in Fibroblasts Promotes Persistent Pulmonary Fibrosis which is Reversible by Therapeutic BCL-2 Inhibition

doi: 10.1038/s41467-026-69865-4

Figure Lengend Snippet: a Heat maps of differential gene expression associated with regulation of cellular senescence in fibroblasts from two non-resolving models of fibrosis; repetitive bleomycin and Col1a1-Fas -/- . b Quantitative senescence Z-score and ( n = 4 mice/group, mean +/- SEM, ** p < 0.01, Brown-Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons.) c Bcl-2 Pearson Correlation maps for senescence associated genes ( p < 0.05) in repetitive bleomycin and Col1a1-Fas -/- fibroblasts. Immunofluorescent images and quantitation of fibroblasts/per field from control and persistently fibrotic lungs from repetitive bleomycin and Col1a1-Fas -/- mice for ( d ) PDGFRα (magenta) and PDGFRβ (green), ( e ) murine Bcl-2 (green), ( f ) p21 (yellow), ( g ) p16 (magenta) and ( h ) SA-β-Gal (white). d – h 5 mice/group; individual images graphed as scatter plot with bar mean + /-SEM, * p < 0.05, *** p < 0.001 Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons. Immunofluorescence panels 20X. SA-β-gal, senescence associated-β-galactosidase. Avg NE = Average normalized expression. Cor coe = correlation coefficient. nsd = no significant difference. Source data are for a – c and e – h provided as a Source Data file. Data for Col1a1-Fas -/- fibroblasts (GEO: GSE161648 ) were previously published 11 .

Article Snippet: Primary antibodies for BCL-2 (BioRad #MCA1550, mouse, 1:100 Hercules, CA), Bcl-2 (Cell Signaling Technology # 3498, rabbit, 1:500), PDGFRα (Cell Signaling, #3174S rabbit, 1:100), PDGFRβ (R&D Systems #AF1032 goat, 1:100, Minneapolis, MN), GFP (which identifies CFP; AvesLab #GFP-1020, chicken, 1:200), αSMA (Sigma Aldrich #2547, mouse, 1:500), p16 INK (Abcam #ab211542 rabbit, 1:100), p21 WAF (Abcam #ab188224 rabbit, 1:250), β-galactosidase (Cell Signaling #27198 rabbit, 1:200), CCSP (Seven Hills Bioreagents #WRAB-3950 rabbit, 1:200, Cincinnati, OH), pro-SPC (Millipore #AB3786 rabbit, 1:500), Krt8 (DSHB # AB531826 rat, 1:100), CD45 (Invitrogen, 17-0451-82 rat, 1:100), CD31 (Invitrogen, #14-0311-82 rat, 1:100) were incubated overnight at 4 o C followed by incubation with fluorescently tagged goat anti mouse-A647 (A21236), donkey anti-rabbit-A555 (A31572), goat anti rat-A555 (A21434), or donkey anti goat-A647 (A21447) secondary antibodies at 1:100 dilution (Invitrogen, Carlsbad, CA).

Techniques: Gene Expression, Quantitation Assay, Control, Immunofluorescence, Expressing

a Schematic of fibrosis induction and therapeutic dosing schedule with ABT-199. b Hydroxyproline content of lungs at 9 weeks, ( c – d ) Quantification of PDGFRα + fibroblasts and PDGFRβ + pericytes. e representative axial images (red overlay indicates disease area) and ( f ) 3D reconstructions (non-aerated fibrotic lung in blue, aerated lung in gray). g arterial oxygen saturation and ( h ) quantified non-aerated lung volume measured by micro-CT. i Representative Trichrome stained lung sections and semi-quantitative histology scoring after vehicle or ABT-199 treatment. b – i n = 5 mice/group, time-course line graphs mean +/− SEM. * p < 0.05, ** p < 0.01, *** p < 0.001, Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons). j – k Representative immunofluorescent staining and quantitation of fibroblasts/per field in vehicle and ABT-199 treated PDGFRα-CFP/BCL-2 + mice for p21 (yellow), p16 (magenta) and SA-β-gal (white). Aperio scans 2x, panels 10x. Immunofluorescence panels 20X. n = 5 mice/group; individual images graphed as scatter plot with bar mean + /−SEM, * p < 0.05, ** p < 0.01, *** p < 0.001, Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons. Source data for b – d , g , h and j are provided as a Source Data file.

Journal: Nature Communications

Article Title: Conditional BCL-2 Expression in Fibroblasts Promotes Persistent Pulmonary Fibrosis which is Reversible by Therapeutic BCL-2 Inhibition

doi: 10.1038/s41467-026-69865-4

Figure Lengend Snippet: a Schematic of fibrosis induction and therapeutic dosing schedule with ABT-199. b Hydroxyproline content of lungs at 9 weeks, ( c – d ) Quantification of PDGFRα + fibroblasts and PDGFRβ + pericytes. e representative axial images (red overlay indicates disease area) and ( f ) 3D reconstructions (non-aerated fibrotic lung in blue, aerated lung in gray). g arterial oxygen saturation and ( h ) quantified non-aerated lung volume measured by micro-CT. i Representative Trichrome stained lung sections and semi-quantitative histology scoring after vehicle or ABT-199 treatment. b – i n = 5 mice/group, time-course line graphs mean +/− SEM. * p < 0.05, ** p < 0.01, *** p < 0.001, Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons). j – k Representative immunofluorescent staining and quantitation of fibroblasts/per field in vehicle and ABT-199 treated PDGFRα-CFP/BCL-2 + mice for p21 (yellow), p16 (magenta) and SA-β-gal (white). Aperio scans 2x, panels 10x. Immunofluorescence panels 20X. n = 5 mice/group; individual images graphed as scatter plot with bar mean + /−SEM, * p < 0.05, ** p < 0.01, *** p < 0.001, Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons. Source data for b – d , g , h and j are provided as a Source Data file.

Article Snippet: Primary antibodies for BCL-2 (BioRad #MCA1550, mouse, 1:100 Hercules, CA), Bcl-2 (Cell Signaling Technology # 3498, rabbit, 1:500), PDGFRα (Cell Signaling, #3174S rabbit, 1:100), PDGFRβ (R&D Systems #AF1032 goat, 1:100, Minneapolis, MN), GFP (which identifies CFP; AvesLab #GFP-1020, chicken, 1:200), αSMA (Sigma Aldrich #2547, mouse, 1:500), p16 INK (Abcam #ab211542 rabbit, 1:100), p21 WAF (Abcam #ab188224 rabbit, 1:250), β-galactosidase (Cell Signaling #27198 rabbit, 1:200), CCSP (Seven Hills Bioreagents #WRAB-3950 rabbit, 1:200, Cincinnati, OH), pro-SPC (Millipore #AB3786 rabbit, 1:500), Krt8 (DSHB # AB531826 rat, 1:100), CD45 (Invitrogen, 17-0451-82 rat, 1:100), CD31 (Invitrogen, #14-0311-82 rat, 1:100) were incubated overnight at 4 o C followed by incubation with fluorescently tagged goat anti mouse-A647 (A21236), donkey anti-rabbit-A555 (A31572), goat anti rat-A555 (A21434), or donkey anti goat-A647 (A21447) secondary antibodies at 1:100 dilution (Invitrogen, Carlsbad, CA).

Techniques: Micro-CT, Staining, Quantitation Assay, Immunofluorescence

Effect of Lycopene and Lyc-Cub-NPs on the gene expression of A PI3K, B AKT, C mTOR, D Caspase-3, and E Bcl-2 in the HT-29 cell line using qRT-PCR kits on the IC 50 concentration detected by MTT viability test (IC 50 = 95.25 and 54.04 µgml, respectively, incubation for 48 h). Data were expressed as mean ± SD ( n = 3). * means significant versus the control group, and # means significant versus the Lycopene group. Control: cancer cell without any treatments. Each group differed significantly from the others at p ≤ 0.05.

Journal: Scientific Reports

Article Title: Cubosomal nanoparticles of lycopene as a novel platform for enhancement in antioxidant and anticancer properties with a molecular docking study

doi: 10.1038/s41598-026-36217-7

Figure Lengend Snippet: Effect of Lycopene and Lyc-Cub-NPs on the gene expression of A PI3K, B AKT, C mTOR, D Caspase-3, and E Bcl-2 in the HT-29 cell line using qRT-PCR kits on the IC 50 concentration detected by MTT viability test (IC 50 = 95.25 and 54.04 µgml, respectively, incubation for 48 h). Data were expressed as mean ± SD ( n = 3). * means significant versus the control group, and # means significant versus the Lycopene group. Control: cancer cell without any treatments. Each group differed significantly from the others at p ≤ 0.05.

Article Snippet: Bcl-2 , F: ATCGCCCTGTGGATGACTGAGT R: GCCAGGAGAAATCAAACAGAGGC , Bcl-2 Human qPCR Primer Pair ( NM_000633 ), HP200598 , OriGene Technologies, Inc..

Techniques: Gene Expression, Quantitative RT-PCR, Concentration Assay, Incubation, Control

Effect of Lycopene and Lyc-Cub-NPs on the protein content of A PI3K, B AKT, C mTOR, D Caspase-3, and E Bcl-2 in the HT-29 cell line using ELISA kits on the IC 50 concentration detected by MTT viability test (IC 50 = 95.25 and 54.04 µgml, respectively, incubation for 48 h). Data were expressed as mean ± SD ( n = 3). * means significant versus the control group, and # means significant versus the Lycopene group. Control: cancer cell without any treatments. Each group differed significantly from the others at p ≤ 0.05.

Journal: Scientific Reports

Article Title: Cubosomal nanoparticles of lycopene as a novel platform for enhancement in antioxidant and anticancer properties with a molecular docking study

doi: 10.1038/s41598-026-36217-7

Figure Lengend Snippet: Effect of Lycopene and Lyc-Cub-NPs on the protein content of A PI3K, B AKT, C mTOR, D Caspase-3, and E Bcl-2 in the HT-29 cell line using ELISA kits on the IC 50 concentration detected by MTT viability test (IC 50 = 95.25 and 54.04 µgml, respectively, incubation for 48 h). Data were expressed as mean ± SD ( n = 3). * means significant versus the control group, and # means significant versus the Lycopene group. Control: cancer cell without any treatments. Each group differed significantly from the others at p ≤ 0.05.

Article Snippet: Bcl-2 , F: ATCGCCCTGTGGATGACTGAGT R: GCCAGGAGAAATCAAACAGAGGC , Bcl-2 Human qPCR Primer Pair ( NM_000633 ), HP200598 , OriGene Technologies, Inc..

Techniques: Enzyme-linked Immunosorbent Assay, Concentration Assay, Incubation, Control

Effect of Lycopene and Lyc-Cub-NPs on the gene expression of A PI3K, B AKT, C mTOR, D Caspase-3, and E Bcl-2 in the HT-29 cell line using qRT-PCR kits on the IC 50 concentration detected by MTT viability test (IC 50 = 95.25 and 54.04 µgml, respectively, incubation for 48 h). Data were expressed as mean ± SD ( n = 3). * means significant versus the control group, and # means significant versus the Lycopene group. Control: cancer cell without any treatments. Each group differed significantly from the others at p ≤ 0.05.

Journal: Scientific Reports

Article Title: Cubosomal nanoparticles of lycopene as a novel platform for enhancement in antioxidant and anticancer properties with a molecular docking study

doi: 10.1038/s41598-026-36217-7

Figure Lengend Snippet: Effect of Lycopene and Lyc-Cub-NPs on the gene expression of A PI3K, B AKT, C mTOR, D Caspase-3, and E Bcl-2 in the HT-29 cell line using qRT-PCR kits on the IC 50 concentration detected by MTT viability test (IC 50 = 95.25 and 54.04 µgml, respectively, incubation for 48 h). Data were expressed as mean ± SD ( n = 3). * means significant versus the control group, and # means significant versus the Lycopene group. Control: cancer cell without any treatments. Each group differed significantly from the others at p ≤ 0.05.

Article Snippet: Bcl-2 , F: ATCGCCCTGTGGATGACTGAGT R: GCCAGGAGAAATCAAACAGAGGC , Bcl-2 Human qPCR Primer Pair ( NM_000633 ), HP200598 , OriGene Technologies, Inc..

Techniques: Gene Expression, Quantitative RT-PCR, Concentration Assay, Incubation, Control

Effect of Lycopene and Lyc-Cub-NPs on the protein content of A PI3K, B AKT, C mTOR, D Caspase-3, and E Bcl-2 in the HT-29 cell line using ELISA kits on the IC 50 concentration detected by MTT viability test (IC 50 = 95.25 and 54.04 µgml, respectively, incubation for 48 h). Data were expressed as mean ± SD ( n = 3). * means significant versus the control group, and # means significant versus the Lycopene group. Control: cancer cell without any treatments. Each group differed significantly from the others at p ≤ 0.05.

Journal: Scientific Reports

Article Title: Cubosomal nanoparticles of lycopene as a novel platform for enhancement in antioxidant and anticancer properties with a molecular docking study

doi: 10.1038/s41598-026-36217-7

Figure Lengend Snippet: Effect of Lycopene and Lyc-Cub-NPs on the protein content of A PI3K, B AKT, C mTOR, D Caspase-3, and E Bcl-2 in the HT-29 cell line using ELISA kits on the IC 50 concentration detected by MTT viability test (IC 50 = 95.25 and 54.04 µgml, respectively, incubation for 48 h). Data were expressed as mean ± SD ( n = 3). * means significant versus the control group, and # means significant versus the Lycopene group. Control: cancer cell without any treatments. Each group differed significantly from the others at p ≤ 0.05.

Article Snippet: Bcl-2 , F: ATCGCCCTGTGGATGACTGAGT R: GCCAGGAGAAATCAAACAGAGGC , Bcl-2 Human qPCR Primer Pair ( NM_000633 ), HP200598 , OriGene Technologies, Inc..

Techniques: Enzyme-linked Immunosorbent Assay, Concentration Assay, Incubation, Control

CAR regulates Bcl-2 and Bax protein expression in cancer cells. The expression levels of Bcl-2 and active Bax proteins were determined in untreated and CAR-treated HCT116 and HeLa cells at its IC 50 value (30 μM), utilizing flow cytometry after a 48 h period. The histogram bars illustrate the mean fold change in protein expression (MFI) ± SEM and the mean fold change in the Bax/Bcl-2 ratio ± SEM ( n = 3). * p < 0.05 and ** p < 0.01 indicate significant levels compared to the control group (Ctrl).

Journal: Biomedicines

Article Title: Antipsychotic Drug Cariprazine Induces Distinct Cell Death Mechanisms in HeLa and HCT116 Cells as a Potential Inhibitor of Qi-Site of Cytochrome bc1 Reductase

doi: 10.3390/biomedicines14020315

Figure Lengend Snippet: CAR regulates Bcl-2 and Bax protein expression in cancer cells. The expression levels of Bcl-2 and active Bax proteins were determined in untreated and CAR-treated HCT116 and HeLa cells at its IC 50 value (30 μM), utilizing flow cytometry after a 48 h period. The histogram bars illustrate the mean fold change in protein expression (MFI) ± SEM and the mean fold change in the Bax/Bcl-2 ratio ± SEM ( n = 3). * p < 0.05 and ** p < 0.01 indicate significant levels compared to the control group (Ctrl).

Article Snippet: These antibodies included a mouse antibody against human active caspase-3 (# 9661, Cell Signaling, Danvers, MA, USA), a mouse antibody against human Bax (Santa Cruz Biotech, Inc., Dallas, TX, USA, N20, # sc-493), a mouse antibody against human Bcl-2 (Santa Cruz Biotech, Inc., Dallas, TX, USA, DC21, #sc-783), and a rabbit antibody against human phospho-Akt (Ser-473) (#9271, Cell Signaling, Danvers, MA, USA).

Techniques: Expressing, Flow Cytometry, Control