Microscopy:Article Title: Inhibition of AhR improves cortical bone and skeletal muscle function via preservation of neuromuscular junctions.
Article Snippet: Muscles were 503 cryosectioned (30 micron) parallel with muscle fiber orientation, permeabilized with 0.3% Triton X-100 504 in 1X PBS, and stained with 1μg/ml alpha-bungarotoxin (Biotium #00005-100μg) in 1X PBS in a dark 505 humidified chamber. .. Sections were counterstained with 0.005mg/ml Hoechst (Invitrogen #H1399) in 1X 506 PBS prior to mounting (Vectamount #H-5501, Vector Laboratories) and imaged on a Leica 507 STELLARIS confocal microscope using a 40X oil immersion objective. ..
other:
Produced:Article Title: LIN28B Underlies the Pathogenesis of a Subclass of Ewing Sarcoma LIN28B Control of EWS-FLI1 Stability.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-EWS Bethyl Cat#A300-418A; RRID: AB_420958 Mouse monoclonal anti-Tubulin Millipore Cat#CP06; RRID: AB_2617116 Rabbit polyclonal anti-FLI1 Abcam Cat#ab15289; RRID: AB_301825 Rabbit Anti-Human LIN28B Polyclonal Antibody Proteintech Cat# 16178-1-AP; RRID:AB_2135051 Rabbit Anti-Human LIN28B Polyclonal Antibody Cell Signaling Technology Cat# 4196; RRID:AB_2135047 Monoclonal Anti-GAPDH-Peroxidase antibody produced in mouse Sigma-Aldrich Cat# G9295; RRID:AB_1078992 Anti-Rabbit IgG (whole molecule)-Peroxidase antibody produced in goat Sigma-Aldrich Cat#A0545; RRID:AB_257896 Biological Samples EwS1-4 This paper See Table S3 hpMSC1-2 This paper See Method Details Chemicals, Peptides, and Recombinant Proteins IMDM, GlutaMAX SupplementIMDM Thermofisher Scientific Cat#31980022 DMEM, high glucose, GlutaMAX Supplement, pyruvate Thermofisher Scientific Cat#31966021 KnockOut Serum Replacement - Multi-Species Thermofisher Scientific Cat#10828028 FBS Good Forte PAN BIOTECH Cat#P40-49500 Trypsin-EDTA (0.05%), phenol red Thermofisher Scientific Cat#25300062 MEM Non-Essential Amino Acids Solution Thermofisher Scientific Cat#11140035 Penicillin-Streptomycin (10,000 U/mL) Thermofisher Scientific Cat#15140122 EGF Human PROSPEC Protein specialists Cat#CYT-217 FGF 2 Human PROSPEC Protein specialists Cat#CYT-218 Fugene 6 Promega Cat#E2692 Polybrene Sigma-Aldrich Cat#005557 Puromycin InvivoGen Cat#ant-pr-1 PowerUp SYBR Green Master Mix Applied Biosystems Cat#A25742 Calcein AM cell-permeable-dye Life Technologies Cat#C1430 Lin28 1632 Tocris Bioscience Cat#6068 Dimethyl sulfoxide Sigma-Aldrich Cat#41640 Actinomycin D Sigma-Aldrich Cat#A1410 VectaMount AQ Aqueous Mounting Medium Vector Laboratories CatH-5501 M-MLV Reverse Transcriptase Promega Cat#M170B RNasin Ribonuclease inhibitor Promega Cat#N211B RPMI 1640 Medium, GlutaMAX Supplement Thermofisher Scientific Cat#61870010 Lin28B RNAscope Probe ACD Cat#596361 dNTP set MP Biomedicals Cat#11NTACG100-CF Doxycycline hyclate Sigma-Aldrich Cat#D9891 Geneticin Thermofisher Scientific Cat#10131-027 FBS (tetracyclin-free) PAN BIOTECH Cat#P30-3602 Ketasol-100 Dr. E. Graeub AG Cat#668.51 Rompun 2% Provet AG Cat#1315 (Continued on next page) e1 Cell Reports 30, 4567–4583.e1–e5, March 31, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER PDGF-BB PeproTech Cat#100-14B Critical Commercial Assays miRCURY RNA Isolation Kit - Cell & Plant Exiqon Cat#300110 Click-iT Nascent RNA Capture Kit Life Technologies Cat#10365 NucleoSpin miRNA kit Macherey-Nagel Cat#740971 EZ-Magna RIPTM RNA-Binding Protein Immunoprecipitation kit MerckMillipore Cat#PP64B CellTiter 96 AQueous One Solution Cell Proliferation Assay Promega Cat#G3582 Deposited Data Gene expression data for Ewing sarcoma spheres generated for this project This Paper GEO: GSE122632 Gene expression data for primary Ewing sarcomas Savola et al., 2011 GEO: GSE17618 Gene expression data for primary Ewing sarcomas Brohl et al., 2014 https://pob.abcc.ncifcrf.gov/ cgi-bin/JK Gene sets for functional enrichment analysis Broad Institute Molecular Signatures Database, RRID:SCR_016863 ATARIS gene scores Aguirre et al., 2016 https://depmap.org/portal/download/ Experimental Models: Cell Lines Lenti-X 293T Clontech Cat#632180 A-673 ATCC Cat# CRL-1598, RRID:CVCL_0080 Experimental Models: Organisms/Strains NNOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ The Jackson Laboratory RRID:IMSR_JAX:005557 Oligonucleotides Random Primers Promega Cat#C118A Primer sequences for real-time PCR This paper see Table S5 sgRNA targeting Lin28B (exon2): CACCGCATCGACTGGAATATCCAAG Powers et al., 2016 N/A Recombinant DNA shRNA Lin28B n.1 Broad Institute, RNAi Consortium Cat#TRCN0000219859 shRNA Lin28B n.2 Broad Institute, RNAi Consortium Cat#TRCN0000122191 shRNA targeting EWS-FLI-1 Tirode et al., 2007 N/A pInd EWS-FLI1 Boulay et al., 2017 N/A Software and Algorithms FlowJo version 9.9.4 FLOWJI, LLC https://www.flowjo.com/ solutions/flowjo/, RRID:SCR_008520 Adobe Illustrator CC 2015 Adobe https://www.adobe.com/products/ illustrator.html, RRID:SCR_010279 GraphPad Prism version 8 GraphPad Software https://www.graphpad.com/, RRID:SCR_002798 Oligo Carvalho and Irizarry, 2010 Bioconductor, RRID:SCR_006442 Limma Ritchie et al., 2015 Bioconductor, RRID:SCR_006442 R Project for Statistical Computing R Development Core Team, 2019 R Project for Statistical Computing, RRID:SCR_001905 RSEM Li and Dewey, 2011 https://github.com/deweylab/RSEM Other Ensembl Aken et al., 2017 Ensembl Genome Browser, RRID:SCR_013367 TargetScan Agarwal et al., 2015 TargetScan, RRID:SCR_010845 Cell Reports 30, 4567–4583.e1–e5, March 31, 2020 e2
Recombinant:Article Title: LIN28B Underlies the Pathogenesis of a Subclass of Ewing Sarcoma LIN28B Control of EWS-FLI1 Stability.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-EWS Bethyl Cat#A300-418A; RRID: AB_420958 Mouse monoclonal anti-Tubulin Millipore Cat#CP06; RRID: AB_2617116 Rabbit polyclonal anti-FLI1 Abcam Cat#ab15289; RRID: AB_301825 Rabbit Anti-Human LIN28B Polyclonal Antibody Proteintech Cat# 16178-1-AP; RRID:AB_2135051 Rabbit Anti-Human LIN28B Polyclonal Antibody Cell Signaling Technology Cat# 4196; RRID:AB_2135047 Monoclonal Anti-GAPDH-Peroxidase antibody produced in mouse Sigma-Aldrich Cat# G9295; RRID:AB_1078992 Anti-Rabbit IgG (whole molecule)-Peroxidase antibody produced in goat Sigma-Aldrich Cat#A0545; RRID:AB_257896 Biological Samples EwS1-4 This paper See Table S3 hpMSC1-2 This paper See Method Details Chemicals, Peptides, and Recombinant Proteins IMDM, GlutaMAX SupplementIMDM Thermofisher Scientific Cat#31980022 DMEM, high glucose, GlutaMAX Supplement, pyruvate Thermofisher Scientific Cat#31966021 KnockOut Serum Replacement - Multi-Species Thermofisher Scientific Cat#10828028 FBS Good Forte PAN BIOTECH Cat#P40-49500 Trypsin-EDTA (0.05%), phenol red Thermofisher Scientific Cat#25300062 MEM Non-Essential Amino Acids Solution Thermofisher Scientific Cat#11140035 Penicillin-Streptomycin (10,000 U/mL) Thermofisher Scientific Cat#15140122 EGF Human PROSPEC Protein specialists Cat#CYT-217 FGF 2 Human PROSPEC Protein specialists Cat#CYT-218 Fugene 6 Promega Cat#E2692 Polybrene Sigma-Aldrich Cat#005557 Puromycin InvivoGen Cat#ant-pr-1 PowerUp SYBR Green Master Mix Applied Biosystems Cat#A25742 Calcein AM cell-permeable-dye Life Technologies Cat#C1430 Lin28 1632 Tocris Bioscience Cat#6068 Dimethyl sulfoxide Sigma-Aldrich Cat#41640 Actinomycin D Sigma-Aldrich Cat#A1410 VectaMount AQ Aqueous Mounting Medium Vector Laboratories CatH-5501 M-MLV Reverse Transcriptase Promega Cat#M170B RNasin Ribonuclease inhibitor Promega Cat#N211B RPMI 1640 Medium, GlutaMAX Supplement Thermofisher Scientific Cat#61870010 Lin28B RNAscope Probe ACD Cat#596361 dNTP set MP Biomedicals Cat#11NTACG100-CF Doxycycline hyclate Sigma-Aldrich Cat#D9891 Geneticin Thermofisher Scientific Cat#10131-027 FBS (tetracyclin-free) PAN BIOTECH Cat#P30-3602 Ketasol-100 Dr. E. Graeub AG Cat#668.51 Rompun 2% Provet AG Cat#1315 (Continued on next page) e1 Cell Reports 30, 4567–4583.e1–e5, March 31, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER PDGF-BB PeproTech Cat#100-14B Critical Commercial Assays miRCURY RNA Isolation Kit - Cell & Plant Exiqon Cat#300110 Click-iT Nascent RNA Capture Kit Life Technologies Cat#10365 NucleoSpin miRNA kit Macherey-Nagel Cat#740971 EZ-Magna RIPTM RNA-Binding Protein Immunoprecipitation kit MerckMillipore Cat#PP64B CellTiter 96 AQueous One Solution Cell Proliferation Assay Promega Cat#G3582 Deposited Data Gene expression data for Ewing sarcoma spheres generated for this project This Paper GEO: GSE122632 Gene expression data for primary Ewing sarcomas Savola et al., 2011 GEO: GSE17618 Gene expression data for primary Ewing sarcomas Brohl et al., 2014 https://pob.abcc.ncifcrf.gov/ cgi-bin/JK Gene sets for functional enrichment analysis Broad Institute Molecular Signatures Database, RRID:SCR_016863 ATARIS gene scores Aguirre et al., 2016 https://depmap.org/portal/download/ Experimental Models: Cell Lines Lenti-X 293T Clontech Cat#632180 A-673 ATCC Cat# CRL-1598, RRID:CVCL_0080 Experimental Models: Organisms/Strains NNOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ The Jackson Laboratory RRID:IMSR_JAX:005557 Oligonucleotides Random Primers Promega Cat#C118A Primer sequences for real-time PCR This paper see Table S5 sgRNA targeting Lin28B (exon2): CACCGCATCGACTGGAATATCCAAG Powers et al., 2016 N/A Recombinant DNA shRNA Lin28B n.1 Broad Institute, RNAi Consortium Cat#TRCN0000219859 shRNA Lin28B n.2 Broad Institute, RNAi Consortium Cat#TRCN0000122191 shRNA targeting EWS-FLI-1 Tirode et al., 2007 N/A pInd EWS-FLI1 Boulay et al., 2017 N/A Software and Algorithms FlowJo version 9.9.4 FLOWJI, LLC https://www.flowjo.com/ solutions/flowjo/, RRID:SCR_008520 Adobe Illustrator CC 2015 Adobe https://www.adobe.com/products/ illustrator.html, RRID:SCR_010279 GraphPad Prism version 8 GraphPad Software https://www.graphpad.com/, RRID:SCR_002798 Oligo Carvalho and Irizarry, 2010 Bioconductor, RRID:SCR_006442 Limma Ritchie et al., 2015 Bioconductor, RRID:SCR_006442 R Project for Statistical Computing R Development Core Team, 2019 R Project for Statistical Computing, RRID:SCR_001905 RSEM Li and Dewey, 2011 https://github.com/deweylab/RSEM Other Ensembl Aken et al., 2017 Ensembl Genome Browser, RRID:SCR_013367 TargetScan Agarwal et al., 2015 TargetScan, RRID:SCR_010845 Cell Reports 30, 4567–4583.e1–e5, March 31, 2020 e2
Knock-Out:Article Title: LIN28B Underlies the Pathogenesis of a Subclass of Ewing Sarcoma LIN28B Control of EWS-FLI1 Stability.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-EWS Bethyl Cat#A300-418A; RRID: AB_420958 Mouse monoclonal anti-Tubulin Millipore Cat#CP06; RRID: AB_2617116 Rabbit polyclonal anti-FLI1 Abcam Cat#ab15289; RRID: AB_301825 Rabbit Anti-Human LIN28B Polyclonal Antibody Proteintech Cat# 16178-1-AP; RRID:AB_2135051 Rabbit Anti-Human LIN28B Polyclonal Antibody Cell Signaling Technology Cat# 4196; RRID:AB_2135047 Monoclonal Anti-GAPDH-Peroxidase antibody produced in mouse Sigma-Aldrich Cat# G9295; RRID:AB_1078992 Anti-Rabbit IgG (whole molecule)-Peroxidase antibody produced in goat Sigma-Aldrich Cat#A0545; RRID:AB_257896 Biological Samples EwS1-4 This paper See Table S3 hpMSC1-2 This paper See Method Details Chemicals, Peptides, and Recombinant Proteins IMDM, GlutaMAX SupplementIMDM Thermofisher Scientific Cat#31980022 DMEM, high glucose, GlutaMAX Supplement, pyruvate Thermofisher Scientific Cat#31966021 KnockOut Serum Replacement - Multi-Species Thermofisher Scientific Cat#10828028 FBS Good Forte PAN BIOTECH Cat#P40-49500 Trypsin-EDTA (0.05%), phenol red Thermofisher Scientific Cat#25300062 MEM Non-Essential Amino Acids Solution Thermofisher Scientific Cat#11140035 Penicillin-Streptomycin (10,000 U/mL) Thermofisher Scientific Cat#15140122 EGF Human PROSPEC Protein specialists Cat#CYT-217 FGF 2 Human PROSPEC Protein specialists Cat#CYT-218 Fugene 6 Promega Cat#E2692 Polybrene Sigma-Aldrich Cat#005557 Puromycin InvivoGen Cat#ant-pr-1 PowerUp SYBR Green Master Mix Applied Biosystems Cat#A25742 Calcein AM cell-permeable-dye Life Technologies Cat#C1430 Lin28 1632 Tocris Bioscience Cat#6068 Dimethyl sulfoxide Sigma-Aldrich Cat#41640 Actinomycin D Sigma-Aldrich Cat#A1410 VectaMount AQ Aqueous Mounting Medium Vector Laboratories CatH-5501 M-MLV Reverse Transcriptase Promega Cat#M170B RNasin Ribonuclease inhibitor Promega Cat#N211B RPMI 1640 Medium, GlutaMAX Supplement Thermofisher Scientific Cat#61870010 Lin28B RNAscope Probe ACD Cat#596361 dNTP set MP Biomedicals Cat#11NTACG100-CF Doxycycline hyclate Sigma-Aldrich Cat#D9891 Geneticin Thermofisher Scientific Cat#10131-027 FBS (tetracyclin-free) PAN BIOTECH Cat#P30-3602 Ketasol-100 Dr. E. Graeub AG Cat#668.51 Rompun 2% Provet AG Cat#1315 (Continued on next page) e1 Cell Reports 30, 4567–4583.e1–e5, March 31, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER PDGF-BB PeproTech Cat#100-14B Critical Commercial Assays miRCURY RNA Isolation Kit - Cell & Plant Exiqon Cat#300110 Click-iT Nascent RNA Capture Kit Life Technologies Cat#10365 NucleoSpin miRNA kit Macherey-Nagel Cat#740971 EZ-Magna RIPTM RNA-Binding Protein Immunoprecipitation kit MerckMillipore Cat#PP64B CellTiter 96 AQueous One Solution Cell Proliferation Assay Promega Cat#G3582 Deposited Data Gene expression data for Ewing sarcoma spheres generated for this project This Paper GEO: GSE122632 Gene expression data for primary Ewing sarcomas Savola et al., 2011 GEO: GSE17618 Gene expression data for primary Ewing sarcomas Brohl et al., 2014 https://pob.abcc.ncifcrf.gov/ cgi-bin/JK Gene sets for functional enrichment analysis Broad Institute Molecular Signatures Database, RRID:SCR_016863 ATARIS gene scores Aguirre et al., 2016 https://depmap.org/portal/download/ Experimental Models: Cell Lines Lenti-X 293T Clontech Cat#632180 A-673 ATCC Cat# CRL-1598, RRID:CVCL_0080 Experimental Models: Organisms/Strains NNOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ The Jackson Laboratory RRID:IMSR_JAX:005557 Oligonucleotides Random Primers Promega Cat#C118A Primer sequences for real-time PCR This paper see Table S5 sgRNA targeting Lin28B (exon2): CACCGCATCGACTGGAATATCCAAG Powers et al., 2016 N/A Recombinant DNA shRNA Lin28B n.1 Broad Institute, RNAi Consortium Cat#TRCN0000219859 shRNA Lin28B n.2 Broad Institute, RNAi Consortium Cat#TRCN0000122191 shRNA targeting EWS-FLI-1 Tirode et al., 2007 N/A pInd EWS-FLI1 Boulay et al., 2017 N/A Software and Algorithms FlowJo version 9.9.4 FLOWJI, LLC https://www.flowjo.com/ solutions/flowjo/, RRID:SCR_008520 Adobe Illustrator CC 2015 Adobe https://www.adobe.com/products/ illustrator.html, RRID:SCR_010279 GraphPad Prism version 8 GraphPad Software https://www.graphpad.com/, RRID:SCR_002798 Oligo Carvalho and Irizarry, 2010 Bioconductor, RRID:SCR_006442 Limma Ritchie et al., 2015 Bioconductor, RRID:SCR_006442 R Project for Statistical Computing R Development Core Team, 2019 R Project for Statistical Computing, RRID:SCR_001905 RSEM Li and Dewey, 2011 https://github.com/deweylab/RSEM Other Ensembl Aken et al., 2017 Ensembl Genome Browser, RRID:SCR_013367 TargetScan Agarwal et al., 2015 TargetScan, RRID:SCR_010845 Cell Reports 30, 4567–4583.e1–e5, March 31, 2020 e2
SYBR Green Assay:Article Title: LIN28B Underlies the Pathogenesis of a Subclass of Ewing Sarcoma LIN28B Control of EWS-FLI1 Stability.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-EWS Bethyl Cat#A300-418A; RRID: AB_420958 Mouse monoclonal anti-Tubulin Millipore Cat#CP06; RRID: AB_2617116 Rabbit polyclonal anti-FLI1 Abcam Cat#ab15289; RRID: AB_301825 Rabbit Anti-Human LIN28B Polyclonal Antibody Proteintech Cat# 16178-1-AP; RRID:AB_2135051 Rabbit Anti-Human LIN28B Polyclonal Antibody Cell Signaling Technology Cat# 4196; RRID:AB_2135047 Monoclonal Anti-GAPDH-Peroxidase antibody produced in mouse Sigma-Aldrich Cat# G9295; RRID:AB_1078992 Anti-Rabbit IgG (whole molecule)-Peroxidase antibody produced in goat Sigma-Aldrich Cat#A0545; RRID:AB_257896 Biological Samples EwS1-4 This paper See Table S3 hpMSC1-2 This paper See Method Details Chemicals, Peptides, and Recombinant Proteins IMDM, GlutaMAX SupplementIMDM Thermofisher Scientific Cat#31980022 DMEM, high glucose, GlutaMAX Supplement, pyruvate Thermofisher Scientific Cat#31966021 KnockOut Serum Replacement - Multi-Species Thermofisher Scientific Cat#10828028 FBS Good Forte PAN BIOTECH Cat#P40-49500 Trypsin-EDTA (0.05%), phenol red Thermofisher Scientific Cat#25300062 MEM Non-Essential Amino Acids Solution Thermofisher Scientific Cat#11140035 Penicillin-Streptomycin (10,000 U/mL) Thermofisher Scientific Cat#15140122 EGF Human PROSPEC Protein specialists Cat#CYT-217 FGF 2 Human PROSPEC Protein specialists Cat#CYT-218 Fugene 6 Promega Cat#E2692 Polybrene Sigma-Aldrich Cat#005557 Puromycin InvivoGen Cat#ant-pr-1 PowerUp SYBR Green Master Mix Applied Biosystems Cat#A25742 Calcein AM cell-permeable-dye Life Technologies Cat#C1430 Lin28 1632 Tocris Bioscience Cat#6068 Dimethyl sulfoxide Sigma-Aldrich Cat#41640 Actinomycin D Sigma-Aldrich Cat#A1410 VectaMount AQ Aqueous Mounting Medium Vector Laboratories CatH-5501 M-MLV Reverse Transcriptase Promega Cat#M170B RNasin Ribonuclease inhibitor Promega Cat#N211B RPMI 1640 Medium, GlutaMAX Supplement Thermofisher Scientific Cat#61870010 Lin28B RNAscope Probe ACD Cat#596361 dNTP set MP Biomedicals Cat#11NTACG100-CF Doxycycline hyclate Sigma-Aldrich Cat#D9891 Geneticin Thermofisher Scientific Cat#10131-027 FBS (tetracyclin-free) PAN BIOTECH Cat#P30-3602 Ketasol-100 Dr. E. Graeub AG Cat#668.51 Rompun 2% Provet AG Cat#1315 (Continued on next page) e1 Cell Reports 30, 4567–4583.e1–e5, March 31, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER PDGF-BB PeproTech Cat#100-14B Critical Commercial Assays miRCURY RNA Isolation Kit - Cell & Plant Exiqon Cat#300110 Click-iT Nascent RNA Capture Kit Life Technologies Cat#10365 NucleoSpin miRNA kit Macherey-Nagel Cat#740971 EZ-Magna RIPTM RNA-Binding Protein Immunoprecipitation kit MerckMillipore Cat#PP64B CellTiter 96 AQueous One Solution Cell Proliferation Assay Promega Cat#G3582 Deposited Data Gene expression data for Ewing sarcoma spheres generated for this project This Paper GEO: GSE122632 Gene expression data for primary Ewing sarcomas Savola et al., 2011 GEO: GSE17618 Gene expression data for primary Ewing sarcomas Brohl et al., 2014 https://pob.abcc.ncifcrf.gov/ cgi-bin/JK Gene sets for functional enrichment analysis Broad Institute Molecular Signatures Database, RRID:SCR_016863 ATARIS gene scores Aguirre et al., 2016 https://depmap.org/portal/download/ Experimental Models: Cell Lines Lenti-X 293T Clontech Cat#632180 A-673 ATCC Cat# CRL-1598, RRID:CVCL_0080 Experimental Models: Organisms/Strains NNOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ The Jackson Laboratory RRID:IMSR_JAX:005557 Oligonucleotides Random Primers Promega Cat#C118A Primer sequences for real-time PCR This paper see Table S5 sgRNA targeting Lin28B (exon2): CACCGCATCGACTGGAATATCCAAG Powers et al., 2016 N/A Recombinant DNA shRNA Lin28B n.1 Broad Institute, RNAi Consortium Cat#TRCN0000219859 shRNA Lin28B n.2 Broad Institute, RNAi Consortium Cat#TRCN0000122191 shRNA targeting EWS-FLI-1 Tirode et al., 2007 N/A pInd EWS-FLI1 Boulay et al., 2017 N/A Software and Algorithms FlowJo version 9.9.4 FLOWJI, LLC https://www.flowjo.com/ solutions/flowjo/, RRID:SCR_008520 Adobe Illustrator CC 2015 Adobe https://www.adobe.com/products/ illustrator.html, RRID:SCR_010279 GraphPad Prism version 8 GraphPad Software https://www.graphpad.com/, RRID:SCR_002798 Oligo Carvalho and Irizarry, 2010 Bioconductor, RRID:SCR_006442 Limma Ritchie et al., 2015 Bioconductor, RRID:SCR_006442 R Project for Statistical Computing R Development Core Team, 2019 R Project for Statistical Computing, RRID:SCR_001905 RSEM Li and Dewey, 2011 https://github.com/deweylab/RSEM Other Ensembl Aken et al., 2017 Ensembl Genome Browser, RRID:SCR_013367 TargetScan Agarwal et al., 2015 TargetScan, RRID:SCR_010845 Cell Reports 30, 4567–4583.e1–e5, March 31, 2020 e2
Reverse Transcription:Article Title: LIN28B Underlies the Pathogenesis of a Subclass of Ewing Sarcoma LIN28B Control of EWS-FLI1 Stability.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-EWS Bethyl Cat#A300-418A; RRID: AB_420958 Mouse monoclonal anti-Tubulin Millipore Cat#CP06; RRID: AB_2617116 Rabbit polyclonal anti-FLI1 Abcam Cat#ab15289; RRID: AB_301825 Rabbit Anti-Human LIN28B Polyclonal Antibody Proteintech Cat# 16178-1-AP; RRID:AB_2135051 Rabbit Anti-Human LIN28B Polyclonal Antibody Cell Signaling Technology Cat# 4196; RRID:AB_2135047 Monoclonal Anti-GAPDH-Peroxidase antibody produced in mouse Sigma-Aldrich Cat# G9295; RRID:AB_1078992 Anti-Rabbit IgG (whole molecule)-Peroxidase antibody produced in goat Sigma-Aldrich Cat#A0545; RRID:AB_257896 Biological Samples EwS1-4 This paper See Table S3 hpMSC1-2 This paper See Method Details Chemicals, Peptides, and Recombinant Proteins IMDM, GlutaMAX SupplementIMDM Thermofisher Scientific Cat#31980022 DMEM, high glucose, GlutaMAX Supplement, pyruvate Thermofisher Scientific Cat#31966021 KnockOut Serum Replacement - Multi-Species Thermofisher Scientific Cat#10828028 FBS Good Forte PAN BIOTECH Cat#P40-49500 Trypsin-EDTA (0.05%), phenol red Thermofisher Scientific Cat#25300062 MEM Non-Essential Amino Acids Solution Thermofisher Scientific Cat#11140035 Penicillin-Streptomycin (10,000 U/mL) Thermofisher Scientific Cat#15140122 EGF Human PROSPEC Protein specialists Cat#CYT-217 FGF 2 Human PROSPEC Protein specialists Cat#CYT-218 Fugene 6 Promega Cat#E2692 Polybrene Sigma-Aldrich Cat#005557 Puromycin InvivoGen Cat#ant-pr-1 PowerUp SYBR Green Master Mix Applied Biosystems Cat#A25742 Calcein AM cell-permeable-dye Life Technologies Cat#C1430 Lin28 1632 Tocris Bioscience Cat#6068 Dimethyl sulfoxide Sigma-Aldrich Cat#41640 Actinomycin D Sigma-Aldrich Cat#A1410 VectaMount AQ Aqueous Mounting Medium Vector Laboratories CatH-5501 M-MLV Reverse Transcriptase Promega Cat#M170B RNasin Ribonuclease inhibitor Promega Cat#N211B RPMI 1640 Medium, GlutaMAX Supplement Thermofisher Scientific Cat#61870010 Lin28B RNAscope Probe ACD Cat#596361 dNTP set MP Biomedicals Cat#11NTACG100-CF Doxycycline hyclate Sigma-Aldrich Cat#D9891 Geneticin Thermofisher Scientific Cat#10131-027 FBS (tetracyclin-free) PAN BIOTECH Cat#P30-3602 Ketasol-100 Dr. E. Graeub AG Cat#668.51 Rompun 2% Provet AG Cat#1315 (Continued on next page) e1 Cell Reports 30, 4567–4583.e1–e5, March 31, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER PDGF-BB PeproTech Cat#100-14B Critical Commercial Assays miRCURY RNA Isolation Kit - Cell & Plant Exiqon Cat#300110 Click-iT Nascent RNA Capture Kit Life Technologies Cat#10365 NucleoSpin miRNA kit Macherey-Nagel Cat#740971 EZ-Magna RIPTM RNA-Binding Protein Immunoprecipitation kit MerckMillipore Cat#PP64B CellTiter 96 AQueous One Solution Cell Proliferation Assay Promega Cat#G3582 Deposited Data Gene expression data for Ewing sarcoma spheres generated for this project This Paper GEO: GSE122632 Gene expression data for primary Ewing sarcomas Savola et al., 2011 GEO: GSE17618 Gene expression data for primary Ewing sarcomas Brohl et al., 2014 https://pob.abcc.ncifcrf.gov/ cgi-bin/JK Gene sets for functional enrichment analysis Broad Institute Molecular Signatures Database, RRID:SCR_016863 ATARIS gene scores Aguirre et al., 2016 https://depmap.org/portal/download/ Experimental Models: Cell Lines Lenti-X 293T Clontech Cat#632180 A-673 ATCC Cat# CRL-1598, RRID:CVCL_0080 Experimental Models: Organisms/Strains NNOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ The Jackson Laboratory RRID:IMSR_JAX:005557 Oligonucleotides Random Primers Promega Cat#C118A Primer sequences for real-time PCR This paper see Table S5 sgRNA targeting Lin28B (exon2): CACCGCATCGACTGGAATATCCAAG Powers et al., 2016 N/A Recombinant DNA shRNA Lin28B n.1 Broad Institute, RNAi Consortium Cat#TRCN0000219859 shRNA Lin28B n.2 Broad Institute, RNAi Consortium Cat#TRCN0000122191 shRNA targeting EWS-FLI-1 Tirode et al., 2007 N/A pInd EWS-FLI1 Boulay et al., 2017 N/A Software and Algorithms FlowJo version 9.9.4 FLOWJI, LLC https://www.flowjo.com/ solutions/flowjo/, RRID:SCR_008520 Adobe Illustrator CC 2015 Adobe https://www.adobe.com/products/ illustrator.html, RRID:SCR_010279 GraphPad Prism version 8 GraphPad Software https://www.graphpad.com/, RRID:SCR_002798 Oligo Carvalho and Irizarry, 2010 Bioconductor, RRID:SCR_006442 Limma Ritchie et al., 2015 Bioconductor, RRID:SCR_006442 R Project for Statistical Computing R Development Core Team, 2019 R Project for Statistical Computing, RRID:SCR_001905 RSEM Li and Dewey, 2011 https://github.com/deweylab/RSEM Other Ensembl Aken et al., 2017 Ensembl Genome Browser, RRID:SCR_013367 TargetScan Agarwal et al., 2015 TargetScan, RRID:SCR_010845 Cell Reports 30, 4567–4583.e1–e5, March 31, 2020 e2
RNAscope:Article Title: LIN28B Underlies the Pathogenesis of a Subclass of Ewing Sarcoma LIN28B Control of EWS-FLI1 Stability.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-EWS Bethyl Cat#A300-418A; RRID: AB_420958 Mouse monoclonal anti-Tubulin Millipore Cat#CP06; RRID: AB_2617116 Rabbit polyclonal anti-FLI1 Abcam Cat#ab15289; RRID: AB_301825 Rabbit Anti-Human LIN28B Polyclonal Antibody Proteintech Cat# 16178-1-AP; RRID:AB_2135051 Rabbit Anti-Human LIN28B Polyclonal Antibody Cell Signaling Technology Cat# 4196; RRID:AB_2135047 Monoclonal Anti-GAPDH-Peroxidase antibody produced in mouse Sigma-Aldrich Cat# G9295; RRID:AB_1078992 Anti-Rabbit IgG (whole molecule)-Peroxidase antibody produced in goat Sigma-Aldrich Cat#A0545; RRID:AB_257896 Biological Samples EwS1-4 This paper See Table S3 hpMSC1-2 This paper See Method Details Chemicals, Peptides, and Recombinant Proteins IMDM, GlutaMAX SupplementIMDM Thermofisher Scientific Cat#31980022 DMEM, high glucose, GlutaMAX Supplement, pyruvate Thermofisher Scientific Cat#31966021 KnockOut Serum Replacement - Multi-Species Thermofisher Scientific Cat#10828028 FBS Good Forte PAN BIOTECH Cat#P40-49500 Trypsin-EDTA (0.05%), phenol red Thermofisher Scientific Cat#25300062 MEM Non-Essential Amino Acids Solution Thermofisher Scientific Cat#11140035 Penicillin-Streptomycin (10,000 U/mL) Thermofisher Scientific Cat#15140122 EGF Human PROSPEC Protein specialists Cat#CYT-217 FGF 2 Human PROSPEC Protein specialists Cat#CYT-218 Fugene 6 Promega Cat#E2692 Polybrene Sigma-Aldrich Cat#005557 Puromycin InvivoGen Cat#ant-pr-1 PowerUp SYBR Green Master Mix Applied Biosystems Cat#A25742 Calcein AM cell-permeable-dye Life Technologies Cat#C1430 Lin28 1632 Tocris Bioscience Cat#6068 Dimethyl sulfoxide Sigma-Aldrich Cat#41640 Actinomycin D Sigma-Aldrich Cat#A1410 VectaMount AQ Aqueous Mounting Medium Vector Laboratories CatH-5501 M-MLV Reverse Transcriptase Promega Cat#M170B RNasin Ribonuclease inhibitor Promega Cat#N211B RPMI 1640 Medium, GlutaMAX Supplement Thermofisher Scientific Cat#61870010 Lin28B RNAscope Probe ACD Cat#596361 dNTP set MP Biomedicals Cat#11NTACG100-CF Doxycycline hyclate Sigma-Aldrich Cat#D9891 Geneticin Thermofisher Scientific Cat#10131-027 FBS (tetracyclin-free) PAN BIOTECH Cat#P30-3602 Ketasol-100 Dr. E. Graeub AG Cat#668.51 Rompun 2% Provet AG Cat#1315 (Continued on next page) e1 Cell Reports 30, 4567–4583.e1–e5, March 31, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER PDGF-BB PeproTech Cat#100-14B Critical Commercial Assays miRCURY RNA Isolation Kit - Cell & Plant Exiqon Cat#300110 Click-iT Nascent RNA Capture Kit Life Technologies Cat#10365 NucleoSpin miRNA kit Macherey-Nagel Cat#740971 EZ-Magna RIPTM RNA-Binding Protein Immunoprecipitation kit MerckMillipore Cat#PP64B CellTiter 96 AQueous One Solution Cell Proliferation Assay Promega Cat#G3582 Deposited Data Gene expression data for Ewing sarcoma spheres generated for this project This Paper GEO: GSE122632 Gene expression data for primary Ewing sarcomas Savola et al., 2011 GEO: GSE17618 Gene expression data for primary Ewing sarcomas Brohl et al., 2014 https://pob.abcc.ncifcrf.gov/ cgi-bin/JK Gene sets for functional enrichment analysis Broad Institute Molecular Signatures Database, RRID:SCR_016863 ATARIS gene scores Aguirre et al., 2016 https://depmap.org/portal/download/ Experimental Models: Cell Lines Lenti-X 293T Clontech Cat#632180 A-673 ATCC Cat# CRL-1598, RRID:CVCL_0080 Experimental Models: Organisms/Strains NNOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ The Jackson Laboratory RRID:IMSR_JAX:005557 Oligonucleotides Random Primers Promega Cat#C118A Primer sequences for real-time PCR This paper see Table S5 sgRNA targeting Lin28B (exon2): CACCGCATCGACTGGAATATCCAAG Powers et al., 2016 N/A Recombinant DNA shRNA Lin28B n.1 Broad Institute, RNAi Consortium Cat#TRCN0000219859 shRNA Lin28B n.2 Broad Institute, RNAi Consortium Cat#TRCN0000122191 shRNA targeting EWS-FLI-1 Tirode et al., 2007 N/A pInd EWS-FLI1 Boulay et al., 2017 N/A Software and Algorithms FlowJo version 9.9.4 FLOWJI, LLC https://www.flowjo.com/ solutions/flowjo/, RRID:SCR_008520 Adobe Illustrator CC 2015 Adobe https://www.adobe.com/products/ illustrator.html, RRID:SCR_010279 GraphPad Prism version 8 GraphPad Software https://www.graphpad.com/, RRID:SCR_002798 Oligo Carvalho and Irizarry, 2010 Bioconductor, RRID:SCR_006442 Limma Ritchie et al., 2015 Bioconductor, RRID:SCR_006442 R Project for Statistical Computing R Development Core Team, 2019 R Project for Statistical Computing, RRID:SCR_001905 RSEM Li and Dewey, 2011 https://github.com/deweylab/RSEM Other Ensembl Aken et al., 2017 Ensembl Genome Browser, RRID:SCR_013367 TargetScan Agarwal et al., 2015 TargetScan, RRID:SCR_010845 Cell Reports 30, 4567–4583.e1–e5, March 31, 2020 e2
|
Vector Laboratories is a verified supplier 
Vector Laboratories manufactures this product 