Review



vectamount aq aqueous mounting medium  (Vector Laboratories)


Bioz Verified Symbol Vector Laboratories is a verified supplier
Bioz Manufacturer Symbol Vector Laboratories manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Vector Laboratories vectamount aq aqueous mounting medium
    Vectamount Aq Aqueous Mounting Medium, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 96/100, based on 516 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/h+5501/VectaMount+AQ+Aqueous+Mounting+Medium/custom%40h-5501%4042564426
    Average 96 stars, based on 516 article reviews
    vectamount aq aqueous mounting medium - by Bioz Stars, 2026-10
    96/100 stars

    Images

    Related Articles

    Microscopy:

    Article Title: Inhibition of AhR improves cortical bone and skeletal muscle function via preservation of neuromuscular junctions.
    Article Snippet: Muscles were 503 cryosectioned (30 micron) parallel with muscle fiber orientation, permeabilized with 0.3% Triton X-100 504 in 1X PBS, and stained with 1μg/ml alpha-bungarotoxin (Biotium #00005-100μg) in 1X PBS in a dark 505 humidified chamber. .. Sections were counterstained with 0.005mg/ml Hoechst (Invitrogen #H1399) in 1X 506 PBS prior to mounting (Vectamount #H-5501, Vector Laboratories) and imaged on a Leica 507 STELLARIS confocal microscope using a 40X oil immersion objective. ..

    other:

    Article Title: Polymer embedding of membrane lungs for histological investigations of intra-device clot formation
    Article Snippet: 49 , VectaMount® AQ , H-5501, Vector Laboratories, Newark, CA, USA.

    Produced:

    Article Title: LIN28B Underlies the Pathogenesis of a Subclass of Ewing Sarcoma LIN28B Control of EWS-FLI1 Stability.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-EWS Bethyl Cat#A300-418A; RRID: AB_420958 Mouse monoclonal anti-Tubulin Millipore Cat#CP06; RRID: AB_2617116 Rabbit polyclonal anti-FLI1 Abcam Cat#ab15289; RRID: AB_301825 Rabbit Anti-Human LIN28B Polyclonal Antibody Proteintech Cat# 16178-1-AP; RRID:AB_2135051 Rabbit Anti-Human LIN28B Polyclonal Antibody Cell Signaling Technology Cat# 4196; RRID:AB_2135047 Monoclonal Anti-GAPDH-Peroxidase antibody produced in mouse Sigma-Aldrich Cat# G9295; RRID:AB_1078992 Anti-Rabbit IgG (whole molecule)-Peroxidase antibody produced in goat Sigma-Aldrich Cat#A0545; RRID:AB_257896 Biological Samples EwS1-4 This paper See Table S3 hpMSC1-2 This paper See Method Details Chemicals, Peptides, and Recombinant Proteins IMDM, GlutaMAX SupplementIMDM Thermofisher Scientific Cat#31980022 DMEM, high glucose, GlutaMAX Supplement, pyruvate Thermofisher Scientific Cat#31966021 KnockOut Serum Replacement - Multi-Species Thermofisher Scientific Cat#10828028 FBS Good Forte PAN BIOTECH Cat#P40-49500 Trypsin-EDTA (0.05%), phenol red Thermofisher Scientific Cat#25300062 MEM Non-Essential Amino Acids Solution Thermofisher Scientific Cat#11140035 Penicillin-Streptomycin (10,000 U/mL) Thermofisher Scientific Cat#15140122 EGF Human PROSPEC Protein specialists Cat#CYT-217 FGF 2 Human PROSPEC Protein specialists Cat#CYT-218 Fugene 6 Promega Cat#E2692 Polybrene Sigma-Aldrich Cat#005557 Puromycin InvivoGen Cat#ant-pr-1 PowerUp SYBR Green Master Mix Applied Biosystems Cat#A25742 Calcein AM cell-permeable-dye Life Technologies Cat#C1430 Lin28 1632 Tocris Bioscience Cat#6068 Dimethyl sulfoxide Sigma-Aldrich Cat#41640 Actinomycin D Sigma-Aldrich Cat#A1410 VectaMount AQ Aqueous Mounting Medium Vector Laboratories CatH-5501 M-MLV Reverse Transcriptase Promega Cat#M170B RNasin Ribonuclease inhibitor Promega Cat#N211B RPMI 1640 Medium, GlutaMAX Supplement Thermofisher Scientific Cat#61870010 Lin28B RNAscope Probe ACD Cat#596361 dNTP set MP Biomedicals Cat#11NTACG100-CF Doxycycline hyclate Sigma-Aldrich Cat#D9891 Geneticin Thermofisher Scientific Cat#10131-027 FBS (tetracyclin-free) PAN BIOTECH Cat#P30-3602 Ketasol-100 Dr. E. Graeub AG Cat#668.51 Rompun 2% Provet AG Cat#1315 (Continued on next page) e1 Cell Reports 30, 4567–4583.e1–e5, March 31, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER PDGF-BB PeproTech Cat#100-14B Critical Commercial Assays miRCURY RNA Isolation Kit - Cell & Plant Exiqon Cat#300110 Click-iT Nascent RNA Capture Kit Life Technologies Cat#10365 NucleoSpin miRNA kit Macherey-Nagel Cat#740971 EZ-Magna RIPTM RNA-Binding Protein Immunoprecipitation kit MerckMillipore Cat#PP64B CellTiter 96 AQueous One Solution Cell Proliferation Assay Promega Cat#G3582 Deposited Data Gene expression data for Ewing sarcoma spheres generated for this project This Paper GEO: GSE122632 Gene expression data for primary Ewing sarcomas Savola et al., 2011 GEO: GSE17618 Gene expression data for primary Ewing sarcomas Brohl et al., 2014 https://pob.abcc.ncifcrf.gov/ cgi-bin/JK Gene sets for functional enrichment analysis Broad Institute Molecular Signatures Database, RRID:SCR_016863 ATARIS gene scores Aguirre et al., 2016 https://depmap.org/portal/download/ Experimental Models: Cell Lines Lenti-X 293T Clontech Cat#632180 A-673 ATCC Cat# CRL-1598, RRID:CVCL_0080 Experimental Models: Organisms/Strains NNOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ The Jackson Laboratory RRID:IMSR_JAX:005557 Oligonucleotides Random Primers Promega Cat#C118A Primer sequences for real-time PCR This paper see Table S5 sgRNA targeting Lin28B (exon2): CACCGCATCGACTGGAATATCCAAG Powers et al., 2016 N/A Recombinant DNA shRNA Lin28B n.1 Broad Institute, RNAi Consortium Cat#TRCN0000219859 shRNA Lin28B n.2 Broad Institute, RNAi Consortium Cat#TRCN0000122191 shRNA targeting EWS-FLI-1 Tirode et al., 2007 N/A pInd EWS-FLI1 Boulay et al., 2017 N/A Software and Algorithms FlowJo version 9.9.4 FLOWJI, LLC https://www.flowjo.com/ solutions/flowjo/, RRID:SCR_008520 Adobe Illustrator CC 2015 Adobe https://www.adobe.com/products/ illustrator.html, RRID:SCR_010279 GraphPad Prism version 8 GraphPad Software https://www.graphpad.com/, RRID:SCR_002798 Oligo Carvalho and Irizarry, 2010 Bioconductor, RRID:SCR_006442 Limma Ritchie et al., 2015 Bioconductor, RRID:SCR_006442 R Project for Statistical Computing R Development Core Team, 2019 R Project for Statistical Computing, RRID:SCR_001905 RSEM Li and Dewey, 2011 https://github.com/deweylab/RSEM Other Ensembl Aken et al., 2017 Ensembl Genome Browser, RRID:SCR_013367 TargetScan Agarwal et al., 2015 TargetScan, RRID:SCR_010845 Cell Reports 30, 4567–4583.e1–e5, March 31, 2020 e2

    Recombinant:

    Article Title: LIN28B Underlies the Pathogenesis of a Subclass of Ewing Sarcoma LIN28B Control of EWS-FLI1 Stability.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-EWS Bethyl Cat#A300-418A; RRID: AB_420958 Mouse monoclonal anti-Tubulin Millipore Cat#CP06; RRID: AB_2617116 Rabbit polyclonal anti-FLI1 Abcam Cat#ab15289; RRID: AB_301825 Rabbit Anti-Human LIN28B Polyclonal Antibody Proteintech Cat# 16178-1-AP; RRID:AB_2135051 Rabbit Anti-Human LIN28B Polyclonal Antibody Cell Signaling Technology Cat# 4196; RRID:AB_2135047 Monoclonal Anti-GAPDH-Peroxidase antibody produced in mouse Sigma-Aldrich Cat# G9295; RRID:AB_1078992 Anti-Rabbit IgG (whole molecule)-Peroxidase antibody produced in goat Sigma-Aldrich Cat#A0545; RRID:AB_257896 Biological Samples EwS1-4 This paper See Table S3 hpMSC1-2 This paper See Method Details Chemicals, Peptides, and Recombinant Proteins IMDM, GlutaMAX SupplementIMDM Thermofisher Scientific Cat#31980022 DMEM, high glucose, GlutaMAX Supplement, pyruvate Thermofisher Scientific Cat#31966021 KnockOut Serum Replacement - Multi-Species Thermofisher Scientific Cat#10828028 FBS Good Forte PAN BIOTECH Cat#P40-49500 Trypsin-EDTA (0.05%), phenol red Thermofisher Scientific Cat#25300062 MEM Non-Essential Amino Acids Solution Thermofisher Scientific Cat#11140035 Penicillin-Streptomycin (10,000 U/mL) Thermofisher Scientific Cat#15140122 EGF Human PROSPEC Protein specialists Cat#CYT-217 FGF 2 Human PROSPEC Protein specialists Cat#CYT-218 Fugene 6 Promega Cat#E2692 Polybrene Sigma-Aldrich Cat#005557 Puromycin InvivoGen Cat#ant-pr-1 PowerUp SYBR Green Master Mix Applied Biosystems Cat#A25742 Calcein AM cell-permeable-dye Life Technologies Cat#C1430 Lin28 1632 Tocris Bioscience Cat#6068 Dimethyl sulfoxide Sigma-Aldrich Cat#41640 Actinomycin D Sigma-Aldrich Cat#A1410 VectaMount AQ Aqueous Mounting Medium Vector Laboratories CatH-5501 M-MLV Reverse Transcriptase Promega Cat#M170B RNasin Ribonuclease inhibitor Promega Cat#N211B RPMI 1640 Medium, GlutaMAX Supplement Thermofisher Scientific Cat#61870010 Lin28B RNAscope Probe ACD Cat#596361 dNTP set MP Biomedicals Cat#11NTACG100-CF Doxycycline hyclate Sigma-Aldrich Cat#D9891 Geneticin Thermofisher Scientific Cat#10131-027 FBS (tetracyclin-free) PAN BIOTECH Cat#P30-3602 Ketasol-100 Dr. E. Graeub AG Cat#668.51 Rompun 2% Provet AG Cat#1315 (Continued on next page) e1 Cell Reports 30, 4567–4583.e1–e5, March 31, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER PDGF-BB PeproTech Cat#100-14B Critical Commercial Assays miRCURY RNA Isolation Kit - Cell & Plant Exiqon Cat#300110 Click-iT Nascent RNA Capture Kit Life Technologies Cat#10365 NucleoSpin miRNA kit Macherey-Nagel Cat#740971 EZ-Magna RIPTM RNA-Binding Protein Immunoprecipitation kit MerckMillipore Cat#PP64B CellTiter 96 AQueous One Solution Cell Proliferation Assay Promega Cat#G3582 Deposited Data Gene expression data for Ewing sarcoma spheres generated for this project This Paper GEO: GSE122632 Gene expression data for primary Ewing sarcomas Savola et al., 2011 GEO: GSE17618 Gene expression data for primary Ewing sarcomas Brohl et al., 2014 https://pob.abcc.ncifcrf.gov/ cgi-bin/JK Gene sets for functional enrichment analysis Broad Institute Molecular Signatures Database, RRID:SCR_016863 ATARIS gene scores Aguirre et al., 2016 https://depmap.org/portal/download/ Experimental Models: Cell Lines Lenti-X 293T Clontech Cat#632180 A-673 ATCC Cat# CRL-1598, RRID:CVCL_0080 Experimental Models: Organisms/Strains NNOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ The Jackson Laboratory RRID:IMSR_JAX:005557 Oligonucleotides Random Primers Promega Cat#C118A Primer sequences for real-time PCR This paper see Table S5 sgRNA targeting Lin28B (exon2): CACCGCATCGACTGGAATATCCAAG Powers et al., 2016 N/A Recombinant DNA shRNA Lin28B n.1 Broad Institute, RNAi Consortium Cat#TRCN0000219859 shRNA Lin28B n.2 Broad Institute, RNAi Consortium Cat#TRCN0000122191 shRNA targeting EWS-FLI-1 Tirode et al., 2007 N/A pInd EWS-FLI1 Boulay et al., 2017 N/A Software and Algorithms FlowJo version 9.9.4 FLOWJI, LLC https://www.flowjo.com/ solutions/flowjo/, RRID:SCR_008520 Adobe Illustrator CC 2015 Adobe https://www.adobe.com/products/ illustrator.html, RRID:SCR_010279 GraphPad Prism version 8 GraphPad Software https://www.graphpad.com/, RRID:SCR_002798 Oligo Carvalho and Irizarry, 2010 Bioconductor, RRID:SCR_006442 Limma Ritchie et al., 2015 Bioconductor, RRID:SCR_006442 R Project for Statistical Computing R Development Core Team, 2019 R Project for Statistical Computing, RRID:SCR_001905 RSEM Li and Dewey, 2011 https://github.com/deweylab/RSEM Other Ensembl Aken et al., 2017 Ensembl Genome Browser, RRID:SCR_013367 TargetScan Agarwal et al., 2015 TargetScan, RRID:SCR_010845 Cell Reports 30, 4567–4583.e1–e5, March 31, 2020 e2

    Knock-Out:

    Article Title: LIN28B Underlies the Pathogenesis of a Subclass of Ewing Sarcoma LIN28B Control of EWS-FLI1 Stability.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-EWS Bethyl Cat#A300-418A; RRID: AB_420958 Mouse monoclonal anti-Tubulin Millipore Cat#CP06; RRID: AB_2617116 Rabbit polyclonal anti-FLI1 Abcam Cat#ab15289; RRID: AB_301825 Rabbit Anti-Human LIN28B Polyclonal Antibody Proteintech Cat# 16178-1-AP; RRID:AB_2135051 Rabbit Anti-Human LIN28B Polyclonal Antibody Cell Signaling Technology Cat# 4196; RRID:AB_2135047 Monoclonal Anti-GAPDH-Peroxidase antibody produced in mouse Sigma-Aldrich Cat# G9295; RRID:AB_1078992 Anti-Rabbit IgG (whole molecule)-Peroxidase antibody produced in goat Sigma-Aldrich Cat#A0545; RRID:AB_257896 Biological Samples EwS1-4 This paper See Table S3 hpMSC1-2 This paper See Method Details Chemicals, Peptides, and Recombinant Proteins IMDM, GlutaMAX SupplementIMDM Thermofisher Scientific Cat#31980022 DMEM, high glucose, GlutaMAX Supplement, pyruvate Thermofisher Scientific Cat#31966021 KnockOut Serum Replacement - Multi-Species Thermofisher Scientific Cat#10828028 FBS Good Forte PAN BIOTECH Cat#P40-49500 Trypsin-EDTA (0.05%), phenol red Thermofisher Scientific Cat#25300062 MEM Non-Essential Amino Acids Solution Thermofisher Scientific Cat#11140035 Penicillin-Streptomycin (10,000 U/mL) Thermofisher Scientific Cat#15140122 EGF Human PROSPEC Protein specialists Cat#CYT-217 FGF 2 Human PROSPEC Protein specialists Cat#CYT-218 Fugene 6 Promega Cat#E2692 Polybrene Sigma-Aldrich Cat#005557 Puromycin InvivoGen Cat#ant-pr-1 PowerUp SYBR Green Master Mix Applied Biosystems Cat#A25742 Calcein AM cell-permeable-dye Life Technologies Cat#C1430 Lin28 1632 Tocris Bioscience Cat#6068 Dimethyl sulfoxide Sigma-Aldrich Cat#41640 Actinomycin D Sigma-Aldrich Cat#A1410 VectaMount AQ Aqueous Mounting Medium Vector Laboratories CatH-5501 M-MLV Reverse Transcriptase Promega Cat#M170B RNasin Ribonuclease inhibitor Promega Cat#N211B RPMI 1640 Medium, GlutaMAX Supplement Thermofisher Scientific Cat#61870010 Lin28B RNAscope Probe ACD Cat#596361 dNTP set MP Biomedicals Cat#11NTACG100-CF Doxycycline hyclate Sigma-Aldrich Cat#D9891 Geneticin Thermofisher Scientific Cat#10131-027 FBS (tetracyclin-free) PAN BIOTECH Cat#P30-3602 Ketasol-100 Dr. E. Graeub AG Cat#668.51 Rompun 2% Provet AG Cat#1315 (Continued on next page) e1 Cell Reports 30, 4567–4583.e1–e5, March 31, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER PDGF-BB PeproTech Cat#100-14B Critical Commercial Assays miRCURY RNA Isolation Kit - Cell & Plant Exiqon Cat#300110 Click-iT Nascent RNA Capture Kit Life Technologies Cat#10365 NucleoSpin miRNA kit Macherey-Nagel Cat#740971 EZ-Magna RIPTM RNA-Binding Protein Immunoprecipitation kit MerckMillipore Cat#PP64B CellTiter 96 AQueous One Solution Cell Proliferation Assay Promega Cat#G3582 Deposited Data Gene expression data for Ewing sarcoma spheres generated for this project This Paper GEO: GSE122632 Gene expression data for primary Ewing sarcomas Savola et al., 2011 GEO: GSE17618 Gene expression data for primary Ewing sarcomas Brohl et al., 2014 https://pob.abcc.ncifcrf.gov/ cgi-bin/JK Gene sets for functional enrichment analysis Broad Institute Molecular Signatures Database, RRID:SCR_016863 ATARIS gene scores Aguirre et al., 2016 https://depmap.org/portal/download/ Experimental Models: Cell Lines Lenti-X 293T Clontech Cat#632180 A-673 ATCC Cat# CRL-1598, RRID:CVCL_0080 Experimental Models: Organisms/Strains NNOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ The Jackson Laboratory RRID:IMSR_JAX:005557 Oligonucleotides Random Primers Promega Cat#C118A Primer sequences for real-time PCR This paper see Table S5 sgRNA targeting Lin28B (exon2): CACCGCATCGACTGGAATATCCAAG Powers et al., 2016 N/A Recombinant DNA shRNA Lin28B n.1 Broad Institute, RNAi Consortium Cat#TRCN0000219859 shRNA Lin28B n.2 Broad Institute, RNAi Consortium Cat#TRCN0000122191 shRNA targeting EWS-FLI-1 Tirode et al., 2007 N/A pInd EWS-FLI1 Boulay et al., 2017 N/A Software and Algorithms FlowJo version 9.9.4 FLOWJI, LLC https://www.flowjo.com/ solutions/flowjo/, RRID:SCR_008520 Adobe Illustrator CC 2015 Adobe https://www.adobe.com/products/ illustrator.html, RRID:SCR_010279 GraphPad Prism version 8 GraphPad Software https://www.graphpad.com/, RRID:SCR_002798 Oligo Carvalho and Irizarry, 2010 Bioconductor, RRID:SCR_006442 Limma Ritchie et al., 2015 Bioconductor, RRID:SCR_006442 R Project for Statistical Computing R Development Core Team, 2019 R Project for Statistical Computing, RRID:SCR_001905 RSEM Li and Dewey, 2011 https://github.com/deweylab/RSEM Other Ensembl Aken et al., 2017 Ensembl Genome Browser, RRID:SCR_013367 TargetScan Agarwal et al., 2015 TargetScan, RRID:SCR_010845 Cell Reports 30, 4567–4583.e1–e5, March 31, 2020 e2

    SYBR Green Assay:

    Article Title: LIN28B Underlies the Pathogenesis of a Subclass of Ewing Sarcoma LIN28B Control of EWS-FLI1 Stability.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-EWS Bethyl Cat#A300-418A; RRID: AB_420958 Mouse monoclonal anti-Tubulin Millipore Cat#CP06; RRID: AB_2617116 Rabbit polyclonal anti-FLI1 Abcam Cat#ab15289; RRID: AB_301825 Rabbit Anti-Human LIN28B Polyclonal Antibody Proteintech Cat# 16178-1-AP; RRID:AB_2135051 Rabbit Anti-Human LIN28B Polyclonal Antibody Cell Signaling Technology Cat# 4196; RRID:AB_2135047 Monoclonal Anti-GAPDH-Peroxidase antibody produced in mouse Sigma-Aldrich Cat# G9295; RRID:AB_1078992 Anti-Rabbit IgG (whole molecule)-Peroxidase antibody produced in goat Sigma-Aldrich Cat#A0545; RRID:AB_257896 Biological Samples EwS1-4 This paper See Table S3 hpMSC1-2 This paper See Method Details Chemicals, Peptides, and Recombinant Proteins IMDM, GlutaMAX SupplementIMDM Thermofisher Scientific Cat#31980022 DMEM, high glucose, GlutaMAX Supplement, pyruvate Thermofisher Scientific Cat#31966021 KnockOut Serum Replacement - Multi-Species Thermofisher Scientific Cat#10828028 FBS Good Forte PAN BIOTECH Cat#P40-49500 Trypsin-EDTA (0.05%), phenol red Thermofisher Scientific Cat#25300062 MEM Non-Essential Amino Acids Solution Thermofisher Scientific Cat#11140035 Penicillin-Streptomycin (10,000 U/mL) Thermofisher Scientific Cat#15140122 EGF Human PROSPEC Protein specialists Cat#CYT-217 FGF 2 Human PROSPEC Protein specialists Cat#CYT-218 Fugene 6 Promega Cat#E2692 Polybrene Sigma-Aldrich Cat#005557 Puromycin InvivoGen Cat#ant-pr-1 PowerUp SYBR Green Master Mix Applied Biosystems Cat#A25742 Calcein AM cell-permeable-dye Life Technologies Cat#C1430 Lin28 1632 Tocris Bioscience Cat#6068 Dimethyl sulfoxide Sigma-Aldrich Cat#41640 Actinomycin D Sigma-Aldrich Cat#A1410 VectaMount AQ Aqueous Mounting Medium Vector Laboratories CatH-5501 M-MLV Reverse Transcriptase Promega Cat#M170B RNasin Ribonuclease inhibitor Promega Cat#N211B RPMI 1640 Medium, GlutaMAX Supplement Thermofisher Scientific Cat#61870010 Lin28B RNAscope Probe ACD Cat#596361 dNTP set MP Biomedicals Cat#11NTACG100-CF Doxycycline hyclate Sigma-Aldrich Cat#D9891 Geneticin Thermofisher Scientific Cat#10131-027 FBS (tetracyclin-free) PAN BIOTECH Cat#P30-3602 Ketasol-100 Dr. E. Graeub AG Cat#668.51 Rompun 2% Provet AG Cat#1315 (Continued on next page) e1 Cell Reports 30, 4567–4583.e1–e5, March 31, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER PDGF-BB PeproTech Cat#100-14B Critical Commercial Assays miRCURY RNA Isolation Kit - Cell & Plant Exiqon Cat#300110 Click-iT Nascent RNA Capture Kit Life Technologies Cat#10365 NucleoSpin miRNA kit Macherey-Nagel Cat#740971 EZ-Magna RIPTM RNA-Binding Protein Immunoprecipitation kit MerckMillipore Cat#PP64B CellTiter 96 AQueous One Solution Cell Proliferation Assay Promega Cat#G3582 Deposited Data Gene expression data for Ewing sarcoma spheres generated for this project This Paper GEO: GSE122632 Gene expression data for primary Ewing sarcomas Savola et al., 2011 GEO: GSE17618 Gene expression data for primary Ewing sarcomas Brohl et al., 2014 https://pob.abcc.ncifcrf.gov/ cgi-bin/JK Gene sets for functional enrichment analysis Broad Institute Molecular Signatures Database, RRID:SCR_016863 ATARIS gene scores Aguirre et al., 2016 https://depmap.org/portal/download/ Experimental Models: Cell Lines Lenti-X 293T Clontech Cat#632180 A-673 ATCC Cat# CRL-1598, RRID:CVCL_0080 Experimental Models: Organisms/Strains NNOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ The Jackson Laboratory RRID:IMSR_JAX:005557 Oligonucleotides Random Primers Promega Cat#C118A Primer sequences for real-time PCR This paper see Table S5 sgRNA targeting Lin28B (exon2): CACCGCATCGACTGGAATATCCAAG Powers et al., 2016 N/A Recombinant DNA shRNA Lin28B n.1 Broad Institute, RNAi Consortium Cat#TRCN0000219859 shRNA Lin28B n.2 Broad Institute, RNAi Consortium Cat#TRCN0000122191 shRNA targeting EWS-FLI-1 Tirode et al., 2007 N/A pInd EWS-FLI1 Boulay et al., 2017 N/A Software and Algorithms FlowJo version 9.9.4 FLOWJI, LLC https://www.flowjo.com/ solutions/flowjo/, RRID:SCR_008520 Adobe Illustrator CC 2015 Adobe https://www.adobe.com/products/ illustrator.html, RRID:SCR_010279 GraphPad Prism version 8 GraphPad Software https://www.graphpad.com/, RRID:SCR_002798 Oligo Carvalho and Irizarry, 2010 Bioconductor, RRID:SCR_006442 Limma Ritchie et al., 2015 Bioconductor, RRID:SCR_006442 R Project for Statistical Computing R Development Core Team, 2019 R Project for Statistical Computing, RRID:SCR_001905 RSEM Li and Dewey, 2011 https://github.com/deweylab/RSEM Other Ensembl Aken et al., 2017 Ensembl Genome Browser, RRID:SCR_013367 TargetScan Agarwal et al., 2015 TargetScan, RRID:SCR_010845 Cell Reports 30, 4567–4583.e1–e5, March 31, 2020 e2

    Reverse Transcription:

    Article Title: LIN28B Underlies the Pathogenesis of a Subclass of Ewing Sarcoma LIN28B Control of EWS-FLI1 Stability.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-EWS Bethyl Cat#A300-418A; RRID: AB_420958 Mouse monoclonal anti-Tubulin Millipore Cat#CP06; RRID: AB_2617116 Rabbit polyclonal anti-FLI1 Abcam Cat#ab15289; RRID: AB_301825 Rabbit Anti-Human LIN28B Polyclonal Antibody Proteintech Cat# 16178-1-AP; RRID:AB_2135051 Rabbit Anti-Human LIN28B Polyclonal Antibody Cell Signaling Technology Cat# 4196; RRID:AB_2135047 Monoclonal Anti-GAPDH-Peroxidase antibody produced in mouse Sigma-Aldrich Cat# G9295; RRID:AB_1078992 Anti-Rabbit IgG (whole molecule)-Peroxidase antibody produced in goat Sigma-Aldrich Cat#A0545; RRID:AB_257896 Biological Samples EwS1-4 This paper See Table S3 hpMSC1-2 This paper See Method Details Chemicals, Peptides, and Recombinant Proteins IMDM, GlutaMAX SupplementIMDM Thermofisher Scientific Cat#31980022 DMEM, high glucose, GlutaMAX Supplement, pyruvate Thermofisher Scientific Cat#31966021 KnockOut Serum Replacement - Multi-Species Thermofisher Scientific Cat#10828028 FBS Good Forte PAN BIOTECH Cat#P40-49500 Trypsin-EDTA (0.05%), phenol red Thermofisher Scientific Cat#25300062 MEM Non-Essential Amino Acids Solution Thermofisher Scientific Cat#11140035 Penicillin-Streptomycin (10,000 U/mL) Thermofisher Scientific Cat#15140122 EGF Human PROSPEC Protein specialists Cat#CYT-217 FGF 2 Human PROSPEC Protein specialists Cat#CYT-218 Fugene 6 Promega Cat#E2692 Polybrene Sigma-Aldrich Cat#005557 Puromycin InvivoGen Cat#ant-pr-1 PowerUp SYBR Green Master Mix Applied Biosystems Cat#A25742 Calcein AM cell-permeable-dye Life Technologies Cat#C1430 Lin28 1632 Tocris Bioscience Cat#6068 Dimethyl sulfoxide Sigma-Aldrich Cat#41640 Actinomycin D Sigma-Aldrich Cat#A1410 VectaMount AQ Aqueous Mounting Medium Vector Laboratories CatH-5501 M-MLV Reverse Transcriptase Promega Cat#M170B RNasin Ribonuclease inhibitor Promega Cat#N211B RPMI 1640 Medium, GlutaMAX Supplement Thermofisher Scientific Cat#61870010 Lin28B RNAscope Probe ACD Cat#596361 dNTP set MP Biomedicals Cat#11NTACG100-CF Doxycycline hyclate Sigma-Aldrich Cat#D9891 Geneticin Thermofisher Scientific Cat#10131-027 FBS (tetracyclin-free) PAN BIOTECH Cat#P30-3602 Ketasol-100 Dr. E. Graeub AG Cat#668.51 Rompun 2% Provet AG Cat#1315 (Continued on next page) e1 Cell Reports 30, 4567–4583.e1–e5, March 31, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER PDGF-BB PeproTech Cat#100-14B Critical Commercial Assays miRCURY RNA Isolation Kit - Cell & Plant Exiqon Cat#300110 Click-iT Nascent RNA Capture Kit Life Technologies Cat#10365 NucleoSpin miRNA kit Macherey-Nagel Cat#740971 EZ-Magna RIPTM RNA-Binding Protein Immunoprecipitation kit MerckMillipore Cat#PP64B CellTiter 96 AQueous One Solution Cell Proliferation Assay Promega Cat#G3582 Deposited Data Gene expression data for Ewing sarcoma spheres generated for this project This Paper GEO: GSE122632 Gene expression data for primary Ewing sarcomas Savola et al., 2011 GEO: GSE17618 Gene expression data for primary Ewing sarcomas Brohl et al., 2014 https://pob.abcc.ncifcrf.gov/ cgi-bin/JK Gene sets for functional enrichment analysis Broad Institute Molecular Signatures Database, RRID:SCR_016863 ATARIS gene scores Aguirre et al., 2016 https://depmap.org/portal/download/ Experimental Models: Cell Lines Lenti-X 293T Clontech Cat#632180 A-673 ATCC Cat# CRL-1598, RRID:CVCL_0080 Experimental Models: Organisms/Strains NNOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ The Jackson Laboratory RRID:IMSR_JAX:005557 Oligonucleotides Random Primers Promega Cat#C118A Primer sequences for real-time PCR This paper see Table S5 sgRNA targeting Lin28B (exon2): CACCGCATCGACTGGAATATCCAAG Powers et al., 2016 N/A Recombinant DNA shRNA Lin28B n.1 Broad Institute, RNAi Consortium Cat#TRCN0000219859 shRNA Lin28B n.2 Broad Institute, RNAi Consortium Cat#TRCN0000122191 shRNA targeting EWS-FLI-1 Tirode et al., 2007 N/A pInd EWS-FLI1 Boulay et al., 2017 N/A Software and Algorithms FlowJo version 9.9.4 FLOWJI, LLC https://www.flowjo.com/ solutions/flowjo/, RRID:SCR_008520 Adobe Illustrator CC 2015 Adobe https://www.adobe.com/products/ illustrator.html, RRID:SCR_010279 GraphPad Prism version 8 GraphPad Software https://www.graphpad.com/, RRID:SCR_002798 Oligo Carvalho and Irizarry, 2010 Bioconductor, RRID:SCR_006442 Limma Ritchie et al., 2015 Bioconductor, RRID:SCR_006442 R Project for Statistical Computing R Development Core Team, 2019 R Project for Statistical Computing, RRID:SCR_001905 RSEM Li and Dewey, 2011 https://github.com/deweylab/RSEM Other Ensembl Aken et al., 2017 Ensembl Genome Browser, RRID:SCR_013367 TargetScan Agarwal et al., 2015 TargetScan, RRID:SCR_010845 Cell Reports 30, 4567–4583.e1–e5, March 31, 2020 e2

    RNAscope:

    Article Title: LIN28B Underlies the Pathogenesis of a Subclass of Ewing Sarcoma LIN28B Control of EWS-FLI1 Stability.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-EWS Bethyl Cat#A300-418A; RRID: AB_420958 Mouse monoclonal anti-Tubulin Millipore Cat#CP06; RRID: AB_2617116 Rabbit polyclonal anti-FLI1 Abcam Cat#ab15289; RRID: AB_301825 Rabbit Anti-Human LIN28B Polyclonal Antibody Proteintech Cat# 16178-1-AP; RRID:AB_2135051 Rabbit Anti-Human LIN28B Polyclonal Antibody Cell Signaling Technology Cat# 4196; RRID:AB_2135047 Monoclonal Anti-GAPDH-Peroxidase antibody produced in mouse Sigma-Aldrich Cat# G9295; RRID:AB_1078992 Anti-Rabbit IgG (whole molecule)-Peroxidase antibody produced in goat Sigma-Aldrich Cat#A0545; RRID:AB_257896 Biological Samples EwS1-4 This paper See Table S3 hpMSC1-2 This paper See Method Details Chemicals, Peptides, and Recombinant Proteins IMDM, GlutaMAX SupplementIMDM Thermofisher Scientific Cat#31980022 DMEM, high glucose, GlutaMAX Supplement, pyruvate Thermofisher Scientific Cat#31966021 KnockOut Serum Replacement - Multi-Species Thermofisher Scientific Cat#10828028 FBS Good Forte PAN BIOTECH Cat#P40-49500 Trypsin-EDTA (0.05%), phenol red Thermofisher Scientific Cat#25300062 MEM Non-Essential Amino Acids Solution Thermofisher Scientific Cat#11140035 Penicillin-Streptomycin (10,000 U/mL) Thermofisher Scientific Cat#15140122 EGF Human PROSPEC Protein specialists Cat#CYT-217 FGF 2 Human PROSPEC Protein specialists Cat#CYT-218 Fugene 6 Promega Cat#E2692 Polybrene Sigma-Aldrich Cat#005557 Puromycin InvivoGen Cat#ant-pr-1 PowerUp SYBR Green Master Mix Applied Biosystems Cat#A25742 Calcein AM cell-permeable-dye Life Technologies Cat#C1430 Lin28 1632 Tocris Bioscience Cat#6068 Dimethyl sulfoxide Sigma-Aldrich Cat#41640 Actinomycin D Sigma-Aldrich Cat#A1410 VectaMount AQ Aqueous Mounting Medium Vector Laboratories CatH-5501 M-MLV Reverse Transcriptase Promega Cat#M170B RNasin Ribonuclease inhibitor Promega Cat#N211B RPMI 1640 Medium, GlutaMAX Supplement Thermofisher Scientific Cat#61870010 Lin28B RNAscope Probe ACD Cat#596361 dNTP set MP Biomedicals Cat#11NTACG100-CF Doxycycline hyclate Sigma-Aldrich Cat#D9891 Geneticin Thermofisher Scientific Cat#10131-027 FBS (tetracyclin-free) PAN BIOTECH Cat#P30-3602 Ketasol-100 Dr. E. Graeub AG Cat#668.51 Rompun 2% Provet AG Cat#1315 (Continued on next page) e1 Cell Reports 30, 4567–4583.e1–e5, March 31, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER PDGF-BB PeproTech Cat#100-14B Critical Commercial Assays miRCURY RNA Isolation Kit - Cell & Plant Exiqon Cat#300110 Click-iT Nascent RNA Capture Kit Life Technologies Cat#10365 NucleoSpin miRNA kit Macherey-Nagel Cat#740971 EZ-Magna RIPTM RNA-Binding Protein Immunoprecipitation kit MerckMillipore Cat#PP64B CellTiter 96 AQueous One Solution Cell Proliferation Assay Promega Cat#G3582 Deposited Data Gene expression data for Ewing sarcoma spheres generated for this project This Paper GEO: GSE122632 Gene expression data for primary Ewing sarcomas Savola et al., 2011 GEO: GSE17618 Gene expression data for primary Ewing sarcomas Brohl et al., 2014 https://pob.abcc.ncifcrf.gov/ cgi-bin/JK Gene sets for functional enrichment analysis Broad Institute Molecular Signatures Database, RRID:SCR_016863 ATARIS gene scores Aguirre et al., 2016 https://depmap.org/portal/download/ Experimental Models: Cell Lines Lenti-X 293T Clontech Cat#632180 A-673 ATCC Cat# CRL-1598, RRID:CVCL_0080 Experimental Models: Organisms/Strains NNOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ The Jackson Laboratory RRID:IMSR_JAX:005557 Oligonucleotides Random Primers Promega Cat#C118A Primer sequences for real-time PCR This paper see Table S5 sgRNA targeting Lin28B (exon2): CACCGCATCGACTGGAATATCCAAG Powers et al., 2016 N/A Recombinant DNA shRNA Lin28B n.1 Broad Institute, RNAi Consortium Cat#TRCN0000219859 shRNA Lin28B n.2 Broad Institute, RNAi Consortium Cat#TRCN0000122191 shRNA targeting EWS-FLI-1 Tirode et al., 2007 N/A pInd EWS-FLI1 Boulay et al., 2017 N/A Software and Algorithms FlowJo version 9.9.4 FLOWJI, LLC https://www.flowjo.com/ solutions/flowjo/, RRID:SCR_008520 Adobe Illustrator CC 2015 Adobe https://www.adobe.com/products/ illustrator.html, RRID:SCR_010279 GraphPad Prism version 8 GraphPad Software https://www.graphpad.com/, RRID:SCR_002798 Oligo Carvalho and Irizarry, 2010 Bioconductor, RRID:SCR_006442 Limma Ritchie et al., 2015 Bioconductor, RRID:SCR_006442 R Project for Statistical Computing R Development Core Team, 2019 R Project for Statistical Computing, RRID:SCR_001905 RSEM Li and Dewey, 2011 https://github.com/deweylab/RSEM Other Ensembl Aken et al., 2017 Ensembl Genome Browser, RRID:SCR_013367 TargetScan Agarwal et al., 2015 TargetScan, RRID:SCR_010845 Cell Reports 30, 4567–4583.e1–e5, March 31, 2020 e2



    Similar Products

    96
    Vector Laboratories vectamount aq aqueous mounting medium
    Vectamount Aq Aqueous Mounting Medium, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/h+5501/VectaMount+AQ+Aqueous+Mounting+Medium/custom%40h-5501%4042564426
    Average 96 stars, based on 1 article reviews
    vectamount aq aqueous mounting medium - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Vector Laboratories vectamount qa mounting medium
    Vectamount Qa Mounting Medium, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/h+5501/VectaMount+AQ+Aqueous+Mounting+Medium/pmc13053801-479-36-41
    Average 96 stars, based on 1 article reviews
    vectamount qa mounting medium - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Vector Laboratories vectamount mounting medium
    Vectamount Mounting Medium, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/h+5501/VectaMount+AQ+Aqueous+Mounting+Medium/bio_rxiv__64898__2026__03__24__711280-260-16-19
    Average 96 stars, based on 1 article reviews
    vectamount mounting medium - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Vector Laboratories vectamount aq
    Vectamount Aq, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/h+5501/VectaMount+AQ+Aqueous+Mounting+Medium/pm41855092-74-4-6
    Average 96 stars, based on 1 article reviews
    vectamount aq - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Vector Laboratories mounting media
    Mounting Media, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/h+5501/VectaMount+AQ+Aqueous+Mounting+Medium/pm41825961-150-9-13
    Average 96 stars, based on 1 article reviews
    mounting media - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    Image Search Results