Review



guide rna grna sequences targeting hspb1  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Addgene inc guide rna grna sequences targeting hspb1
    Guide Rna Grna Sequences Targeting Hspb1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+sequence/LSB-hsa-miR-299-5p+(Plasmid+%23103390)/pm42882493-70-0-19
    Average 94 stars, based on 10 article reviews
    guide rna grna sequences targeting hspb1 - by Bioz Stars, 2026-11
    94/100 stars

    Images

    Related Articles

    Sequencing:

    Article Title: CEP192 localises mitotic Aurora-A activity by priming its interaction with TPX2
    Article Snippet: .. pSpCas9-2A-GFP-CEP192 Exon11_5’_Guide 1 , This study. gRNA sequence in Appendix Table S . , Original plasmid from addgene Cat# 48138.. .. pSpCas9-2A-GFP-CEP192 Exon11_3’_Guide 1 , This study. gRNA sequence in Appendix Table S . , Original plasmid from addgene Cat# 48138..

    Article Title: Function-guided proximity mapping unveils electrophilic-metabolite sensing by proteins not present in their canonical locales
    Article Snippet: .. Entry Plasmid Hairpin sequences (1) shCyclinT1-35 (TRCN0000273835) CCGGGCCAATGTGAAGTCACAATATCTCGAGATATT GTGACTTCACATTGGCTTTTTG (2) shCyclinT1-36 (TRCN0000273836) CCGGAGATTGCCAAGAGTACTAAATCTCGAGATTTA GTACTCTTGGCAATCTTTTTTG (3) shHEXIM1-62 (TRCN0000245062) CCGGGCGGCATTGGAAACCGTACTACTCGAGTAGT ACGGTTTCCAATGCCGCTTTTTG (4) shHEXIM1-63 (TRCN0000245063) CCGGACACCAGCGATGACGACTTCACTCGAGTGAA GTCGTCATCGCTGGTGTTTTTTG (5) shHEXIM1-74 (TRCN0000074174) CCGGGCATTGGAAACCGTACTACAACTCGAGTTGT AGTACGGTTTCCAATGCTTTTTG (6) shLac Z (shRNA control)-D11 (TRCN0000231722) CGCGATCGTAATCACCCGAGT (7) shCDK9-92 (TRCN0000199892) CCGGGTTCGACTTCTGCGAGCATGACTCGAGTCAT GCTCGCAGAAGTCGAACTTTTTTG (8) shCDK9-94 (TRCN0000000494) CCGGGCACAGTTTGGTCCGTTAGAACTCGAGTTCT AACGGACCAAACTGTGCTTTTT (9) shCDK9-97 (TRCN0000000497) CCGGCTACTACATCCACAGAAACAACTCGAGTTGTT TCTGTGGATGTAGTAGTTTTT (10) shCyclinT1-28 (TRCN0000273837) CCGGTTAGGCTTTGAACTAACAATTCTCGAGAATTG TTAGTTCAAAGCCTAATTTTTG (11) shCyclinT1-29 (TRCN0000013673) CCGGGCCTTGTTTCTAGCAGCTAAACTCGAGTTTAG CTGCTAGAAACAAGGCTTTTT (12) shCyclinT1-17 (TRCN0000013677) CCGGCGGTGGTATTTCACTCGAGAACTCGAGTTCT CGAGTGAAATACCACCGTTTT Supplementary Table S3: siRNA sequences (from GE horizon dharmacon siRNA collection) Entry Plasmid Company Sequences (1) siCyclinT1-1 GE dharmacon UAGUAUACAUGCAUCGAUU (2) siCyclinT1-2 GE dharmacon GAACAAACGUCCUGGUGAU (3) siCyclinT1-3 GE dharmacon UAUCAACACUGCUAUAGUA (4) siCDK9 Santa Cruz (sc-29268) Sequence not released by supplier (Pooled siRNAs targeting human CDK9) (5) siCont Santa Cruz (sc-44233) Sequence not released by supplier (Scrambled sequence: siRNA control) Supplementary Table S4: gRNA sequence The following gRNA sequence was used in the lentiCRISPR v2 vector (Addgene #52961). ..

    Article Title: CEP192 localises mitotic Aurora-A activity by priming its interaction with TPX2
    Article Snippet: pSpCas9-2A-GFP-CEP192 Exon11_3’_Guide 1 , This study. gRNA sequence in Appendix Table S . , Original plasmid from addgene Cat# 48138.. .. pSpCas9-2A-GFP-CEP192 Exon11_3’_Guide 2 , This study. gRNA sequence in Appendix Table S . , Original plasmid from addgene Cat# 48138.. .. p53 CRISPR/Cas9 KO Plasmid , SantaCruz Biotechnology , Cat #sc-4146469.

    Article Title: Promoting the production of challenging proteins via induced expression in CHO cells and modified cell-free lysates harboring T7 RNA polymerase and mutant eIF2α
    Article Snippet: .. Gibson assembly was utilized to clone the gRNA sequence into the gRNA_cloning vector (Plasmid #41824 from Addgene) according to the protocol, as previously described [ ]. .. Plasmids based on the piX 3.0 backbone (Biotech Rabbit) are optimal for cell-free protein synthesis due to the presence of a T7 promotor and a T7 terminator as regulatory sequences for transcription.

    Article Title: CEP192 localises mitotic Aurora-A activity by priming its interaction with TPX2
    Article Snippet: pSpCas9-2A-GFP-CEP192 Exon11_5’_Guide 1 , This study. gRNA sequence in Appendix Table S . , Original plasmid from addgene Cat# 48138.. .. pSpCas9-2A-GFP-CEP192 Exon11_3’_Guide 1 , This study. gRNA sequence in Appendix Table S . , Original plasmid from addgene Cat# 48138.. .. pSpCas9-2A-GFP-CEP192 Exon11_3’_Guide 2 , This study. gRNA sequence in Appendix Table S . , Original plasmid from addgene Cat# 48138..

    Article Title: STI1 domain engages transient helices to mediate Dsk2 phase separation and proteasome condensation.
    Article Snippet: .. Each guide RNA was cloned into the 2 μ Cas9- and sgRNAexpressing vector pML107, replacing the original gRNA sequence (Addgene plasmid # 67639, (Laughery et al, 2015)). ..

    Article Title: Acetate controls endothelial-to-mesenchymal transition.
    Article Snippet: Article Acetate controls endothel ial-to-mesenchymal transition

    Plasmid Preparation:

    Article Title: CEP192 localises mitotic Aurora-A activity by priming its interaction with TPX2
    Article Snippet: .. pSpCas9-2A-GFP-CEP192 Exon11_5’_Guide 1 , This study. gRNA sequence in Appendix Table S . , Original plasmid from addgene Cat# 48138.. .. pSpCas9-2A-GFP-CEP192 Exon11_3’_Guide 1 , This study. gRNA sequence in Appendix Table S . , Original plasmid from addgene Cat# 48138..

    Article Title: Function-guided proximity mapping unveils electrophilic-metabolite sensing by proteins not present in their canonical locales
    Article Snippet: .. Entry Plasmid Hairpin sequences (1) shCyclinT1-35 (TRCN0000273835) CCGGGCCAATGTGAAGTCACAATATCTCGAGATATT GTGACTTCACATTGGCTTTTTG (2) shCyclinT1-36 (TRCN0000273836) CCGGAGATTGCCAAGAGTACTAAATCTCGAGATTTA GTACTCTTGGCAATCTTTTTTG (3) shHEXIM1-62 (TRCN0000245062) CCGGGCGGCATTGGAAACCGTACTACTCGAGTAGT ACGGTTTCCAATGCCGCTTTTTG (4) shHEXIM1-63 (TRCN0000245063) CCGGACACCAGCGATGACGACTTCACTCGAGTGAA GTCGTCATCGCTGGTGTTTTTTG (5) shHEXIM1-74 (TRCN0000074174) CCGGGCATTGGAAACCGTACTACAACTCGAGTTGT AGTACGGTTTCCAATGCTTTTTG (6) shLac Z (shRNA control)-D11 (TRCN0000231722) CGCGATCGTAATCACCCGAGT (7) shCDK9-92 (TRCN0000199892) CCGGGTTCGACTTCTGCGAGCATGACTCGAGTCAT GCTCGCAGAAGTCGAACTTTTTTG (8) shCDK9-94 (TRCN0000000494) CCGGGCACAGTTTGGTCCGTTAGAACTCGAGTTCT AACGGACCAAACTGTGCTTTTT (9) shCDK9-97 (TRCN0000000497) CCGGCTACTACATCCACAGAAACAACTCGAGTTGTT TCTGTGGATGTAGTAGTTTTT (10) shCyclinT1-28 (TRCN0000273837) CCGGTTAGGCTTTGAACTAACAATTCTCGAGAATTG TTAGTTCAAAGCCTAATTTTTG (11) shCyclinT1-29 (TRCN0000013673) CCGGGCCTTGTTTCTAGCAGCTAAACTCGAGTTTAG CTGCTAGAAACAAGGCTTTTT (12) shCyclinT1-17 (TRCN0000013677) CCGGCGGTGGTATTTCACTCGAGAACTCGAGTTCT CGAGTGAAATACCACCGTTTT Supplementary Table S3: siRNA sequences (from GE horizon dharmacon siRNA collection) Entry Plasmid Company Sequences (1) siCyclinT1-1 GE dharmacon UAGUAUACAUGCAUCGAUU (2) siCyclinT1-2 GE dharmacon GAACAAACGUCCUGGUGAU (3) siCyclinT1-3 GE dharmacon UAUCAACACUGCUAUAGUA (4) siCDK9 Santa Cruz (sc-29268) Sequence not released by supplier (Pooled siRNAs targeting human CDK9) (5) siCont Santa Cruz (sc-44233) Sequence not released by supplier (Scrambled sequence: siRNA control) Supplementary Table S4: gRNA sequence The following gRNA sequence was used in the lentiCRISPR v2 vector (Addgene #52961). ..

    Article Title: CEP192 localises mitotic Aurora-A activity by priming its interaction with TPX2
    Article Snippet: pSpCas9-2A-GFP-CEP192 Exon11_3’_Guide 1 , This study. gRNA sequence in Appendix Table S . , Original plasmid from addgene Cat# 48138.. .. pSpCas9-2A-GFP-CEP192 Exon11_3’_Guide 2 , This study. gRNA sequence in Appendix Table S . , Original plasmid from addgene Cat# 48138.. .. p53 CRISPR/Cas9 KO Plasmid , SantaCruz Biotechnology , Cat #sc-4146469.

    Article Title: Promoting the production of challenging proteins via induced expression in CHO cells and modified cell-free lysates harboring T7 RNA polymerase and mutant eIF2α
    Article Snippet: .. Gibson assembly was utilized to clone the gRNA sequence into the gRNA_cloning vector (Plasmid #41824 from Addgene) according to the protocol, as previously described [ ]. .. Plasmids based on the piX 3.0 backbone (Biotech Rabbit) are optimal for cell-free protein synthesis due to the presence of a T7 promotor and a T7 terminator as regulatory sequences for transcription.

    Article Title: CEP192 localises mitotic Aurora-A activity by priming its interaction with TPX2
    Article Snippet: pSpCas9-2A-GFP-CEP192 Exon11_5’_Guide 1 , This study. gRNA sequence in Appendix Table S . , Original plasmid from addgene Cat# 48138.. .. pSpCas9-2A-GFP-CEP192 Exon11_3’_Guide 1 , This study. gRNA sequence in Appendix Table S . , Original plasmid from addgene Cat# 48138.. .. pSpCas9-2A-GFP-CEP192 Exon11_3’_Guide 2 , This study. gRNA sequence in Appendix Table S . , Original plasmid from addgene Cat# 48138..

    Article Title: STI1 domain engages transient helices to mediate Dsk2 phase separation and proteasome condensation.
    Article Snippet: .. Each guide RNA was cloned into the 2 μ Cas9- and sgRNAexpressing vector pML107, replacing the original gRNA sequence (Addgene plasmid # 67639, (Laughery et al, 2015)). ..

    Article Title: Acetate controls endothelial-to-mesenchymal transition.
    Article Snippet: Article Acetate controls endothel ial-to-mesenchymal transition

    other:

    Article Title: Advanced human iPSC-based preclinical model for Parkinson’s disease with optogenetic alpha-synuclein aggregation
    Article Snippet: BCA protein assay kit , Pierce , Cat# 23228.

    shRNA:

    Article Title: Function-guided proximity mapping unveils electrophilic-metabolite sensing by proteins not present in their canonical locales
    Article Snippet: .. Entry Plasmid Hairpin sequences (1) shCyclinT1-35 (TRCN0000273835) CCGGGCCAATGTGAAGTCACAATATCTCGAGATATT GTGACTTCACATTGGCTTTTTG (2) shCyclinT1-36 (TRCN0000273836) CCGGAGATTGCCAAGAGTACTAAATCTCGAGATTTA GTACTCTTGGCAATCTTTTTTG (3) shHEXIM1-62 (TRCN0000245062) CCGGGCGGCATTGGAAACCGTACTACTCGAGTAGT ACGGTTTCCAATGCCGCTTTTTG (4) shHEXIM1-63 (TRCN0000245063) CCGGACACCAGCGATGACGACTTCACTCGAGTGAA GTCGTCATCGCTGGTGTTTTTTG (5) shHEXIM1-74 (TRCN0000074174) CCGGGCATTGGAAACCGTACTACAACTCGAGTTGT AGTACGGTTTCCAATGCTTTTTG (6) shLac Z (shRNA control)-D11 (TRCN0000231722) CGCGATCGTAATCACCCGAGT (7) shCDK9-92 (TRCN0000199892) CCGGGTTCGACTTCTGCGAGCATGACTCGAGTCAT GCTCGCAGAAGTCGAACTTTTTTG (8) shCDK9-94 (TRCN0000000494) CCGGGCACAGTTTGGTCCGTTAGAACTCGAGTTCT AACGGACCAAACTGTGCTTTTT (9) shCDK9-97 (TRCN0000000497) CCGGCTACTACATCCACAGAAACAACTCGAGTTGTT TCTGTGGATGTAGTAGTTTTT (10) shCyclinT1-28 (TRCN0000273837) CCGGTTAGGCTTTGAACTAACAATTCTCGAGAATTG TTAGTTCAAAGCCTAATTTTTG (11) shCyclinT1-29 (TRCN0000013673) CCGGGCCTTGTTTCTAGCAGCTAAACTCGAGTTTAG CTGCTAGAAACAAGGCTTTTT (12) shCyclinT1-17 (TRCN0000013677) CCGGCGGTGGTATTTCACTCGAGAACTCGAGTTCT CGAGTGAAATACCACCGTTTT Supplementary Table S3: siRNA sequences (from GE horizon dharmacon siRNA collection) Entry Plasmid Company Sequences (1) siCyclinT1-1 GE dharmacon UAGUAUACAUGCAUCGAUU (2) siCyclinT1-2 GE dharmacon GAACAAACGUCCUGGUGAU (3) siCyclinT1-3 GE dharmacon UAUCAACACUGCUAUAGUA (4) siCDK9 Santa Cruz (sc-29268) Sequence not released by supplier (Pooled siRNAs targeting human CDK9) (5) siCont Santa Cruz (sc-44233) Sequence not released by supplier (Scrambled sequence: siRNA control) Supplementary Table S4: gRNA sequence The following gRNA sequence was used in the lentiCRISPR v2 vector (Addgene #52961). ..

    Control:

    Article Title: Function-guided proximity mapping unveils electrophilic-metabolite sensing by proteins not present in their canonical locales
    Article Snippet: .. Entry Plasmid Hairpin sequences (1) shCyclinT1-35 (TRCN0000273835) CCGGGCCAATGTGAAGTCACAATATCTCGAGATATT GTGACTTCACATTGGCTTTTTG (2) shCyclinT1-36 (TRCN0000273836) CCGGAGATTGCCAAGAGTACTAAATCTCGAGATTTA GTACTCTTGGCAATCTTTTTTG (3) shHEXIM1-62 (TRCN0000245062) CCGGGCGGCATTGGAAACCGTACTACTCGAGTAGT ACGGTTTCCAATGCCGCTTTTTG (4) shHEXIM1-63 (TRCN0000245063) CCGGACACCAGCGATGACGACTTCACTCGAGTGAA GTCGTCATCGCTGGTGTTTTTTG (5) shHEXIM1-74 (TRCN0000074174) CCGGGCATTGGAAACCGTACTACAACTCGAGTTGT AGTACGGTTTCCAATGCTTTTTG (6) shLac Z (shRNA control)-D11 (TRCN0000231722) CGCGATCGTAATCACCCGAGT (7) shCDK9-92 (TRCN0000199892) CCGGGTTCGACTTCTGCGAGCATGACTCGAGTCAT GCTCGCAGAAGTCGAACTTTTTTG (8) shCDK9-94 (TRCN0000000494) CCGGGCACAGTTTGGTCCGTTAGAACTCGAGTTCT AACGGACCAAACTGTGCTTTTT (9) shCDK9-97 (TRCN0000000497) CCGGCTACTACATCCACAGAAACAACTCGAGTTGTT TCTGTGGATGTAGTAGTTTTT (10) shCyclinT1-28 (TRCN0000273837) CCGGTTAGGCTTTGAACTAACAATTCTCGAGAATTG TTAGTTCAAAGCCTAATTTTTG (11) shCyclinT1-29 (TRCN0000013673) CCGGGCCTTGTTTCTAGCAGCTAAACTCGAGTTTAG CTGCTAGAAACAAGGCTTTTT (12) shCyclinT1-17 (TRCN0000013677) CCGGCGGTGGTATTTCACTCGAGAACTCGAGTTCT CGAGTGAAATACCACCGTTTT Supplementary Table S3: siRNA sequences (from GE horizon dharmacon siRNA collection) Entry Plasmid Company Sequences (1) siCyclinT1-1 GE dharmacon UAGUAUACAUGCAUCGAUU (2) siCyclinT1-2 GE dharmacon GAACAAACGUCCUGGUGAU (3) siCyclinT1-3 GE dharmacon UAUCAACACUGCUAUAGUA (4) siCDK9 Santa Cruz (sc-29268) Sequence not released by supplier (Pooled siRNAs targeting human CDK9) (5) siCont Santa Cruz (sc-44233) Sequence not released by supplier (Scrambled sequence: siRNA control) Supplementary Table S4: gRNA sequence The following gRNA sequence was used in the lentiCRISPR v2 vector (Addgene #52961). ..

    Clone Assay:

    Article Title: STI1 domain engages transient helices to mediate Dsk2 phase separation and proteasome condensation.
    Article Snippet: .. Each guide RNA was cloned into the 2 μ Cas9- and sgRNAexpressing vector pML107, replacing the original gRNA sequence (Addgene plasmid # 67639, (Laughery et al, 2015)). ..

    Generated:

    Article Title: Acetate controls endothelial-to-mesenchymal transition.
    Article Snippet: Article Acetate controls endothel ial-to-mesenchymal transition



    Similar Products

    guide rna grna sequences targeting hspb1  (Addgene inc)
    94
    Addgene inc guide rna grna sequences targeting hspb1
    Guide Rna Grna Sequences Targeting Hspb1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+sequence/LSB-hsa-miR-299-5p+(Plasmid+%23103390)/pm42882493-70-0-19
    Average 94 stars, based on 1 article reviews
    guide rna grna sequences targeting hspb1 - by Bioz Stars, 2026-11
    94/100 stars
    		  Buy from Supplier
    guide rna grna sequences  (OriGene)
    95
    OriGene guide rna grna sequences
    Guide Rna Grna Sequences, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+sequence/pCas-Guide/pmc13183672-48-10-18
    Average 95 stars, based on 1 article reviews
    guide rna grna sequences - by Bioz Stars, 2026-11
    95/100 stars
    		  Buy from Supplier
    optimal single guide rna sgrna target sequences  (Benchling Inc)
    86
    Benchling Inc optimal single guide rna sgrna target sequences
    Optimal Single Guide Rna Sgrna Target Sequences, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+sequence/guide+rna/pm42167230-305-5-14
    Average 86 stars, based on 1 article reviews
    optimal single guide rna sgrna target sequences - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    coding sequence targeting guide rna  (Synthego Inc)
    86
    Synthego Inc coding sequence targeting guide rna
    Coding Sequence Targeting Guide Rna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+sequence/guide+rna+sequence/bio_rxiv__64898__2026__05__05__723075-352-4-8
    Average 86 stars, based on 1 article reviews
    coding sequence targeting guide rna - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    single guide rna sgrna sequences targeting fh  (Synthego Inc)
    86
    Synthego Inc single guide rna sgrna sequences targeting fh
    Single Guide Rna Sgrna Sequences Targeting Fh, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+sequence/sequences+sgrna/pm42082831-318-1-9
    Average 86 stars, based on 1 article reviews
    single guide rna sgrna sequences targeting fh - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    sanger sequencing grna sequences  (Synthego Inc)
    86
    Synthego Inc sanger sequencing grna sequences
    Sanger Sequencing Grna Sequences, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+sequence/sanger+sequencing/pmc12926986-179-3-11
    Average 86 stars, based on 1 article reviews
    sanger sequencing grna sequences - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    grna sequences  (Addgene inc)
    93
    Addgene inc grna sequences
    Grna Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+sequence/CROP-sgRNA-MS2+(Plasmid+%23153457)/pm41856116-865-64-67
    Average 93 stars, based on 1 article reviews
    grna sequences - by Bioz Stars, 2026-11
    93/100 stars
    		  Buy from Supplier
    grna sequences against rictor  (Addgene inc)
    94
    Addgene inc grna sequences against rictor
    Grna Sequences Against Rictor, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+sequence/pKLV2-U6gRNA5(Rictor-g1)-PGKpuroBFP-W+(Plasmid+%23105041)/pm41787128-326-4-10
    Average 94 stars, based on 1 article reviews
    grna sequences against rictor - by Bioz Stars, 2026-11
    94/100 stars
    		  Buy from Supplier
    press methods nucleotide sequences guide rna  (Synthego Inc)
    86
    Synthego Inc press methods nucleotide sequences guide rna
    Press Methods Nucleotide Sequences Guide Rna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+sequence/guide+rna/pm41741470-228-10-19
    Average 86 stars, based on 1 article reviews
    press methods nucleotide sequences guide rna - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    grna scaffold sequence  (Addgene inc)
    96
    Addgene inc grna scaffold sequence
    Results of CRISPR–Cas9 plasmids for targeted gene disruption in A. fijiensis . ( a ) <t>The</t> <t>sgRNA</t> scaffold sequence was amplified from plasmid pX330 using primers <t>gRNA-scaffold-F</t> and gRNA-scaffold-R. The predicted endogenous U6 promoter was amplified from the A. fijiensis genome using adaptor primers U6-1-F and U6-1-R containing 5′ overlapping sequences of the sgRNA scaffold. the 20 bp pyrG -targeting sgRNA sequence was seamlessly inserted between the U6 promoter and sgRNA scaffold using primers U6- pyrG -F and U6-1- pyrG -R. The plasmid backbone containing the Cas9 open reading frame and the AMA1 autonomous replication element was amplified from plasmid FM-6 using primers pAMA-1-F and pAMA1-R. The U6- pyrG -sgRNA expression cassette was amplified from pPu6- pyrG -sgRNA using primers U6-1-F and gRNA-scaffold-R, and subsequently inserted into the Cas9-containing backbone by homologous recombination to generate the final plasmid AFM-Δ pyrG . For clarity, DNA elements in the schematic are not drawn to scale. ( b ) Targeted disruption of the pyrG gene mediated by plasmid-based CRISPR-Cas9 editing in A. fijiensis . Diagnostic PCR analysis of genomic DNA from independent transformants in pyrG locus. The DNA molecular weight marker used was a 100–5000 bp DNA Marker III (Biosharp BL103A, Anhui, China). PCR amplification was performed using primers flanking the targeted integration region to distinguish wild-type and disrupted alleles.
    Grna Scaffold Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+sequence/pX330-U6-Chimeric_BB-CBh-hSpCas9+(Plasmid+%2342230)/pmc13027702-112-13-19
    Average 96 stars, based on 1 article reviews
    grna scaffold sequence - by Bioz Stars, 2026-11
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    Results of CRISPR–Cas9 plasmids for targeted gene disruption in A. fijiensis . ( a ) The sgRNA scaffold sequence was amplified from plasmid pX330 using primers gRNA-scaffold-F and gRNA-scaffold-R. The predicted endogenous U6 promoter was amplified from the A. fijiensis genome using adaptor primers U6-1-F and U6-1-R containing 5′ overlapping sequences of the sgRNA scaffold. the 20 bp pyrG -targeting sgRNA sequence was seamlessly inserted between the U6 promoter and sgRNA scaffold using primers U6- pyrG -F and U6-1- pyrG -R. The plasmid backbone containing the Cas9 open reading frame and the AMA1 autonomous replication element was amplified from plasmid FM-6 using primers pAMA-1-F and pAMA1-R. The U6- pyrG -sgRNA expression cassette was amplified from pPu6- pyrG -sgRNA using primers U6-1-F and gRNA-scaffold-R, and subsequently inserted into the Cas9-containing backbone by homologous recombination to generate the final plasmid AFM-Δ pyrG . For clarity, DNA elements in the schematic are not drawn to scale. ( b ) Targeted disruption of the pyrG gene mediated by plasmid-based CRISPR-Cas9 editing in A. fijiensis . Diagnostic PCR analysis of genomic DNA from independent transformants in pyrG locus. The DNA molecular weight marker used was a 100–5000 bp DNA Marker III (Biosharp BL103A, Anhui, China). PCR amplification was performed using primers flanking the targeted integration region to distinguish wild-type and disrupted alleles.

    Journal: Journal of Fungi

    Article Title: A High-Efficiency CRISPR–Cas9 Ribonucleoprotein Genome Editing System in Aspergillus fijiensis Enabled by Microhomology-Mediated End Joining

    doi: 10.3390/jof12030165

    Figure Lengend Snippet: Results of CRISPR–Cas9 plasmids for targeted gene disruption in A. fijiensis . ( a ) The sgRNA scaffold sequence was amplified from plasmid pX330 using primers gRNA-scaffold-F and gRNA-scaffold-R. The predicted endogenous U6 promoter was amplified from the A. fijiensis genome using adaptor primers U6-1-F and U6-1-R containing 5′ overlapping sequences of the sgRNA scaffold. the 20 bp pyrG -targeting sgRNA sequence was seamlessly inserted between the U6 promoter and sgRNA scaffold using primers U6- pyrG -F and U6-1- pyrG -R. The plasmid backbone containing the Cas9 open reading frame and the AMA1 autonomous replication element was amplified from plasmid FM-6 using primers pAMA-1-F and pAMA1-R. The U6- pyrG -sgRNA expression cassette was amplified from pPu6- pyrG -sgRNA using primers U6-1-F and gRNA-scaffold-R, and subsequently inserted into the Cas9-containing backbone by homologous recombination to generate the final plasmid AFM-Δ pyrG . For clarity, DNA elements in the schematic are not drawn to scale. ( b ) Targeted disruption of the pyrG gene mediated by plasmid-based CRISPR-Cas9 editing in A. fijiensis . Diagnostic PCR analysis of genomic DNA from independent transformants in pyrG locus. The DNA molecular weight marker used was a 100–5000 bp DNA Marker III (Biosharp BL103A, Anhui, China). PCR amplification was performed using primers flanking the targeted integration region to distinguish wild-type and disrupted alleles.

    Article Snippet: The sgRNA expression plasmid pPu6- pyrG -sgRNA was first generated by amplifying the gRNA scaffold sequence from pX330 plasmid (Addgene, Watertown, MA, USA, #42230) using primers gRNA-scaffold-F and gRNA-scaffold-R ( ).

    Techniques: CRISPR, Disruption, Sequencing, Amplification, Plasmid Preparation, Expressing, Homologous Recombination, Diagnostic Assay, Molecular Weight, Marker