Review



human melanoma g361 cells  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    ATCC human melanoma g361 cells
    Human Melanoma G361 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 468 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/g361+cells/pm41683370-54-0-4?v=ATCC
    Average 96 stars, based on 468 article reviews
    human melanoma g361 cells - by Bioz Stars, 2026-08
    96/100 stars

    Images



    Similar Products

    96
    ATCC human melanoma g361 cells
    Human Melanoma G361 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/g361+cells/pm41683370-54-0-4?v=ATCC
    Average 96 stars, based on 1 article reviews
    human melanoma g361 cells - by Bioz Stars, 2026-08
    96/100 stars
      Buy from Supplier

    86
    Synthego Inc crispr cas9 mediated sirt6 kd g361 cell lines
    Characterization of <t>SIRT6</t> expression in <t>G361</t> knockdown (KD) cells and proteogenomics workflow in melanoma cells. ( <t>A</t> <t>)</t> <t>CRISPR/Cas9-mediated</t> SIRT6 KD G361 cells were created, and protein expression was determined by Protein Simple automated Western blotting. SIRT6 KD reduces the ( B ) proliferation and ( C ) colony forming potential of G361 melanoma cells. Data is representative of at least 2 biological and 3 technical replicates per group, with statistical significance determined using one-way ANOVA and data shown as mean ± SEM (* p ≤ 0.05, **** p ≤ 0.0001). ( D ) Schematic representation of the experimental workflow for integrative proteogenomic analysis in A375 and G361 melanoma cells, outlining the steps from sample preparation to data integration. For RNA-seq and proteomics, data was generated from three independent biological replicates per group. For all datasets, control cell line was matched for each knockdown strategy.
    Crispr Cas9 Mediated Sirt6 Kd G361 Cell Lines, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/g361+cells/pmc12938699-107-0-9?v=Synthego+Inc
    Average 86 stars, based on 1 article reviews
    crispr cas9 mediated sirt6 kd g361 cell lines - by Bioz Stars, 2026-08
    86/100 stars
      Buy from Supplier

    96
    ATCC malignant melanoma cell line g361
    Characterization of <t>SIRT6</t> expression in <t>G361</t> knockdown (KD) cells and proteogenomics workflow in melanoma cells. ( <t>A</t> <t>)</t> <t>CRISPR/Cas9-mediated</t> SIRT6 KD G361 cells were created, and protein expression was determined by Protein Simple automated Western blotting. SIRT6 KD reduces the ( B ) proliferation and ( C ) colony forming potential of G361 melanoma cells. Data is representative of at least 2 biological and 3 technical replicates per group, with statistical significance determined using one-way ANOVA and data shown as mean ± SEM (* p ≤ 0.05, **** p ≤ 0.0001). ( D ) Schematic representation of the experimental workflow for integrative proteogenomic analysis in A375 and G361 melanoma cells, outlining the steps from sample preparation to data integration. For RNA-seq and proteomics, data was generated from three independent biological replicates per group. For all datasets, control cell line was matched for each knockdown strategy.
    Malignant Melanoma Cell Line G361, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/g361+cells/pm41391593-60-2-7?v=ATCC
    Average 96 stars, based on 1 article reviews
    malignant melanoma cell line g361 - by Bioz Stars, 2026-08
    96/100 stars
      Buy from Supplier

    96
    ATCC human melanoma cells g361
    Characterization of <t>SIRT6</t> expression in <t>G361</t> knockdown (KD) cells and proteogenomics workflow in melanoma cells. ( <t>A</t> <t>)</t> <t>CRISPR/Cas9-mediated</t> SIRT6 KD G361 cells were created, and protein expression was determined by Protein Simple automated Western blotting. SIRT6 KD reduces the ( B ) proliferation and ( C ) colony forming potential of G361 melanoma cells. Data is representative of at least 2 biological and 3 technical replicates per group, with statistical significance determined using one-way ANOVA and data shown as mean ± SEM (* p ≤ 0.05, **** p ≤ 0.0001). ( D ) Schematic representation of the experimental workflow for integrative proteogenomic analysis in A375 and G361 melanoma cells, outlining the steps from sample preparation to data integration. For RNA-seq and proteomics, data was generated from three independent biological replicates per group. For all datasets, control cell line was matched for each knockdown strategy.
    Human Melanoma Cells G361, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/g361+cells/pm41373883-260-0-8?v=ATCC
    Average 96 stars, based on 1 article reviews
    human melanoma cells g361 - by Bioz Stars, 2026-08
    96/100 stars
      Buy from Supplier

    96
    ATCC g361 cells
    Ozonated olive oil has ability to inhibit cell migration and proliferation in melanoma cells (A) Seeded A375 cells were scratched (top panels) and incubated with or without 0.001 % or 0.01 % OZO or OLO for 18 h (bottom panels). Blue lines are shown as borders of seeded cells. The images are representative of 3 independent experiments (n = 3). Scale bars, 200 μm. (B) Proportion of invasion areas in OZO-treated and OLO-treated A375 cells are shown. Data were shown mean + SEM of 3 independent experiments. (C–G) Cell viability of A375 (C), <t>G361</t> (D), Malme-3M (E), B16F10 (F) and HaCaT (G) cells in the presence of 0.01 % OZO (filled circles) or OLO (open circles). Data were shown mean + SEM of 3 independent experiments (n = 3). Statistical analysis performed by Tukey's multiple comparison test. ∗; p < 0.05, ∗∗∗; p < 0.001 (vs OLO). (−): no addition, D: DMSO-treated.
    G361 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/g361+cells/pmc12477922-67-6-27?v=ATCC
    Average 96 stars, based on 1 article reviews
    g361 cells - by Bioz Stars, 2026-08
    96/100 stars
      Buy from Supplier

    96
    ATCC malignant melanoma cell lines g361
    Effects of resveratrol on cell viability and morphology in malignant melanoma cells. ( A ) Chemical structure of resveratrol (RSV). ( B ) Cell viabilities of non-tumorigenic human epidermal melanocytes (HEMn-MP) and malignant melanoma cell lines <t>(G361</t> and SK-MEL-24) after 48 h of RSV treatment, assessed by MTT assay. Results are presented as means ± Standard error (SE) of three independent experiments (* p < 0.05). ( C ) Representative phase-contrast images showing morphological alterations in HEMn-MP, G361, and SK-MEL-24 cells following RSV exposure for 48 h (scale bar = 50 μm; original magnification ×400). RSV: resveratrol.
    Malignant Melanoma Cell Lines G361, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/g361+cells/pmc12732220-51-16-27?v=ATCC
    Average 96 stars, based on 1 article reviews
    malignant melanoma cell lines g361 - by Bioz Stars, 2026-08
    96/100 stars
      Buy from Supplier

    94
    ATCC g361 melanoma cell line
    Effects of resveratrol on cell viability and morphology in malignant melanoma cells. ( A ) Chemical structure of resveratrol (RSV). ( B ) Cell viabilities of non-tumorigenic human epidermal melanocytes (HEMn-MP) and malignant melanoma cell lines <t>(G361</t> and SK-MEL-24) after 48 h of RSV treatment, assessed by MTT assay. Results are presented as means ± Standard error (SE) of three independent experiments (* p < 0.05). ( C ) Representative phase-contrast images showing morphological alterations in HEMn-MP, G361, and SK-MEL-24 cells following RSV exposure for 48 h (scale bar = 50 μm; original magnification ×400). RSV: resveratrol.
    G361 Melanoma Cell Line, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/g361+cells/pm40999671-69-14-18?v=ATCC
    Average 94 stars, based on 1 article reviews
    g361 melanoma cell line - by Bioz Stars, 2026-08
    94/100 stars
      Buy from Supplier

    Image Search Results


    Characterization of SIRT6 expression in G361 knockdown (KD) cells and proteogenomics workflow in melanoma cells. ( A ) CRISPR/Cas9-mediated SIRT6 KD G361 cells were created, and protein expression was determined by Protein Simple automated Western blotting. SIRT6 KD reduces the ( B ) proliferation and ( C ) colony forming potential of G361 melanoma cells. Data is representative of at least 2 biological and 3 technical replicates per group, with statistical significance determined using one-way ANOVA and data shown as mean ± SEM (* p ≤ 0.05, **** p ≤ 0.0001). ( D ) Schematic representation of the experimental workflow for integrative proteogenomic analysis in A375 and G361 melanoma cells, outlining the steps from sample preparation to data integration. For RNA-seq and proteomics, data was generated from three independent biological replicates per group. For all datasets, control cell line was matched for each knockdown strategy.

    Journal: Cancers

    Article Title: Mechanisms of the Antiproliferative Effects of SIRT6 Inhibition in Melanoma: A Multi-Omics Analysis

    doi: 10.3390/cancers18040590

    Figure Lengend Snippet: Characterization of SIRT6 expression in G361 knockdown (KD) cells and proteogenomics workflow in melanoma cells. ( A ) CRISPR/Cas9-mediated SIRT6 KD G361 cells were created, and protein expression was determined by Protein Simple automated Western blotting. SIRT6 KD reduces the ( B ) proliferation and ( C ) colony forming potential of G361 melanoma cells. Data is representative of at least 2 biological and 3 technical replicates per group, with statistical significance determined using one-way ANOVA and data shown as mean ± SEM (* p ≤ 0.05, **** p ≤ 0.0001). ( D ) Schematic representation of the experimental workflow for integrative proteogenomic analysis in A375 and G361 melanoma cells, outlining the steps from sample preparation to data integration. For RNA-seq and proteomics, data was generated from three independent biological replicates per group. For all datasets, control cell line was matched for each knockdown strategy.

    Article Snippet: CRISPR/Cas9-mediated SIRT6 KD G361 cell lines were purchased from Synthego (guide sequence CUUCCGCUCCAGCUCCUCCG) and clones were isolated using the same method.

    Techniques: Expressing, Knockdown, CRISPR, Western Blot, Sample Prep, RNA Sequencing, Generated, Control

    Transcriptomic profiling and functional enrichment analysis of SIRT6 knockdown (KD) G361 cells. ( A ) RNA-seq analysis of SIRT6 KD G361 cells identified multiple differentially expressed genes (DEGs) with the top 20 up/down regulated denoted in the volcano plot. Dashed line indicates significant genes with Log2 FC ≥ |1.5|. Gene Ontology (GO) enrichment analysis by PANTHER of top 200 significant DEGs revealed alterations across various biological processes ( B ) and molecular functions ( C ).

    Journal: Cancers

    Article Title: Mechanisms of the Antiproliferative Effects of SIRT6 Inhibition in Melanoma: A Multi-Omics Analysis

    doi: 10.3390/cancers18040590

    Figure Lengend Snippet: Transcriptomic profiling and functional enrichment analysis of SIRT6 knockdown (KD) G361 cells. ( A ) RNA-seq analysis of SIRT6 KD G361 cells identified multiple differentially expressed genes (DEGs) with the top 20 up/down regulated denoted in the volcano plot. Dashed line indicates significant genes with Log2 FC ≥ |1.5|. Gene Ontology (GO) enrichment analysis by PANTHER of top 200 significant DEGs revealed alterations across various biological processes ( B ) and molecular functions ( C ).

    Article Snippet: CRISPR/Cas9-mediated SIRT6 KD G361 cell lines were purchased from Synthego (guide sequence CUUCCGCUCCAGCUCCUCCG) and clones were isolated using the same method.

    Techniques: Functional Assay, Knockdown, RNA Sequencing

    Transcriptomic profiling and functional enrichment analysis of SIRT6 knockdown (KD) A375 cells. ( A ) The top 20 up/down regulated differentially expressed genes (DEGs) identified by RNA-seq in SIRT6 KD A375 cells denoted via volcano plot. Dashed line indicates significant genes with Log2 FC ≥ |1.5|. Subsequent Gene Ontology (GO) enrichment by PANTHER of top 200 significant DEGs found significant changes in several biological processes ( B ) and molecular functions ( C ) in SIRT6 KD A375 cells.

    Journal: Cancers

    Article Title: Mechanisms of the Antiproliferative Effects of SIRT6 Inhibition in Melanoma: A Multi-Omics Analysis

    doi: 10.3390/cancers18040590

    Figure Lengend Snippet: Transcriptomic profiling and functional enrichment analysis of SIRT6 knockdown (KD) A375 cells. ( A ) The top 20 up/down regulated differentially expressed genes (DEGs) identified by RNA-seq in SIRT6 KD A375 cells denoted via volcano plot. Dashed line indicates significant genes with Log2 FC ≥ |1.5|. Subsequent Gene Ontology (GO) enrichment by PANTHER of top 200 significant DEGs found significant changes in several biological processes ( B ) and molecular functions ( C ) in SIRT6 KD A375 cells.

    Article Snippet: CRISPR/Cas9-mediated SIRT6 KD G361 cell lines were purchased from Synthego (guide sequence CUUCCGCUCCAGCUCCUCCG) and clones were isolated using the same method.

    Techniques: Functional Assay, Knockdown, RNA Sequencing

    Functional insights from Ingenuity Pathway Analysis (IPA). ( A ) Graphical summary generated by Ingenuity Pathway Analysis highlighting predicted target regulation activity based on differentially expressed genes (DEGs) in SIRT6 knockdown (KD) G361 cells. ( B ) Top canonical pathways affected in SIRT6 KD G361 cells as predicted by IPA based on the transcriptomic data. IPA analysis of differentially expressed genes shows regulation of cancer-related biological functions in SIRT6 KD G361 ( C ) and A375 cells ( D ).

    Journal: Cancers

    Article Title: Mechanisms of the Antiproliferative Effects of SIRT6 Inhibition in Melanoma: A Multi-Omics Analysis

    doi: 10.3390/cancers18040590

    Figure Lengend Snippet: Functional insights from Ingenuity Pathway Analysis (IPA). ( A ) Graphical summary generated by Ingenuity Pathway Analysis highlighting predicted target regulation activity based on differentially expressed genes (DEGs) in SIRT6 knockdown (KD) G361 cells. ( B ) Top canonical pathways affected in SIRT6 KD G361 cells as predicted by IPA based on the transcriptomic data. IPA analysis of differentially expressed genes shows regulation of cancer-related biological functions in SIRT6 KD G361 ( C ) and A375 cells ( D ).

    Article Snippet: CRISPR/Cas9-mediated SIRT6 KD G361 cell lines were purchased from Synthego (guide sequence CUUCCGCUCCAGCUCCUCCG) and clones were isolated using the same method.

    Techniques: Functional Assay, Generated, Activity Assay, Knockdown

    Interactions of SIRT6 with numerous key cell death, invasion, and proliferation genes. Ingenuity Pathway Analysis (IPA) evaluation of differentially expressed genes (DEGs) in SIRT6 KD human melanoma cell lines predicted SIRT6-interacting genes associated with proliferation ( A ) and cell death ( B ) in SIRT6 KD G361 cells. Line type identifies interaction, with solid lines indicating direct interactions and dashed lines indicating indirect interactions. Arrows at the end of the lines indicate that SIRT6 may affect expression of the indicated gene, while a bar at the end of the line indicates inhibition.

    Journal: Cancers

    Article Title: Mechanisms of the Antiproliferative Effects of SIRT6 Inhibition in Melanoma: A Multi-Omics Analysis

    doi: 10.3390/cancers18040590

    Figure Lengend Snippet: Interactions of SIRT6 with numerous key cell death, invasion, and proliferation genes. Ingenuity Pathway Analysis (IPA) evaluation of differentially expressed genes (DEGs) in SIRT6 KD human melanoma cell lines predicted SIRT6-interacting genes associated with proliferation ( A ) and cell death ( B ) in SIRT6 KD G361 cells. Line type identifies interaction, with solid lines indicating direct interactions and dashed lines indicating indirect interactions. Arrows at the end of the lines indicate that SIRT6 may affect expression of the indicated gene, while a bar at the end of the line indicates inhibition.

    Article Snippet: CRISPR/Cas9-mediated SIRT6 KD G361 cell lines were purchased from Synthego (guide sequence CUUCCGCUCCAGCUCCUCCG) and clones were isolated using the same method.

    Techniques: Expressing, Inhibition

    Proteomics analysis of SIRT6 knockdown (KD) A375 melanoma cells. Proteomic analysis of SIRT6 KD A375 cells showing peptide identifications ( A ) and abundance data ( B ) in respective proteins. Gene Ontology (GO) enrichment based on PANTHER analysis reveals regulation of multiple biological ( C ) and molecular ( D ) functions in SIRT6 KD A375 cells.

    Journal: Cancers

    Article Title: Mechanisms of the Antiproliferative Effects of SIRT6 Inhibition in Melanoma: A Multi-Omics Analysis

    doi: 10.3390/cancers18040590

    Figure Lengend Snippet: Proteomics analysis of SIRT6 knockdown (KD) A375 melanoma cells. Proteomic analysis of SIRT6 KD A375 cells showing peptide identifications ( A ) and abundance data ( B ) in respective proteins. Gene Ontology (GO) enrichment based on PANTHER analysis reveals regulation of multiple biological ( C ) and molecular ( D ) functions in SIRT6 KD A375 cells.

    Article Snippet: CRISPR/Cas9-mediated SIRT6 KD G361 cell lines were purchased from Synthego (guide sequence CUUCCGCUCCAGCUCCUCCG) and clones were isolated using the same method.

    Techniques: Knockdown

    Comparative analysis of multi-omics data. Comparison of SIRT6 knockdown (KD) G361 and A375 cell-based transcriptomics and proteomics data by Ingenuity Pathway Analysis (IPA) predicted regulation of multiple canonical pathways ( A ) and biological functions ( B ) that were predicted to be modulated and are related to cell proliferation, division, migration, invasion, and death at RNA and protein levels. By analyzing protein modulation ≥|1.2|-fold (red = increased levels; green = decreased levels), IPA predicted inhibition of cell proliferation ( C ) and activation of cell death of tumor cell lines ( D ) in our SIRT6 KD A375 cells as compared to the shNS control cells ( n = 3 per group).

    Journal: Cancers

    Article Title: Mechanisms of the Antiproliferative Effects of SIRT6 Inhibition in Melanoma: A Multi-Omics Analysis

    doi: 10.3390/cancers18040590

    Figure Lengend Snippet: Comparative analysis of multi-omics data. Comparison of SIRT6 knockdown (KD) G361 and A375 cell-based transcriptomics and proteomics data by Ingenuity Pathway Analysis (IPA) predicted regulation of multiple canonical pathways ( A ) and biological functions ( B ) that were predicted to be modulated and are related to cell proliferation, division, migration, invasion, and death at RNA and protein levels. By analyzing protein modulation ≥|1.2|-fold (red = increased levels; green = decreased levels), IPA predicted inhibition of cell proliferation ( C ) and activation of cell death of tumor cell lines ( D ) in our SIRT6 KD A375 cells as compared to the shNS control cells ( n = 3 per group).

    Article Snippet: CRISPR/Cas9-mediated SIRT6 KD G361 cell lines were purchased from Synthego (guide sequence CUUCCGCUCCAGCUCCUCCG) and clones were isolated using the same method.

    Techniques: Biomarker Discovery, Comparison, Knockdown, Transcriptomics, Migration, Inhibition, Activation Assay, Control

    Causal networks from multi-omics data. Comparative analysis of multi-omics data from SIRT6 knockdown (KD) G361 and A375 cells by Ingenuity Pathway Analysis (IPA) showed predicted regulation of multiple networks. ( A ) Common causal networks inferred from multi-omics data, integrating upstream regulators and downstream effects. ( B ) SIRT6 KD in A375 cells affects multiple proteins with ≥|1.2|-fold change ( n = 3 per group; shNS and shSIRT6) related to transcription factor family networks, highlighting top common pathways with activation z-scores ≥|2| in both transcriptomics and proteomics data.

    Journal: Cancers

    Article Title: Mechanisms of the Antiproliferative Effects of SIRT6 Inhibition in Melanoma: A Multi-Omics Analysis

    doi: 10.3390/cancers18040590

    Figure Lengend Snippet: Causal networks from multi-omics data. Comparative analysis of multi-omics data from SIRT6 knockdown (KD) G361 and A375 cells by Ingenuity Pathway Analysis (IPA) showed predicted regulation of multiple networks. ( A ) Common causal networks inferred from multi-omics data, integrating upstream regulators and downstream effects. ( B ) SIRT6 KD in A375 cells affects multiple proteins with ≥|1.2|-fold change ( n = 3 per group; shNS and shSIRT6) related to transcription factor family networks, highlighting top common pathways with activation z-scores ≥|2| in both transcriptomics and proteomics data.

    Article Snippet: CRISPR/Cas9-mediated SIRT6 KD G361 cell lines were purchased from Synthego (guide sequence CUUCCGCUCCAGCUCCUCCG) and clones were isolated using the same method.

    Techniques: Biomarker Discovery, Knockdown, Activation Assay, Transcriptomics

    Ozonated olive oil has ability to inhibit cell migration and proliferation in melanoma cells (A) Seeded A375 cells were scratched (top panels) and incubated with or without 0.001 % or 0.01 % OZO or OLO for 18 h (bottom panels). Blue lines are shown as borders of seeded cells. The images are representative of 3 independent experiments (n = 3). Scale bars, 200 μm. (B) Proportion of invasion areas in OZO-treated and OLO-treated A375 cells are shown. Data were shown mean + SEM of 3 independent experiments. (C–G) Cell viability of A375 (C), G361 (D), Malme-3M (E), B16F10 (F) and HaCaT (G) cells in the presence of 0.01 % OZO (filled circles) or OLO (open circles). Data were shown mean + SEM of 3 independent experiments (n = 3). Statistical analysis performed by Tukey's multiple comparison test. ∗; p < 0.05, ∗∗∗; p < 0.001 (vs OLO). (−): no addition, D: DMSO-treated.

    Journal: Biochemistry and Biophysics Reports

    Article Title: Ozonated olive oil inhibits melanoma proliferation by inducing ferroptosis

    doi: 10.1016/j.bbrep.2025.102267

    Figure Lengend Snippet: Ozonated olive oil has ability to inhibit cell migration and proliferation in melanoma cells (A) Seeded A375 cells were scratched (top panels) and incubated with or without 0.001 % or 0.01 % OZO or OLO for 18 h (bottom panels). Blue lines are shown as borders of seeded cells. The images are representative of 3 independent experiments (n = 3). Scale bars, 200 μm. (B) Proportion of invasion areas in OZO-treated and OLO-treated A375 cells are shown. Data were shown mean + SEM of 3 independent experiments. (C–G) Cell viability of A375 (C), G361 (D), Malme-3M (E), B16F10 (F) and HaCaT (G) cells in the presence of 0.01 % OZO (filled circles) or OLO (open circles). Data were shown mean + SEM of 3 independent experiments (n = 3). Statistical analysis performed by Tukey's multiple comparison test. ∗; p < 0.05, ∗∗∗; p < 0.001 (vs OLO). (−): no addition, D: DMSO-treated.

    Article Snippet: Human melanoma cell line, A375 cells, G361 cells and Malme-3M cells, human keratinocyte cell line, HaCaT cells and murine melanoma cell line, B16F10 cells were obtained from ATCC and cultured in Dulbecco's Modified Eagle Medium (DMEM; Sigma-Aldrich Co., St. Louis, MO) contained 10 % fetal bovine serum (FBS; Cosmo Bio Co., Tokyo, Japan) at 37 °C in humidified 5 % CO 2 /95 % air atmosphere.

    Techniques: Migration, Incubation, Comparison

    Ozonated olive oil induces ferroptosis in melanoma cells (A) Level of intracellular GSH and GSSG ratio in A375, G361, Malme-3M and HaCaT cells treated with or without 0.01 % OLO or 0.01 % OZO for 6h. Data was shown mean + SEM of 3 independent experiments (n = 3). (B–D) Levels of lipid peroxidation in A375 (B), G361 (C) and Malme-3M (D) cells treated with or without 0.01 % OZO- or 0.01 % OLO analyzed by flowcytometric analysis. (Upper panel) The images are representative of individual independent experiments. (Lower panel) The graphs are shown that measured Geometric MFI from 8 (A375), and 4 (other) independent experiments. Statistical significance by Tukey's multiple comparison test. ∗; p < 0.05, ∗∗∗; p < 0.001. (−): no addition, D: DMSO-treated. (E–F) Expression of GPX4 mRNA and protein in A375 at 0–6h after treatment with 0.01 % OLO or 0.01 % OZO. (E) The graph is shown that fold change of GPX4 mRNA levels. Data was shown mean + SEM of 5 independent experiments (n = 5). (F). Data are representative of 5 independent experiments. (F, right panel) The graph is shown that measured GPX4 and GAPDH protein ratio by Image J from 5 independent experiments (n = 5). Statistical significance by Tukey's multiple comparison test. ns; not significant, ∗∗; p < 0.01 (vs OLO).

    Journal: Biochemistry and Biophysics Reports

    Article Title: Ozonated olive oil inhibits melanoma proliferation by inducing ferroptosis

    doi: 10.1016/j.bbrep.2025.102267

    Figure Lengend Snippet: Ozonated olive oil induces ferroptosis in melanoma cells (A) Level of intracellular GSH and GSSG ratio in A375, G361, Malme-3M and HaCaT cells treated with or without 0.01 % OLO or 0.01 % OZO for 6h. Data was shown mean + SEM of 3 independent experiments (n = 3). (B–D) Levels of lipid peroxidation in A375 (B), G361 (C) and Malme-3M (D) cells treated with or without 0.01 % OZO- or 0.01 % OLO analyzed by flowcytometric analysis. (Upper panel) The images are representative of individual independent experiments. (Lower panel) The graphs are shown that measured Geometric MFI from 8 (A375), and 4 (other) independent experiments. Statistical significance by Tukey's multiple comparison test. ∗; p < 0.05, ∗∗∗; p < 0.001. (−): no addition, D: DMSO-treated. (E–F) Expression of GPX4 mRNA and protein in A375 at 0–6h after treatment with 0.01 % OLO or 0.01 % OZO. (E) The graph is shown that fold change of GPX4 mRNA levels. Data was shown mean + SEM of 5 independent experiments (n = 5). (F). Data are representative of 5 independent experiments. (F, right panel) The graph is shown that measured GPX4 and GAPDH protein ratio by Image J from 5 independent experiments (n = 5). Statistical significance by Tukey's multiple comparison test. ns; not significant, ∗∗; p < 0.01 (vs OLO).

    Article Snippet: Human melanoma cell line, A375 cells, G361 cells and Malme-3M cells, human keratinocyte cell line, HaCaT cells and murine melanoma cell line, B16F10 cells were obtained from ATCC and cultured in Dulbecco's Modified Eagle Medium (DMEM; Sigma-Aldrich Co., St. Louis, MO) contained 10 % fetal bovine serum (FBS; Cosmo Bio Co., Tokyo, Japan) at 37 °C in humidified 5 % CO 2 /95 % air atmosphere.

    Techniques: Comparison, Expressing

    Ferroptosis inhibitors but not apoptosis and necroptosis inhibitor suppressed ozonated olive oil-induced melanoma cell death (A-B) Cell viability of 0.01 % OZO- or 0.01 % OLO-treated A375 cells in the presence or absence of 10 μM α-tocopherol (α-Toco) (A), 1 μM ferrostatin-1 (Fer-1) (B) Data was shown mean + SEM 4 of individual independent experiments (n = 4). ∗∗∗; p < 0.001 by Tukey's multiple comparison test. (C–E) Cell viability of 0.01 % OZO- or 0.01 % OLO-treated G361 (C), Malme-3M (D) and B16F10 (E) cells in the presence or absence of ferrostatin-1 (Fer-1). (F, G) Proliferation of 0.01 % OZO- or OLO-treated A375 (F) and Malme-3M (G) cells in the absence or presence of 100 μM deferiprone (DFP). Data was shown mean + SEM of 4 individual independent experiments (n = 4). (H) Proliferation of 0.003 % OZO- or OLO-treated A375 cell in the absence or presence of 100 μM FeSO 4 . Data was shown mean + SEM of 3 individual independent experiments (n = 3). (I) Proliferation of 0.01 % OZO- or OLO-treated A375 cells in the absence or presence of 10 μM Z-VAD (left panel) or 1 μM necrostatin-1 (Nec-1, right panel). Data was shown mean + SEM of 4 individual independent experiments (n = 4). Statistical significance by Tukey's multiple comparison test. ns; not significant, ∗; p < 0.05, ∗∗; p < 0.01, ∗∗∗; p < 0.001. (−): no addition, D: DMSO-treated.

    Journal: Biochemistry and Biophysics Reports

    Article Title: Ozonated olive oil inhibits melanoma proliferation by inducing ferroptosis

    doi: 10.1016/j.bbrep.2025.102267

    Figure Lengend Snippet: Ferroptosis inhibitors but not apoptosis and necroptosis inhibitor suppressed ozonated olive oil-induced melanoma cell death (A-B) Cell viability of 0.01 % OZO- or 0.01 % OLO-treated A375 cells in the presence or absence of 10 μM α-tocopherol (α-Toco) (A), 1 μM ferrostatin-1 (Fer-1) (B) Data was shown mean + SEM 4 of individual independent experiments (n = 4). ∗∗∗; p < 0.001 by Tukey's multiple comparison test. (C–E) Cell viability of 0.01 % OZO- or 0.01 % OLO-treated G361 (C), Malme-3M (D) and B16F10 (E) cells in the presence or absence of ferrostatin-1 (Fer-1). (F, G) Proliferation of 0.01 % OZO- or OLO-treated A375 (F) and Malme-3M (G) cells in the absence or presence of 100 μM deferiprone (DFP). Data was shown mean + SEM of 4 individual independent experiments (n = 4). (H) Proliferation of 0.003 % OZO- or OLO-treated A375 cell in the absence or presence of 100 μM FeSO 4 . Data was shown mean + SEM of 3 individual independent experiments (n = 3). (I) Proliferation of 0.01 % OZO- or OLO-treated A375 cells in the absence or presence of 10 μM Z-VAD (left panel) or 1 μM necrostatin-1 (Nec-1, right panel). Data was shown mean + SEM of 4 individual independent experiments (n = 4). Statistical significance by Tukey's multiple comparison test. ns; not significant, ∗; p < 0.05, ∗∗; p < 0.01, ∗∗∗; p < 0.001. (−): no addition, D: DMSO-treated.

    Article Snippet: Human melanoma cell line, A375 cells, G361 cells and Malme-3M cells, human keratinocyte cell line, HaCaT cells and murine melanoma cell line, B16F10 cells were obtained from ATCC and cultured in Dulbecco's Modified Eagle Medium (DMEM; Sigma-Aldrich Co., St. Louis, MO) contained 10 % fetal bovine serum (FBS; Cosmo Bio Co., Tokyo, Japan) at 37 °C in humidified 5 % CO 2 /95 % air atmosphere.

    Techniques: Comparison

    Effects of resveratrol on cell viability and morphology in malignant melanoma cells. ( A ) Chemical structure of resveratrol (RSV). ( B ) Cell viabilities of non-tumorigenic human epidermal melanocytes (HEMn-MP) and malignant melanoma cell lines (G361 and SK-MEL-24) after 48 h of RSV treatment, assessed by MTT assay. Results are presented as means ± Standard error (SE) of three independent experiments (* p < 0.05). ( C ) Representative phase-contrast images showing morphological alterations in HEMn-MP, G361, and SK-MEL-24 cells following RSV exposure for 48 h (scale bar = 50 μm; original magnification ×400). RSV: resveratrol.

    Journal: Current Issues in Molecular Biology

    Article Title: Resveratrol Targets Glycolytic Enzymes HK II and PKM2 to Promote Concurrent Apoptotic and Necrotic Cell Death in Malignant Melanoma

    doi: 10.3390/cimb47121006

    Figure Lengend Snippet: Effects of resveratrol on cell viability and morphology in malignant melanoma cells. ( A ) Chemical structure of resveratrol (RSV). ( B ) Cell viabilities of non-tumorigenic human epidermal melanocytes (HEMn-MP) and malignant melanoma cell lines (G361 and SK-MEL-24) after 48 h of RSV treatment, assessed by MTT assay. Results are presented as means ± Standard error (SE) of three independent experiments (* p < 0.05). ( C ) Representative phase-contrast images showing morphological alterations in HEMn-MP, G361, and SK-MEL-24 cells following RSV exposure for 48 h (scale bar = 50 μm; original magnification ×400). RSV: resveratrol.

    Article Snippet: Normal human epidermal melanocytes (HEMn-MP) were obtained from Cascade Biologics (Portland, OR, USA), and the human malignant melanoma cell lines G361 and SK-MEL-24 were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA).

    Techniques: MTT Assay

    Resveratrol induces apoptotic and necroptotic cell death in malignant melanoma cells. G361 and SK-MEL-24 cells were treated with RSV (20, 40, 60 μM) for 48 h. ( A ) Representative fluorescence images of DAPI-stained nuclei (scale bar = 25 μm; original magnification ×200). Condensed or fragmented nuclei, indicative of apoptosis, are indicated by white arrows. ( B ) Quantification of apoptotic cell populations by Annexin-V/7-AAD staining using a Muse™ Cell Analyzer. Annexin-V-positive/7-AAD-negative cells were classified as early apoptotic, whereas Annexin-V-positive/7-AAD-positive cells were classified as late apoptotic. Data are presented as mean ± SE ( n = 3). Statistical significance: * p < 0.05, ** p < 0.01, **** p < 0.0001. RSV: resveratrol.

    Journal: Current Issues in Molecular Biology

    Article Title: Resveratrol Targets Glycolytic Enzymes HK II and PKM2 to Promote Concurrent Apoptotic and Necrotic Cell Death in Malignant Melanoma

    doi: 10.3390/cimb47121006

    Figure Lengend Snippet: Resveratrol induces apoptotic and necroptotic cell death in malignant melanoma cells. G361 and SK-MEL-24 cells were treated with RSV (20, 40, 60 μM) for 48 h. ( A ) Representative fluorescence images of DAPI-stained nuclei (scale bar = 25 μm; original magnification ×200). Condensed or fragmented nuclei, indicative of apoptosis, are indicated by white arrows. ( B ) Quantification of apoptotic cell populations by Annexin-V/7-AAD staining using a Muse™ Cell Analyzer. Annexin-V-positive/7-AAD-negative cells were classified as early apoptotic, whereas Annexin-V-positive/7-AAD-positive cells were classified as late apoptotic. Data are presented as mean ± SE ( n = 3). Statistical significance: * p < 0.05, ** p < 0.01, **** p < 0.0001. RSV: resveratrol.

    Article Snippet: Normal human epidermal melanocytes (HEMn-MP) were obtained from Cascade Biologics (Portland, OR, USA), and the human malignant melanoma cell lines G361 and SK-MEL-24 were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA).

    Techniques: Fluorescence, Staining

    Resveratrol induced G0/G1 cell cycle arrest in malignant melanoma cells. G361 and SK-MEL-24 cells were treated with RSV (0, 20, 40, 60 µM) for 48 h. ( A ) Representative histograms of cell cycle distribution following staining with Muse™ Cell Cycle Reagent and analysis on a Muse™ Cell Analyzer. ( B ) Quantitative analysis of the percentage of cells in G0/G1, S, and G2/M phases. Data represent mean ± SE ( n = 3). ( C ) Western blot analysis of cell cycle regulatory proteins (cyclin D1, cyclin E1, and CDK4) after 48 h of RSV treatment. β-Actin served as a loading control. Relative band intensities were quantified against the control. Statistical significance: * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 (post hoc test). RSV: resveratrol.

    Journal: Current Issues in Molecular Biology

    Article Title: Resveratrol Targets Glycolytic Enzymes HK II and PKM2 to Promote Concurrent Apoptotic and Necrotic Cell Death in Malignant Melanoma

    doi: 10.3390/cimb47121006

    Figure Lengend Snippet: Resveratrol induced G0/G1 cell cycle arrest in malignant melanoma cells. G361 and SK-MEL-24 cells were treated with RSV (0, 20, 40, 60 µM) for 48 h. ( A ) Representative histograms of cell cycle distribution following staining with Muse™ Cell Cycle Reagent and analysis on a Muse™ Cell Analyzer. ( B ) Quantitative analysis of the percentage of cells in G0/G1, S, and G2/M phases. Data represent mean ± SE ( n = 3). ( C ) Western blot analysis of cell cycle regulatory proteins (cyclin D1, cyclin E1, and CDK4) after 48 h of RSV treatment. β-Actin served as a loading control. Relative band intensities were quantified against the control. Statistical significance: * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 (post hoc test). RSV: resveratrol.

    Article Snippet: Normal human epidermal melanocytes (HEMn-MP) were obtained from Cascade Biologics (Portland, OR, USA), and the human malignant melanoma cell lines G361 and SK-MEL-24 were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA).

    Techniques: Staining, Western Blot, Control

    Resveratrol modulates glycolytic enzymes and induces apoptosis and necroptosis in malignant melanoma cells. G361 and SK-MEL-24 cells were treated with RSV (0, 20, 40, 60 µM) for 48 h. ( A ) Western blot analysis of HK II, PKM2, and apoptosis-related proteins (cleaved caspase-3, caspase-3, Bax, and Bcl-2). β-Actin served as loading control. ( B ) Western blot analysis of necroptosis-associated proteins, including phosphorylated MLKL (p-MLKL) and phosphorylated RIP (p-RIP). Total MLKL and total RIP were used as loading controls. ( C ) Intracellular ATP levels. ( D ) Hexokinase enzymatic activity. ( E ) Caspase-3/7 activity. Data are expressed as mean ± SE ( n = 3). Statistical significance was determined by one-way ANOVA followed by Tukey’s post hoc test (* p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001). HK II: Hexokinase II; PKM2: pyruvate kinase M2; RSV: resveratrol.

    Journal: Current Issues in Molecular Biology

    Article Title: Resveratrol Targets Glycolytic Enzymes HK II and PKM2 to Promote Concurrent Apoptotic and Necrotic Cell Death in Malignant Melanoma

    doi: 10.3390/cimb47121006

    Figure Lengend Snippet: Resveratrol modulates glycolytic enzymes and induces apoptosis and necroptosis in malignant melanoma cells. G361 and SK-MEL-24 cells were treated with RSV (0, 20, 40, 60 µM) for 48 h. ( A ) Western blot analysis of HK II, PKM2, and apoptosis-related proteins (cleaved caspase-3, caspase-3, Bax, and Bcl-2). β-Actin served as loading control. ( B ) Western blot analysis of necroptosis-associated proteins, including phosphorylated MLKL (p-MLKL) and phosphorylated RIP (p-RIP). Total MLKL and total RIP were used as loading controls. ( C ) Intracellular ATP levels. ( D ) Hexokinase enzymatic activity. ( E ) Caspase-3/7 activity. Data are expressed as mean ± SE ( n = 3). Statistical significance was determined by one-way ANOVA followed by Tukey’s post hoc test (* p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001). HK II: Hexokinase II; PKM2: pyruvate kinase M2; RSV: resveratrol.

    Article Snippet: Normal human epidermal melanocytes (HEMn-MP) were obtained from Cascade Biologics (Portland, OR, USA), and the human malignant melanoma cell lines G361 and SK-MEL-24 were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA).

    Techniques: Western Blot, Control, Activity Assay

    Resveratrol suppresses the migratory ability of malignant melanoma cells. A wound healing assay was performed in G361 ( A ) and SK-MEL-24 ( B ) cells treated with RSV (0, 20, 40, 60 μM) for 48 h. Assays were conducted under both 5% FBS-supplemented and serum-free conditions to minimize confounding effects of proliferation. Wound areas were imaged at 0 h and 48 h to assess cell migration (scale bar = 50 μm; original magnification ×400). Data are presented as mean ± SE ( n = 3). Statistical significance: * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 (post hoc test). RSV: resveratrol.

    Journal: Current Issues in Molecular Biology

    Article Title: Resveratrol Targets Glycolytic Enzymes HK II and PKM2 to Promote Concurrent Apoptotic and Necrotic Cell Death in Malignant Melanoma

    doi: 10.3390/cimb47121006

    Figure Lengend Snippet: Resveratrol suppresses the migratory ability of malignant melanoma cells. A wound healing assay was performed in G361 ( A ) and SK-MEL-24 ( B ) cells treated with RSV (0, 20, 40, 60 μM) for 48 h. Assays were conducted under both 5% FBS-supplemented and serum-free conditions to minimize confounding effects of proliferation. Wound areas were imaged at 0 h and 48 h to assess cell migration (scale bar = 50 μm; original magnification ×400). Data are presented as mean ± SE ( n = 3). Statistical significance: * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 (post hoc test). RSV: resveratrol.

    Article Snippet: Normal human epidermal melanocytes (HEMn-MP) were obtained from Cascade Biologics (Portland, OR, USA), and the human malignant melanoma cell lines G361 and SK-MEL-24 were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA).

    Techniques: Wound Healing Assay, Migration