flomax flow cytometry analysis software (Partec)
90
Structured Review
Partec
flomax flow cytometry analysis software
Flomax Flow Cytometry Analysis Software, supplied by Partec, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/flow+cytometry+flomax+software/flomax+flow+cytometry+analysis+software/pmc10073919-79-23-28
Average 90 stars, based on 1 article reviews
Flomax Flow Cytometry Analysis Software, supplied by Partec, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/flow+cytometry+flomax+software/flomax+flow+cytometry+analysis+software/pmc10073919-79-23-28
Average 90 stars, based on 1 article reviews
flomax flow cytometry analysis software - by Bioz Stars,
2026-09
90/100 stars
Images
1) Product Images from "Cell Surface Vimentin Detection in Cancer Cells by Peptide-Based Monoclonal Antibody"
Article Title: Cell Surface Vimentin Detection in Cancer Cells by Peptide-Based Monoclonal Antibody
Journal: Avicenna Journal of Medical Biotechnology
doi:
Figure Legend Snippet: Multiple sequence alignment results for the selected vimentin peptide in different species as well as the summary of immunoassay results for the produced anti-vimentin antibody (7C11-D9)
Techniques Used: Sequencing, Produced, Immunocytochemistry, Flow Cytometry
Figure Legend Snippet: Flow cytometry results of Cell-Surface Vimentin (CSV) detection in different cells. The produced anti-vimentin 7C11-D9 and sheep anti-mouse FITC conjugated were primary and secondary antibodies, respectively. An anti-HIV antibody was used as isotype control.
Techniques Used: Flow Cytometry, Produced, Control
Related Articles
other:Article Title: The Mechanism of miR-222 Targets Matrix Metalloproteinase 1 in Regulating Fibroblast Proliferation in Hypertrophic Scars. Article Snippet: This study aimed to investigate the value of miR-222 in hypertrophic scars (HS).. Specific mechanisms were used to measure the level of miR-222, while MTT assay, flow cytometry, western blot and qRT-PCR were employed to detect the relative proteins after fibroblasts were transfected with the miR-222 mimic/inhibitor.. The direct target of miR-222 was determined by Dual-Luciferase Reporter assay. Flow Cytometry:Article Title: Glimepiride promotes osteogenic differentiation in rat osteoblasts via the PI3K/Akt/eNOS pathway in a high glucose microenvironment. Article Snippet: .. Gene Forward primer (59-39) Reverse Primer(59-39) CCND1 AAAGGCCAGTATGCACAGCTTTC TTCAACCACTGGGCCACTATTTC RUNX2 GATAACCTGGATGCCGTCGTG CAGCCTAGCCAGTCGGATTTG OCN CAGCGTTATGAGATCAAGATGACCA AGTGATGTGCAAGAGTCCATCCTG ALP GGAGCACTGTGTTTATGCTGGAA GACCGAGCGATTGCTCAAGA b-ACTIN TGGCACCCAGCACAATGAA GTCATAGTCCGCCTAGAAGCA doi:10.1371/journal.pone.0112243.t001 PLOS ONE | www.plosone.org 2 November 2014 | Volume 9 | Issue 11 | e112243 acquired and the apoptotic cell was quantification by flow cytometry and Article Title: Toxicity of depleted uranium on isolated liver mitochondria: a revised mechanistic vision for justification of clinical complication of depleted uranium (DU) on liver Article Snippet: Faculty of Pharmacy, Shahid Beheshti University of Medical Sciences, Tehran, Iran; Department of Pharmacology and Toxicology, School of Pharmacy, Mazandaran University of Medical Sciences, Sari, Iran; Department of Pharmacology and Toxicology, School of Pharmacy, Zanjan University of Medical Sciences, Zanjan, Iran; Department of Pharmacology and Toxicology, Faculty of Pharmacy, Zabol University of Medical Sciences, Zabol, Iran; Department of Pharmacology, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran Software:Article Title: Glimepiride promotes osteogenic differentiation in rat osteoblasts via the PI3K/Akt/eNOS pathway in a high glucose microenvironment. Article Snippet: .. Gene Forward primer (59-39) Reverse Primer(59-39) CCND1 AAAGGCCAGTATGCACAGCTTTC TTCAACCACTGGGCCACTATTTC RUNX2 GATAACCTGGATGCCGTCGTG CAGCCTAGCCAGTCGGATTTG OCN CAGCGTTATGAGATCAAGATGACCA AGTGATGTGCAAGAGTCCATCCTG ALP GGAGCACTGTGTTTATGCTGGAA GACCGAGCGATTGCTCAAGA b-ACTIN TGGCACCCAGCACAATGAA GTCATAGTCCGCCTAGAAGCA doi:10.1371/journal.pone.0112243.t001 PLOS ONE | www.plosone.org 2 November 2014 | Volume 9 | Issue 11 | e112243 acquired and the apoptotic cell was quantification by flow cytometry and Article Title: Toxicity of depleted uranium on isolated liver mitochondria: a revised mechanistic vision for justification of clinical complication of depleted uranium (DU) on liver Article Snippet: Faculty of Pharmacy, Shahid Beheshti University of Medical Sciences, Tehran, Iran; Department of Pharmacology and Toxicology, School of Pharmacy, Mazandaran University of Medical Sciences, Sari, Iran; Department of Pharmacology and Toxicology, School of Pharmacy, Zanjan University of Medical Sciences, Zanjan, Iran; Department of Pharmacology and Toxicology, Faculty of Pharmacy, Zabol University of Medical Sciences, Zabol, Iran; Department of Pharmacology, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran Incubation:Article Title: Toxicity of depleted uranium on isolated liver mitochondria: a revised mechanistic vision for justification of clinical complication of depleted uranium (DU) on liver Article Snippet: Faculty of Pharmacy, Shahid Beheshti University of Medical Sciences, Tehran, Iran; Department of Pharmacology and Toxicology, School of Pharmacy, Mazandaran University of Medical Sciences, Sari, Iran; Department of Pharmacology and Toxicology, School of Pharmacy, Zanjan University of Medical Sciences, Zanjan, Iran; Department of Pharmacology and Toxicology, Faculty of Pharmacy, Zabol University of Medical Sciences, Zabol, Iran; Department of Pharmacology, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran Fluorescence:Article Title: Toxicity of depleted uranium on isolated liver mitochondria: a revised mechanistic vision for justification of clinical complication of depleted uranium (DU) on liver Article Snippet: Faculty of Pharmacy, Shahid Beheshti University of Medical Sciences, Tehran, Iran; Department of Pharmacology and Toxicology, School of Pharmacy, Mazandaran University of Medical Sciences, Sari, Iran; Department of Pharmacology and Toxicology, School of Pharmacy, Zanjan University of Medical Sciences, Zanjan, Iran; Department of Pharmacology and Toxicology, Faculty of Pharmacy, Zabol University of Medical Sciences, Zabol, Iran; Department of Pharmacology, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran |