|
Thermo Fisher
gene exp fam20a hs01034070 m1 Gene Exp Fam20a Hs01034070 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp fam20a hs01034070 m1/product/Thermo Fisher Average 94 stars, based on 1 article reviews
gene exp fam20a hs01034070 m1 - by Bioz Stars,
2026-02
94/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp fam20a hs01034071 m1 Gene Exp Fam20a Hs01034071 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp fam20a hs01034071 m1/product/Thermo Fisher Average 94 stars, based on 1 article reviews
gene exp fam20a hs01034071 m1 - by Bioz Stars,
2026-02
94/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp fam20a mm00464089 m1 Gene Exp Fam20a Mm00464089 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp fam20a mm00464089 m1/product/Thermo Fisher Average 85 stars, based on 1 article reviews
gene exp fam20a mm00464089 m1 - by Bioz Stars,
2026-02
85/100 stars
|
Buy from Supplier |
|
Fisher Scientific
fam20a reverse tgtgtctcagtttccctgtctg Fam20a Reverse Tgtgtctcagtttccctgtctg, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/fam20a reverse tgtgtctcagtttccctgtctg/product/Fisher Scientific Average 90 stars, based on 1 article reviews
fam20a reverse tgtgtctcagtttccctgtctg - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Fisher Scientific
fam20a forward aaggaccccacaggtgtttt Fam20a Forward Aaggaccccacaggtgtttt, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/fam20a forward aaggaccccacaggtgtttt/product/Fisher Scientific Average 90 stars, based on 1 article reviews
fam20a forward aaggaccccacaggtgtttt - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |