Review





Similar Products

94
Thermo Fisher gene exp fam20a hs01034070 m1
Gene Exp Fam20a Hs01034070 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp fam20a hs01034070 m1/product/Thermo Fisher
Average 94 stars, based on 1 article reviews
gene exp fam20a hs01034070 m1 - by Bioz Stars, 2026-02
94/100 stars
  Buy from Supplier

94
Thermo Fisher gene exp fam20a hs01034071 m1
Gene Exp Fam20a Hs01034071 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp fam20a hs01034071 m1/product/Thermo Fisher
Average 94 stars, based on 1 article reviews
gene exp fam20a hs01034071 m1 - by Bioz Stars, 2026-02
94/100 stars
  Buy from Supplier

85
Thermo Fisher gene exp fam20a mm00464089 m1
Gene Exp Fam20a Mm00464089 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp fam20a mm00464089 m1/product/Thermo Fisher
Average 85 stars, based on 1 article reviews
gene exp fam20a mm00464089 m1 - by Bioz Stars, 2026-02
85/100 stars
  Buy from Supplier

90
Fisher Scientific fam20a reverse tgtgtctcagtttccctgtctg
Fam20a Reverse Tgtgtctcagtttccctgtctg, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fam20a reverse tgtgtctcagtttccctgtctg/product/Fisher Scientific
Average 90 stars, based on 1 article reviews
fam20a reverse tgtgtctcagtttccctgtctg - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Fisher Scientific fam20a forward aaggaccccacaggtgtttt
Fam20a Forward Aaggaccccacaggtgtttt, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fam20a forward aaggaccccacaggtgtttt/product/Fisher Scientific
Average 90 stars, based on 1 article reviews
fam20a forward aaggaccccacaggtgtttt - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

Image Search Results