fam20a Search Results


94
Thermo Fisher gene exp fam20a hs01034071 m1
Gene Exp Fam20a Hs01034071 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp fam20a hs01034071 m1/product/Thermo Fisher
Average 94 stars, based on 1 article reviews
gene exp fam20a hs01034071 m1 - by Bioz Stars, 2026-02
94/100 stars
  Buy from Supplier

85
Thermo Fisher gene exp fam20a mm00464089 m1
Gene Exp Fam20a Mm00464089 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp fam20a mm00464089 m1/product/Thermo Fisher
Average 85 stars, based on 1 article reviews
gene exp fam20a mm00464089 m1 - by Bioz Stars, 2026-02
85/100 stars
  Buy from Supplier

91
Thermo Fisher gene exp fam20a hs01034070 m1
RNAs used in confirmation testing. ( a ) Coding mRNA; ( b ) Noncoding small RNA.
Gene Exp Fam20a Hs01034070 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp fam20a hs01034070 m1/product/Thermo Fisher
Average 91 stars, based on 1 article reviews
gene exp fam20a hs01034070 m1 - by Bioz Stars, 2026-02
91/100 stars
  Buy from Supplier

90
Proteintech polyclonal anti fam20a
RNAs used in confirmation testing. ( a ) Coding mRNA; ( b ) Noncoding small RNA.
Polyclonal Anti Fam20a, supplied by Proteintech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/polyclonal anti fam20a/product/Proteintech
Average 90 stars, based on 1 article reviews
polyclonal anti fam20a - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
OriGene human fam20a
( A ) Comparison of gene expression among Fam20 family members. Quantitative real-time PCR analysis was performed using 5-week-old mouse tissues (brain, heart, lung, kidney, calvaria, tooth). The mean fold change in the expression of each Fam20 member was calculated based on the normalization to that of glyceraldehyde-3-phosphate dehydrogenase ( Gapdh ) using the value of <t>Fam20a</t> in brain as a calibrator. The values are shown as the mean + S.D. based on triplicate assays. The expression of Fam20a is indicated by blue bars, Fam20b by red and Fam20c by green. ( B ) Immunohistochemical analysis of FAM20A and FAM20C in adult mouse incisors. FAM20A (a,d) and FAM20C (b,e) were both localized in the same cell/tissue types. No immunoreactivities were observed when non-immune goat serum was used as a negative control (c,f). Scale bar, 50 μm. Images of odontoblasts and ameloblasts were shown at a higher magnification on the right corner of each image (scale bar, 10 μm). Pu; pulp, Od; odontoblasts, PD; pre-dentin, D; dentin, E; enamel, Am; ameloblasts, Si; stratum intermedium.
Human Fam20a, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human fam20a/product/OriGene
Average 90 stars, based on 1 article reviews
human fam20a - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
ABclonal Biotechnology anti-fam20a
(A) Pedigree. Dots mark the two persons who donated samples for DNA sequencing. (B) Oral photographs of the proband (III:1). Most teeth were covered with fixed prostheses. The uncovered teeth (tooth numbers 2, 14, 15, 29, 31) show generally thin dental enamel with smooth tooth surface. The attached gingiva is enlarged and bumpy. (C) Panoramic radiograph of the proband. Many impacted teeth (tooth numbers 1, 16, 17, 18, 22, 26, 27, 32) show a complete lack of dental enamel and intrapulpal calcifications. Roots of the teeth are generally short. (D) Kidney ultrasounds of the proband. Hyperechoic signals are evident and suggestive of medullary nephrocalcinosis. (E) DNA sequencing chromatograms of <t>FAM20A</t> mutations. Left: Sequence from the border of Exon 1 and Intron 1 revealing heterozygosity for a one-nucleotide deletion (g.5417delG; c.129delG) that occurs in the father (II:5) and proband. Right: Exon 5 sequence revealing heterozygosity for a two-nucleotide deletion (g.62248_62249delAG; c.734_735delAG) and a synonymous SNP (g.62249G>A; rs2286562) that occur in the proband. The mutation designations are with respect to the FAM20A genomic reference sequence NG_029809.1 and cDNA reference sequence NM_017565.3 (for mRNA transcript variant 1).
Anti Fam20a, supplied by ABclonal Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti-fam20a/product/ABclonal Biotechnology
Average 90 stars, based on 1 article reviews
anti-fam20a - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Mochida Pharmaceutical fam20a protein
(A) Pedigree. Dots mark the two persons who donated samples for DNA sequencing. (B) Oral photographs of the proband (III:1). Most teeth were covered with fixed prostheses. The uncovered teeth (tooth numbers 2, 14, 15, 29, 31) show generally thin dental enamel with smooth tooth surface. The attached gingiva is enlarged and bumpy. (C) Panoramic radiograph of the proband. Many impacted teeth (tooth numbers 1, 16, 17, 18, 22, 26, 27, 32) show a complete lack of dental enamel and intrapulpal calcifications. Roots of the teeth are generally short. (D) Kidney ultrasounds of the proband. Hyperechoic signals are evident and suggestive of medullary nephrocalcinosis. (E) DNA sequencing chromatograms of <t>FAM20A</t> mutations. Left: Sequence from the border of Exon 1 and Intron 1 revealing heterozygosity for a one-nucleotide deletion (g.5417delG; c.129delG) that occurs in the father (II:5) and proband. Right: Exon 5 sequence revealing heterozygosity for a two-nucleotide deletion (g.62248_62249delAG; c.734_735delAG) and a synonymous SNP (g.62249G>A; rs2286562) that occur in the proband. The mutation designations are with respect to the FAM20A genomic reference sequence NG_029809.1 and cDNA reference sequence NM_017565.3 (for mRNA transcript variant 1).
Fam20a Protein, supplied by Mochida Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fam20a protein/product/Mochida Pharmaceutical
Average 90 stars, based on 1 article reviews
fam20a protein - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
OriGene fa20a (fam20a) (nm_017565) human tagged orf clone
(A) Pedigree. Dots mark the two persons who donated samples for DNA sequencing. (B) Oral photographs of the proband (III:1). Most teeth were covered with fixed prostheses. The uncovered teeth (tooth numbers 2, 14, 15, 29, 31) show generally thin dental enamel with smooth tooth surface. The attached gingiva is enlarged and bumpy. (C) Panoramic radiograph of the proband. Many impacted teeth (tooth numbers 1, 16, 17, 18, 22, 26, 27, 32) show a complete lack of dental enamel and intrapulpal calcifications. Roots of the teeth are generally short. (D) Kidney ultrasounds of the proband. Hyperechoic signals are evident and suggestive of medullary nephrocalcinosis. (E) DNA sequencing chromatograms of <t>FAM20A</t> mutations. Left: Sequence from the border of Exon 1 and Intron 1 revealing heterozygosity for a one-nucleotide deletion (g.5417delG; c.129delG) that occurs in the father (II:5) and proband. Right: Exon 5 sequence revealing heterozygosity for a two-nucleotide deletion (g.62248_62249delAG; c.734_735delAG) and a synonymous SNP (g.62249G>A; rs2286562) that occur in the proband. The mutation designations are with respect to the FAM20A genomic reference sequence NG_029809.1 and cDNA reference sequence NM_017565.3 (for mRNA transcript variant 1).
Fa20a (Fam20a) (Nm 017565) Human Tagged Orf Clone, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fa20a (fam20a) (nm_017565) human tagged orf clone/product/OriGene
Average 90 stars, based on 1 article reviews
fa20a (fam20a) (nm_017565) human tagged orf clone - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Gallus BioPharmaceuticals human fam20a
(A) Pedigree. Dots mark the two persons who donated samples for DNA sequencing. (B) Oral photographs of the proband (III:1). Most teeth were covered with fixed prostheses. The uncovered teeth (tooth numbers 2, 14, 15, 29, 31) show generally thin dental enamel with smooth tooth surface. The attached gingiva is enlarged and bumpy. (C) Panoramic radiograph of the proband. Many impacted teeth (tooth numbers 1, 16, 17, 18, 22, 26, 27, 32) show a complete lack of dental enamel and intrapulpal calcifications. Roots of the teeth are generally short. (D) Kidney ultrasounds of the proband. Hyperechoic signals are evident and suggestive of medullary nephrocalcinosis. (E) DNA sequencing chromatograms of <t>FAM20A</t> mutations. Left: Sequence from the border of Exon 1 and Intron 1 revealing heterozygosity for a one-nucleotide deletion (g.5417delG; c.129delG) that occurs in the father (II:5) and proband. Right: Exon 5 sequence revealing heterozygosity for a two-nucleotide deletion (g.62248_62249delAG; c.734_735delAG) and a synonymous SNP (g.62249G>A; rs2286562) that occur in the proband. The mutation designations are with respect to the FAM20A genomic reference sequence NG_029809.1 and cDNA reference sequence NM_017565.3 (for mRNA transcript variant 1).
Human Fam20a, supplied by Gallus BioPharmaceuticals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human fam20a/product/Gallus BioPharmaceuticals
Average 90 stars, based on 1 article reviews
human fam20a - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Fisher Scientific fam20a reverse tgtgtctcagtttccctgtctg
(A) Pedigree. Dots mark the two persons who donated samples for DNA sequencing. (B) Oral photographs of the proband (III:1). Most teeth were covered with fixed prostheses. The uncovered teeth (tooth numbers 2, 14, 15, 29, 31) show generally thin dental enamel with smooth tooth surface. The attached gingiva is enlarged and bumpy. (C) Panoramic radiograph of the proband. Many impacted teeth (tooth numbers 1, 16, 17, 18, 22, 26, 27, 32) show a complete lack of dental enamel and intrapulpal calcifications. Roots of the teeth are generally short. (D) Kidney ultrasounds of the proband. Hyperechoic signals are evident and suggestive of medullary nephrocalcinosis. (E) DNA sequencing chromatograms of <t>FAM20A</t> mutations. Left: Sequence from the border of Exon 1 and Intron 1 revealing heterozygosity for a one-nucleotide deletion (g.5417delG; c.129delG) that occurs in the father (II:5) and proband. Right: Exon 5 sequence revealing heterozygosity for a two-nucleotide deletion (g.62248_62249delAG; c.734_735delAG) and a synonymous SNP (g.62249G>A; rs2286562) that occur in the proband. The mutation designations are with respect to the FAM20A genomic reference sequence NG_029809.1 and cDNA reference sequence NM_017565.3 (for mRNA transcript variant 1).
Fam20a Reverse Tgtgtctcagtttccctgtctg, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fam20a reverse tgtgtctcagtttccctgtctg/product/Fisher Scientific
Average 90 stars, based on 1 article reviews
fam20a reverse tgtgtctcagtttccctgtctg - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

Image Search Results


RNAs used in confirmation testing. ( a ) Coding mRNA; ( b ) Noncoding small RNA.

Journal: Diagnostics

Article Title: Detection of Embryonic Trisomy 21 in the First Trimester Using Maternal Plasma Cell-Free RNA

doi: 10.3390/diagnostics12061410

Figure Lengend Snippet: RNAs used in confirmation testing. ( a ) Coding mRNA; ( b ) Noncoding small RNA.

Article Snippet: FAM20A-Hs01034070_m1 , <0.01 , NR_027751 , 17 , Down.

Techniques: Sequencing

Differentially expressed RNAs and biographical variables used in machine learning.

Journal: Diagnostics

Article Title: Detection of Embryonic Trisomy 21 in the First Trimester Using Maternal Plasma Cell-Free RNA

doi: 10.3390/diagnostics12061410

Figure Lengend Snippet: Differentially expressed RNAs and biographical variables used in machine learning.

Article Snippet: FAM20A-Hs01034070_m1 , <0.01 , NR_027751 , 17 , Down.

Techniques:

Seven most important variables used in top-performing ML models.

Journal: Diagnostics

Article Title: Detection of Embryonic Trisomy 21 in the First Trimester Using Maternal Plasma Cell-Free RNA

doi: 10.3390/diagnostics12061410

Figure Lengend Snippet: Seven most important variables used in top-performing ML models.

Article Snippet: FAM20A-Hs01034070_m1 , <0.01 , NR_027751 , 17 , Down.

Techniques: Sequencing

( A ) Comparison of gene expression among Fam20 family members. Quantitative real-time PCR analysis was performed using 5-week-old mouse tissues (brain, heart, lung, kidney, calvaria, tooth). The mean fold change in the expression of each Fam20 member was calculated based on the normalization to that of glyceraldehyde-3-phosphate dehydrogenase ( Gapdh ) using the value of Fam20a in brain as a calibrator. The values are shown as the mean + S.D. based on triplicate assays. The expression of Fam20a is indicated by blue bars, Fam20b by red and Fam20c by green. ( B ) Immunohistochemical analysis of FAM20A and FAM20C in adult mouse incisors. FAM20A (a,d) and FAM20C (b,e) were both localized in the same cell/tissue types. No immunoreactivities were observed when non-immune goat serum was used as a negative control (c,f). Scale bar, 50 μm. Images of odontoblasts and ameloblasts were shown at a higher magnification on the right corner of each image (scale bar, 10 μm). Pu; pulp, Od; odontoblasts, PD; pre-dentin, D; dentin, E; enamel, Am; ameloblasts, Si; stratum intermedium.

Journal: Scientific Reports

Article Title: FAM20A binds to and regulates FAM20C localization

doi: 10.1038/srep27784

Figure Lengend Snippet: ( A ) Comparison of gene expression among Fam20 family members. Quantitative real-time PCR analysis was performed using 5-week-old mouse tissues (brain, heart, lung, kidney, calvaria, tooth). The mean fold change in the expression of each Fam20 member was calculated based on the normalization to that of glyceraldehyde-3-phosphate dehydrogenase ( Gapdh ) using the value of Fam20a in brain as a calibrator. The values are shown as the mean + S.D. based on triplicate assays. The expression of Fam20a is indicated by blue bars, Fam20b by red and Fam20c by green. ( B ) Immunohistochemical analysis of FAM20A and FAM20C in adult mouse incisors. FAM20A (a,d) and FAM20C (b,e) were both localized in the same cell/tissue types. No immunoreactivities were observed when non-immune goat serum was used as a negative control (c,f). Scale bar, 50 μm. Images of odontoblasts and ameloblasts were shown at a higher magnification on the right corner of each image (scale bar, 10 μm). Pu; pulp, Od; odontoblasts, PD; pre-dentin, D; dentin, E; enamel, Am; ameloblasts, Si; stratum intermedium.

Article Snippet: The plasmids containing the full length sequence of human FAM20A and FAM20C were purchased from OriGene and used as PCR templates.

Techniques: Expressing, Real-time Polymerase Chain Reaction, Immunohistochemical staining, Negative Control

( A ) Binding assay in a cell culture system. The 293 cells were transiently transfected with FAM20A-Flag (lane 2) and FAM20C-HA (lanes 2 and 3). Cell lysates were prepared and immunoprecipitated (IP) with anti-Flag antibody. The interaction was detected by Western blotting (WB) with anti-HA antibody (upper panel). Presence of FAM20C-HA (middle panel) and FAM20A-Flag (lower panel) in the same lysates was verified. ( B ) FAM20A-FAM20C interaction is independent from FAM20C kinase activity. The 293 cells were transfected with FAM20A WT-HA and FAM20C WT-V5 (WT), FAM20C D478A-V5 (DA), or FAM20C P328S-V5 (PS). Cell lysates were immunoprecipitated with anti-V5 antibody and the interaction was detected by WB analysis with anti-HA antibody (upper panel). Presence of FAM20A WT-HA (middle panel) and FAM20C forms (lower panel) in the same lysates was confirmed. ( C ) Binding assay by GST pull down. The rhFAM20C WT-V5/His or rhFAM20C D478A-V5/His protein was incubated with either GST protein alone or GST-FAM20A protein and coupled to glutathione beads. After washing the beads, the bound proteins were visualized by WB analysis with anti-V5 antibody (upper panel). Presence of rhFAM20C WT-V5/His (upper panel, lane 5), rhFAM20C D478A-V5/His (upper panel, lane 6), GST and GST-FAM20A (lower panels) proteins were assessed by WB analysis.

Journal: Scientific Reports

Article Title: FAM20A binds to and regulates FAM20C localization

doi: 10.1038/srep27784

Figure Lengend Snippet: ( A ) Binding assay in a cell culture system. The 293 cells were transiently transfected with FAM20A-Flag (lane 2) and FAM20C-HA (lanes 2 and 3). Cell lysates were prepared and immunoprecipitated (IP) with anti-Flag antibody. The interaction was detected by Western blotting (WB) with anti-HA antibody (upper panel). Presence of FAM20C-HA (middle panel) and FAM20A-Flag (lower panel) in the same lysates was verified. ( B ) FAM20A-FAM20C interaction is independent from FAM20C kinase activity. The 293 cells were transfected with FAM20A WT-HA and FAM20C WT-V5 (WT), FAM20C D478A-V5 (DA), or FAM20C P328S-V5 (PS). Cell lysates were immunoprecipitated with anti-V5 antibody and the interaction was detected by WB analysis with anti-HA antibody (upper panel). Presence of FAM20A WT-HA (middle panel) and FAM20C forms (lower panel) in the same lysates was confirmed. ( C ) Binding assay by GST pull down. The rhFAM20C WT-V5/His or rhFAM20C D478A-V5/His protein was incubated with either GST protein alone or GST-FAM20A protein and coupled to glutathione beads. After washing the beads, the bound proteins were visualized by WB analysis with anti-V5 antibody (upper panel). Presence of rhFAM20C WT-V5/His (upper panel, lane 5), rhFAM20C D478A-V5/His (upper panel, lane 6), GST and GST-FAM20A (lower panels) proteins were assessed by WB analysis.

Article Snippet: The plasmids containing the full length sequence of human FAM20A and FAM20C were purchased from OriGene and used as PCR templates.

Techniques: Binding Assay, Cell Culture, Transfection, Immunoprecipitation, Western Blot, Activity Assay, Incubation

The 293 cells were transfected with pc3-FAM20A WT-Flag (WT), pc3-FAM20A R392Pfs21-Flag (R392Pfs21) or pc3-FAM20A G331D-Flag (G331D) together with pc3.1-FAM20C WT-V5/His (FAM20C-V5). Conditioned media (CM) were collected and IP-WB analysis was performed to detect extracellular FAM20C (upper panel). The intracellular expression of FAM20C was verified by WB analysis with cell lysates (Lys, middle panel) and that of FAM20A WT and AI-mutants was also confirmed by IP-WB analysis with cell lysates (lower panel). FAM20C secretion is accelerated with FAM20A WT co-transfection as compared to FAM20C transfection alone (upper panel, lane 2 vs. 1ane 1). AI-associated FAM20A mutants, R392Pfs21 (upper panel, lane 3) and G331D (upper panel, lane 4), fail to enhance the extracellular FAM20C accumulation.

Journal: Scientific Reports

Article Title: FAM20A binds to and regulates FAM20C localization

doi: 10.1038/srep27784

Figure Lengend Snippet: The 293 cells were transfected with pc3-FAM20A WT-Flag (WT), pc3-FAM20A R392Pfs21-Flag (R392Pfs21) or pc3-FAM20A G331D-Flag (G331D) together with pc3.1-FAM20C WT-V5/His (FAM20C-V5). Conditioned media (CM) were collected and IP-WB analysis was performed to detect extracellular FAM20C (upper panel). The intracellular expression of FAM20C was verified by WB analysis with cell lysates (Lys, middle panel) and that of FAM20A WT and AI-mutants was also confirmed by IP-WB analysis with cell lysates (lower panel). FAM20C secretion is accelerated with FAM20A WT co-transfection as compared to FAM20C transfection alone (upper panel, lane 2 vs. 1ane 1). AI-associated FAM20A mutants, R392Pfs21 (upper panel, lane 3) and G331D (upper panel, lane 4), fail to enhance the extracellular FAM20C accumulation.

Article Snippet: The plasmids containing the full length sequence of human FAM20A and FAM20C were purchased from OriGene and used as PCR templates.

Techniques: Transfection, Expressing, Cotransfection

( A ) Conditioned media and cell lysates were collected from Wild-type (WT) and knockout (KO) of Fam20a -KO mouse-derived MEF cells. IP-WB analysis with anti-FAM20C antibody was performed to detect extracellular FAM20C (top panel). Intracellular FAM20C (upper middle panel) and intracellular FAM20A (lower middle panel) were detected by WB analysis with anti-FAM20C and anti-FAM20A antibodies, respectively. The expression of β-TUBULIN was shown (bottom panel) as a loading control. Extracellular FAM20C was not detected in KO MEF cells, although intracellular FAM20C levels were comparable between WT and KO cell cultures. Three independent experiments were performed and the representative set of images were shown. The band intensities of intracellular FAM20C normalized to β-TUBULIN in the same lysate were calculated and the values are expressed as the mean + SD (n = 3) (graph on the right). There was no statistical difference of normalized intracellular FAM20C expression between WT and KO. ( B ) MC3T3-E1 osteoblastic cells were cultured with conditioned media (CM) from Fam20a WT and KO MEF cells, and impact of FAM20A-mediated FAM20C secretion was assessed by in vitro mineralization assay. Mineralized nodule formation was impaired in osteoblasts the presence of CM from Fam20a KO MEF cells. Three independent experiments were performed and the representative set of images were shown. The concentration of Alizarin Red S dye extracted from each cell culture matrix was calculated and the values are expressed as the mean + SD (n = 3) with statistical analysis. The asterisk above the bar graph indicates the presence of statistical difference between CM from WT and CM from KO treatment groups. *p < 0.01.

Journal: Scientific Reports

Article Title: FAM20A binds to and regulates FAM20C localization

doi: 10.1038/srep27784

Figure Lengend Snippet: ( A ) Conditioned media and cell lysates were collected from Wild-type (WT) and knockout (KO) of Fam20a -KO mouse-derived MEF cells. IP-WB analysis with anti-FAM20C antibody was performed to detect extracellular FAM20C (top panel). Intracellular FAM20C (upper middle panel) and intracellular FAM20A (lower middle panel) were detected by WB analysis with anti-FAM20C and anti-FAM20A antibodies, respectively. The expression of β-TUBULIN was shown (bottom panel) as a loading control. Extracellular FAM20C was not detected in KO MEF cells, although intracellular FAM20C levels were comparable between WT and KO cell cultures. Three independent experiments were performed and the representative set of images were shown. The band intensities of intracellular FAM20C normalized to β-TUBULIN in the same lysate were calculated and the values are expressed as the mean + SD (n = 3) (graph on the right). There was no statistical difference of normalized intracellular FAM20C expression between WT and KO. ( B ) MC3T3-E1 osteoblastic cells were cultured with conditioned media (CM) from Fam20a WT and KO MEF cells, and impact of FAM20A-mediated FAM20C secretion was assessed by in vitro mineralization assay. Mineralized nodule formation was impaired in osteoblasts the presence of CM from Fam20a KO MEF cells. Three independent experiments were performed and the representative set of images were shown. The concentration of Alizarin Red S dye extracted from each cell culture matrix was calculated and the values are expressed as the mean + SD (n = 3) with statistical analysis. The asterisk above the bar graph indicates the presence of statistical difference between CM from WT and CM from KO treatment groups. *p < 0.01.

Article Snippet: The plasmids containing the full length sequence of human FAM20A and FAM20C were purchased from OriGene and used as PCR templates.

Techniques: Knock-Out, Derivative Assay, Expressing, Cell Culture, In Vitro, Mineralization Assay, Concentration Assay

A model for the role of FAM20A in the FAM20A-FAM20C complex. FAM20A binds to FAM20C, in which FAM20C may be allosterically modulated by FAM20A, leading to secretion. In the case of FAM20A with Amelogenesis Imperfecta (AI) mutation or absence of FAM20A (i.e. KO), FAM20C secretion does not occur, which consequently results in poor osteoblast mineralization.

Journal: Scientific Reports

Article Title: FAM20A binds to and regulates FAM20C localization

doi: 10.1038/srep27784

Figure Lengend Snippet: A model for the role of FAM20A in the FAM20A-FAM20C complex. FAM20A binds to FAM20C, in which FAM20C may be allosterically modulated by FAM20A, leading to secretion. In the case of FAM20A with Amelogenesis Imperfecta (AI) mutation or absence of FAM20A (i.e. KO), FAM20C secretion does not occur, which consequently results in poor osteoblast mineralization.

Article Snippet: The plasmids containing the full length sequence of human FAM20A and FAM20C were purchased from OriGene and used as PCR templates.

Techniques: Mutagenesis

Primer sequences.

Journal: Scientific Reports

Article Title: FAM20A binds to and regulates FAM20C localization

doi: 10.1038/srep27784

Figure Lengend Snippet: Primer sequences.

Article Snippet: The plasmids containing the full length sequence of human FAM20A and FAM20C were purchased from OriGene and used as PCR templates.

Techniques: Sequencing

(A) Pedigree. Dots mark the two persons who donated samples for DNA sequencing. (B) Oral photographs of the proband (III:1). Most teeth were covered with fixed prostheses. The uncovered teeth (tooth numbers 2, 14, 15, 29, 31) show generally thin dental enamel with smooth tooth surface. The attached gingiva is enlarged and bumpy. (C) Panoramic radiograph of the proband. Many impacted teeth (tooth numbers 1, 16, 17, 18, 22, 26, 27, 32) show a complete lack of dental enamel and intrapulpal calcifications. Roots of the teeth are generally short. (D) Kidney ultrasounds of the proband. Hyperechoic signals are evident and suggestive of medullary nephrocalcinosis. (E) DNA sequencing chromatograms of FAM20A mutations. Left: Sequence from the border of Exon 1 and Intron 1 revealing heterozygosity for a one-nucleotide deletion (g.5417delG; c.129delG) that occurs in the father (II:5) and proband. Right: Exon 5 sequence revealing heterozygosity for a two-nucleotide deletion (g.62248_62249delAG; c.734_735delAG) and a synonymous SNP (g.62249G>A; rs2286562) that occur in the proband. The mutation designations are with respect to the FAM20A genomic reference sequence NG_029809.1 and cDNA reference sequence NM_017565.3 (for mRNA transcript variant 1).

Journal: Journal of periodontal research

Article Title: Transcriptome analysis of gingival tissues of Enamel Renal Syndrome

doi: 10.1111/jre.12666

Figure Lengend Snippet: (A) Pedigree. Dots mark the two persons who donated samples for DNA sequencing. (B) Oral photographs of the proband (III:1). Most teeth were covered with fixed prostheses. The uncovered teeth (tooth numbers 2, 14, 15, 29, 31) show generally thin dental enamel with smooth tooth surface. The attached gingiva is enlarged and bumpy. (C) Panoramic radiograph of the proband. Many impacted teeth (tooth numbers 1, 16, 17, 18, 22, 26, 27, 32) show a complete lack of dental enamel and intrapulpal calcifications. Roots of the teeth are generally short. (D) Kidney ultrasounds of the proband. Hyperechoic signals are evident and suggestive of medullary nephrocalcinosis. (E) DNA sequencing chromatograms of FAM20A mutations. Left: Sequence from the border of Exon 1 and Intron 1 revealing heterozygosity for a one-nucleotide deletion (g.5417delG; c.129delG) that occurs in the father (II:5) and proband. Right: Exon 5 sequence revealing heterozygosity for a two-nucleotide deletion (g.62248_62249delAG; c.734_735delAG) and a synonymous SNP (g.62249G>A; rs2286562) that occur in the proband. The mutation designations are with respect to the FAM20A genomic reference sequence NG_029809.1 and cDNA reference sequence NM_017565.3 (for mRNA transcript variant 1).

Article Snippet: The primary antibodies used in the study included: anti-FAM20A (1:100 ; A8496 ; ABclonal Technology, Woburn, MA USA), anti-ALPL (1:100 ; 11187–1-AP ; Proteintech, Rosemont, IL USA), anti-SPARC (1:100 ; 15274–1-AP ; Proteintech), anti-ACTA2 (1A4 ; Cell Marque, Rocklin, CA USA).

Techniques: DNA Sequencing, Sequencing, Mutagenesis, Variant Assay

(A, B) H&E staining of proband’s gingival tissue (100X). A: The epithelium shows mild acanthosis and thick broad-based rete ridges. Dense collagen fibers running in different direction are seen in the lamina propria with some basophilic calcifications (arrowhead). B: Clusters of psammomatous calcifications (arrowheads) are observed at different areas of gingival connective tissue with no apparent epithelial nests around. (C, D) FAM20A localization in gingival tissues from the proband and a control (100X). C: In proband’s gingiva, FAM20A immunoreactivity is minimal except some scattered staining in the epithelium. D: In control gingiva, strong FAM20A signals are observed throughout the whole layer of epithelium, except the basal cell layer and the parakeratinized surface layer. Moderate signal is also detected in endothelium of blood vessels and some connective tissue fibroblasts.

Journal: Journal of periodontal research

Article Title: Transcriptome analysis of gingival tissues of Enamel Renal Syndrome

doi: 10.1111/jre.12666

Figure Lengend Snippet: (A, B) H&E staining of proband’s gingival tissue (100X). A: The epithelium shows mild acanthosis and thick broad-based rete ridges. Dense collagen fibers running in different direction are seen in the lamina propria with some basophilic calcifications (arrowhead). B: Clusters of psammomatous calcifications (arrowheads) are observed at different areas of gingival connective tissue with no apparent epithelial nests around. (C, D) FAM20A localization in gingival tissues from the proband and a control (100X). C: In proband’s gingiva, FAM20A immunoreactivity is minimal except some scattered staining in the epithelium. D: In control gingiva, strong FAM20A signals are observed throughout the whole layer of epithelium, except the basal cell layer and the parakeratinized surface layer. Moderate signal is also detected in endothelium of blood vessels and some connective tissue fibroblasts.

Article Snippet: The primary antibodies used in the study included: anti-FAM20A (1:100 ; A8496 ; ABclonal Technology, Woburn, MA USA), anti-ALPL (1:100 ; 11187–1-AP ; Proteintech, Rosemont, IL USA), anti-SPARC (1:100 ; 15274–1-AP ; Proteintech), anti-ACTA2 (1A4 ; Cell Marque, Rocklin, CA USA).

Techniques: Staining