Review



dusp16 plasmid  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Addgene inc dusp16 plasmid
    Dusp16 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dusp16+plasmid/pLX302-MKP7-V5+puro+(Plasmid+%2387771)/pmc09104707__supp_gr__275811__121_Supplemental_Material-133-1-8
    Average 90 stars, based on 2 article reviews
    dusp16 plasmid - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: A general calculus of fitness landscapes finds genes under selection in cancers
    Article Snippet: BT474, and HEK293 were obtained from ATCC and maintained in DMEM medium supplemented with high glucose (Life Technologies), 10% fetal bovine serum (FBS) (Thermo Fisher Scientific) with 50 units/ml penicillin and 50 μg/ml streptomycin (Life Technologies) in a humidified atmosphere of 5% CO2 at 37oC. .. The DUSP16 plasmid (pLX302-MKP7-V5 puro) was purchased from Addgene (#87771). .. The DUSP16 ORF was amplified with forward primer GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGAAGGAGATAGAACCATGGCCCATGAGATG ATTGGAACTCA and reverse primer GGGGACCACTTTGTACAAGAAAGCTGGGTTCTACGTAGAATCGAGACCGAGGA and cloned into an inducible lentiviral expression system (from Dr. Zhu Songyang(Kim et al. 2017)) using Gateway BP and LR Clonase II (Life Technologies) according to the manufacturer’s instructions.



    Similar Products

    90
    Shanghai GenePharma dusp16-overexpressing plasmids
    Dusp16 Overexpressing Plasmids, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dusp16+plasmid/sirna+pool+for+dusp16/pm38583797-69-20-24
    Average 90 stars, based on 1 article reviews
    dusp16-overexpressing plasmids - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Addgene inc dusp16 plasmid
    Dusp16 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dusp16+plasmid/pLX302-MKP7-V5+puro+(Plasmid+%2387771)/pmc09104707__supp_gr__275811__121_Supplemental_Material-133-1-8
    Average 90 stars, based on 1 article reviews
    dusp16 plasmid - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    92
    Santa Cruz Biotechnology dusp16 hdr plasmid
    Fig. 1 <t>DUSP16</t> protein expression level is associated with cancer cell sensitivity to cisplatin. A, B Basal expression levels of DUSP16 in NPC cell lines were determined by quantitative real-time PCR (qPCR). Data were expressed as means ± standard error of the mean (mean ± SEM, n = 3 biologically independent samples). Two-tail unpaired t-test showed significantly higher DUSP16 expression in C666-1 and HK-1 cells compared to that in HONE-1 cells. *P < 0.05, **P < 0.001 (A). DUSP16 protein expression in these cells was determined by western blot analysis. The data are representative of two experiments with similar results (B). C Expression of DUSP16 in HK-1 and C666-1 in response to cisplatin treatment was determined by qPCR and western blot analysis. Induction of DUSP16 mRNA expression at each time point was expressed as means ± SEM (n = 3 biologically independent samples). Statistical analysis was performed using two-tailed unpaired t-test. *P < 0.05, **P < 0.001. D Flow cytometric analysis measuring apoptosis in HK-1 and C666-1 cell lines at 48 h after cisplatin treatment. Bar charts show the percentage of apoptotic (AnnexinV+7AAD+) and surviving (AnnexinV−7AAD−) cells, respectively, in both untreated and cisplatin-treated groups with mean ± SEM (n = 3 biologically independent samples). Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. The data are representative of three experiments with similar results. E, F DUSP16 protein expression in colorectal cancer cell DLD-1 and HCT116 (E) and in gastric cancer cell Ags and Nugc3 was evaluated by western blot analysis. The data are representative of 3 experiments with similar results. G, H Phospho-JNK (pJNK), phospho-P38 (pP38), phospho-ERK (pERK) and their total protein expression (tJNK, tP38, and tERK) in HK-1 (G), and C666-1 (H) cells upon cisplatin treatment was examined by western blot analysis. The data are representative of 3 experiments with similar results. Source data are provided as a Source data file.
    Dusp16 Hdr Plasmid, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dusp16+plasmid/MKP-7+CRISPR%2FCas9+KO+Plasmid/pm33863904-420-19-23
    Average 92 stars, based on 1 article reviews
    dusp16 hdr plasmid - by Bioz Stars, 2026-10
    92/100 stars
      Buy from Supplier

    92
    Santa Cruz Biotechnology dusp16 crispr cas9 ko plasmid
    Fig. 1 <t>DUSP16</t> protein expression level is associated with cancer cell sensitivity to cisplatin. A, B Basal expression levels of DUSP16 in NPC cell lines were determined by quantitative real-time PCR (qPCR). Data were expressed as means ± standard error of the mean (mean ± SEM, n = 3 biologically independent samples). Two-tail unpaired t-test showed significantly higher DUSP16 expression in C666-1 and HK-1 cells compared to that in HONE-1 cells. *P < 0.05, **P < 0.001 (A). DUSP16 protein expression in these cells was determined by western blot analysis. The data are representative of two experiments with similar results (B). C Expression of DUSP16 in HK-1 and C666-1 in response to cisplatin treatment was determined by qPCR and western blot analysis. Induction of DUSP16 mRNA expression at each time point was expressed as means ± SEM (n = 3 biologically independent samples). Statistical analysis was performed using two-tailed unpaired t-test. *P < 0.05, **P < 0.001. D Flow cytometric analysis measuring apoptosis in HK-1 and C666-1 cell lines at 48 h after cisplatin treatment. Bar charts show the percentage of apoptotic (AnnexinV+7AAD+) and surviving (AnnexinV−7AAD−) cells, respectively, in both untreated and cisplatin-treated groups with mean ± SEM (n = 3 biologically independent samples). Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. The data are representative of three experiments with similar results. E, F DUSP16 protein expression in colorectal cancer cell DLD-1 and HCT116 (E) and in gastric cancer cell Ags and Nugc3 was evaluated by western blot analysis. The data are representative of 3 experiments with similar results. G, H Phospho-JNK (pJNK), phospho-P38 (pP38), phospho-ERK (pERK) and their total protein expression (tJNK, tP38, and tERK) in HK-1 (G), and C666-1 (H) cells upon cisplatin treatment was examined by western blot analysis. The data are representative of 3 experiments with similar results. Source data are provided as a Source data file.
    Dusp16 Crispr Cas9 Ko Plasmid, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dusp16+plasmid/MKP-7+CRISPR%2FCas9+KO+Plasmid/pm33863904-420-11-16
    Average 92 stars, based on 1 article reviews
    dusp16 crispr cas9 ko plasmid - by Bioz Stars, 2026-10
    92/100 stars
      Buy from Supplier

    90
    Ribobio co dusp16 expression plasmid pcdna3.1-dusp16
    Fig. 1 <t>DUSP16</t> protein expression level is associated with cancer cell sensitivity to cisplatin. A, B Basal expression levels of DUSP16 in NPC cell lines were determined by quantitative real-time PCR (qPCR). Data were expressed as means ± standard error of the mean (mean ± SEM, n = 3 biologically independent samples). Two-tail unpaired t-test showed significantly higher DUSP16 expression in C666-1 and HK-1 cells compared to that in HONE-1 cells. *P < 0.05, **P < 0.001 (A). DUSP16 protein expression in these cells was determined by western blot analysis. The data are representative of two experiments with similar results (B). C Expression of DUSP16 in HK-1 and C666-1 in response to cisplatin treatment was determined by qPCR and western blot analysis. Induction of DUSP16 mRNA expression at each time point was expressed as means ± SEM (n = 3 biologically independent samples). Statistical analysis was performed using two-tailed unpaired t-test. *P < 0.05, **P < 0.001. D Flow cytometric analysis measuring apoptosis in HK-1 and C666-1 cell lines at 48 h after cisplatin treatment. Bar charts show the percentage of apoptotic (AnnexinV+7AAD+) and surviving (AnnexinV−7AAD−) cells, respectively, in both untreated and cisplatin-treated groups with mean ± SEM (n = 3 biologically independent samples). Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. The data are representative of three experiments with similar results. E, F DUSP16 protein expression in colorectal cancer cell DLD-1 and HCT116 (E) and in gastric cancer cell Ags and Nugc3 was evaluated by western blot analysis. The data are representative of 3 experiments with similar results. G, H Phospho-JNK (pJNK), phospho-P38 (pP38), phospho-ERK (pERK) and their total protein expression (tJNK, tP38, and tERK) in HK-1 (G), and C666-1 (H) cells upon cisplatin treatment was examined by western blot analysis. The data are representative of 3 experiments with similar results. Source data are provided as a Source data file.
    Dusp16 Expression Plasmid Pcdna3.1 Dusp16, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dusp16+plasmid/pcdna3+1/pm31982140-49-1-12
    Average 90 stars, based on 1 article reviews
    dusp16 expression plasmid pcdna3.1-dusp16 - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Addgene inc dusp16 mkp7
    Fig. 1 <t>DUSP16</t> protein expression level is associated with cancer cell sensitivity to cisplatin. A, B Basal expression levels of DUSP16 in NPC cell lines were determined by quantitative real-time PCR (qPCR). Data were expressed as means ± standard error of the mean (mean ± SEM, n = 3 biologically independent samples). Two-tail unpaired t-test showed significantly higher DUSP16 expression in C666-1 and HK-1 cells compared to that in HONE-1 cells. *P < 0.05, **P < 0.001 (A). DUSP16 protein expression in these cells was determined by western blot analysis. The data are representative of two experiments with similar results (B). C Expression of DUSP16 in HK-1 and C666-1 in response to cisplatin treatment was determined by qPCR and western blot analysis. Induction of DUSP16 mRNA expression at each time point was expressed as means ± SEM (n = 3 biologically independent samples). Statistical analysis was performed using two-tailed unpaired t-test. *P < 0.05, **P < 0.001. D Flow cytometric analysis measuring apoptosis in HK-1 and C666-1 cell lines at 48 h after cisplatin treatment. Bar charts show the percentage of apoptotic (AnnexinV+7AAD+) and surviving (AnnexinV−7AAD−) cells, respectively, in both untreated and cisplatin-treated groups with mean ± SEM (n = 3 biologically independent samples). Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. The data are representative of three experiments with similar results. E, F DUSP16 protein expression in colorectal cancer cell DLD-1 and HCT116 (E) and in gastric cancer cell Ags and Nugc3 was evaluated by western blot analysis. The data are representative of 3 experiments with similar results. G, H Phospho-JNK (pJNK), phospho-P38 (pP38), phospho-ERK (pERK) and their total protein expression (tJNK, tP38, and tERK) in HK-1 (G), and C666-1 (H) cells upon cisplatin treatment was examined by western blot analysis. The data are representative of 3 experiments with similar results. Source data are provided as a Source data file.
    Dusp16 Mkp7, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dusp16+plasmid/pET16b-Prp16+(Plasmid+%23111351)/pmc05393398-283-5-30
    Average 90 stars, based on 1 article reviews
    dusp16 mkp7 - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    Image Search Results


    Fig. 1 DUSP16 protein expression level is associated with cancer cell sensitivity to cisplatin. A, B Basal expression levels of DUSP16 in NPC cell lines were determined by quantitative real-time PCR (qPCR). Data were expressed as means ± standard error of the mean (mean ± SEM, n = 3 biologically independent samples). Two-tail unpaired t-test showed significantly higher DUSP16 expression in C666-1 and HK-1 cells compared to that in HONE-1 cells. *P < 0.05, **P < 0.001 (A). DUSP16 protein expression in these cells was determined by western blot analysis. The data are representative of two experiments with similar results (B). C Expression of DUSP16 in HK-1 and C666-1 in response to cisplatin treatment was determined by qPCR and western blot analysis. Induction of DUSP16 mRNA expression at each time point was expressed as means ± SEM (n = 3 biologically independent samples). Statistical analysis was performed using two-tailed unpaired t-test. *P < 0.05, **P < 0.001. D Flow cytometric analysis measuring apoptosis in HK-1 and C666-1 cell lines at 48 h after cisplatin treatment. Bar charts show the percentage of apoptotic (AnnexinV+7AAD+) and surviving (AnnexinV−7AAD−) cells, respectively, in both untreated and cisplatin-treated groups with mean ± SEM (n = 3 biologically independent samples). Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. The data are representative of three experiments with similar results. E, F DUSP16 protein expression in colorectal cancer cell DLD-1 and HCT116 (E) and in gastric cancer cell Ags and Nugc3 was evaluated by western blot analysis. The data are representative of 3 experiments with similar results. G, H Phospho-JNK (pJNK), phospho-P38 (pP38), phospho-ERK (pERK) and their total protein expression (tJNK, tP38, and tERK) in HK-1 (G), and C666-1 (H) cells upon cisplatin treatment was examined by western blot analysis. The data are representative of 3 experiments with similar results. Source data are provided as a Source data file.

    Journal: Nature communications

    Article Title: DUSP16 promotes cancer chemoresistance through regulation of mitochondria-mediated cell death.

    doi: 10.1038/s41467-021-22638-7

    Figure Lengend Snippet: Fig. 1 DUSP16 protein expression level is associated with cancer cell sensitivity to cisplatin. A, B Basal expression levels of DUSP16 in NPC cell lines were determined by quantitative real-time PCR (qPCR). Data were expressed as means ± standard error of the mean (mean ± SEM, n = 3 biologically independent samples). Two-tail unpaired t-test showed significantly higher DUSP16 expression in C666-1 and HK-1 cells compared to that in HONE-1 cells. *P < 0.05, **P < 0.001 (A). DUSP16 protein expression in these cells was determined by western blot analysis. The data are representative of two experiments with similar results (B). C Expression of DUSP16 in HK-1 and C666-1 in response to cisplatin treatment was determined by qPCR and western blot analysis. Induction of DUSP16 mRNA expression at each time point was expressed as means ± SEM (n = 3 biologically independent samples). Statistical analysis was performed using two-tailed unpaired t-test. *P < 0.05, **P < 0.001. D Flow cytometric analysis measuring apoptosis in HK-1 and C666-1 cell lines at 48 h after cisplatin treatment. Bar charts show the percentage of apoptotic (AnnexinV+7AAD+) and surviving (AnnexinV−7AAD−) cells, respectively, in both untreated and cisplatin-treated groups with mean ± SEM (n = 3 biologically independent samples). Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. The data are representative of three experiments with similar results. E, F DUSP16 protein expression in colorectal cancer cell DLD-1 and HCT116 (E) and in gastric cancer cell Ags and Nugc3 was evaluated by western blot analysis. The data are representative of 3 experiments with similar results. G, H Phospho-JNK (pJNK), phospho-P38 (pP38), phospho-ERK (pERK) and their total protein expression (tJNK, tP38, and tERK) in HK-1 (G), and C666-1 (H) cells upon cisplatin treatment was examined by western blot analysis. The data are representative of 3 experiments with similar results. Source data are provided as a Source data file.

    Article Snippet: Knockdown of DUSP16 in C666-1 cells was performed by transfection with DUSP16 CRISPR/Cas9 KO Plasmid (sc-405727, Santa Cruz) and DUSP16 HDR plasmid (sc-405727-HDR, Santa Cruz) with UltraCruz® Transfection Reagent (sc395739) according to the manufacturer’s instructions.

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Western Blot, Two Tailed Test

    Fig. 2 Overexpression of DUSP16 in various types of cancer cells results in increased resistance to cisplatin. A mRNA and protein levels of DUSP16 in HK-1 cells transfected with vector or human DUSP16 cDNA were quantified by qPCR and western blot analysis, respectively. Bar chart shows mRNA expression of vector (n = 2) and DUSP16 (n = 4) expressing clones. B, C Comparison of apoptosis induction between vector- and DUSP16-transfected cells after cisplatin treatment was carried out by staining the cells with AnnexinV and 7AAD followed by flow cytometry analysis (B). Bar charts show the percentage of apoptotic (both AnnexinV+7AAD+ and AnnexinV+7AAD−cells) and surviving cells, respectively, in both untreated and cisplatin-treated groups with mean ± SEM, n = 3 biologically independent samples (C). Statistical analysis was performed using two-tailed unpaired t-test. The data are representative of 3 experiments with similar results. D DUSP16 mRNA expression in DLD-1 cells transfected with vector (n = 6) or human DUSP16 cDNA (n = 6) quantified by qPCR. Statistical analysis was performed using two-tailed unpaired t-test. DUSP16 protein expression in these clones was assessed by Western blot. E, F Apoptosis induction between the vector- and DUSP16-transfected DLD-1 cells after cisplatin treatment was analyzed (E) and bar charts show the percentage of apoptotic and surviving cells in both untreated and cisplatin-treated groups with mean ± SEM, n = 3 biologically independent samples (F). Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. G DUSP16 mRNA and protein expression in Nugc3 cells transfected with vector or human DUSP16 cDNA was determined by qPCR and immunoblotting, respectively. Dot plot shows DUSP16 mRNA expression in vector (n = 3) and DUSP16 (n = 5) expressing clones. Statistical analysis was performed using two-tailed unpaired t-test. H, I Apoptosis induction between vector- and DUSP16-transfected Nugc3 cells after cisplatin treatment was analyzed and bar charts (I) show the percentage of apoptotic and surviving cells in untreated and cisplatin-treated cells, respectively, with mean ± SEM, n = 3 biologically independent samples. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. The data are representative of 3 experiments with similar results. Source data are provided as a Source data file.

    Journal: Nature communications

    Article Title: DUSP16 promotes cancer chemoresistance through regulation of mitochondria-mediated cell death.

    doi: 10.1038/s41467-021-22638-7

    Figure Lengend Snippet: Fig. 2 Overexpression of DUSP16 in various types of cancer cells results in increased resistance to cisplatin. A mRNA and protein levels of DUSP16 in HK-1 cells transfected with vector or human DUSP16 cDNA were quantified by qPCR and western blot analysis, respectively. Bar chart shows mRNA expression of vector (n = 2) and DUSP16 (n = 4) expressing clones. B, C Comparison of apoptosis induction between vector- and DUSP16-transfected cells after cisplatin treatment was carried out by staining the cells with AnnexinV and 7AAD followed by flow cytometry analysis (B). Bar charts show the percentage of apoptotic (both AnnexinV+7AAD+ and AnnexinV+7AAD−cells) and surviving cells, respectively, in both untreated and cisplatin-treated groups with mean ± SEM, n = 3 biologically independent samples (C). Statistical analysis was performed using two-tailed unpaired t-test. The data are representative of 3 experiments with similar results. D DUSP16 mRNA expression in DLD-1 cells transfected with vector (n = 6) or human DUSP16 cDNA (n = 6) quantified by qPCR. Statistical analysis was performed using two-tailed unpaired t-test. DUSP16 protein expression in these clones was assessed by Western blot. E, F Apoptosis induction between the vector- and DUSP16-transfected DLD-1 cells after cisplatin treatment was analyzed (E) and bar charts show the percentage of apoptotic and surviving cells in both untreated and cisplatin-treated groups with mean ± SEM, n = 3 biologically independent samples (F). Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. G DUSP16 mRNA and protein expression in Nugc3 cells transfected with vector or human DUSP16 cDNA was determined by qPCR and immunoblotting, respectively. Dot plot shows DUSP16 mRNA expression in vector (n = 3) and DUSP16 (n = 5) expressing clones. Statistical analysis was performed using two-tailed unpaired t-test. H, I Apoptosis induction between vector- and DUSP16-transfected Nugc3 cells after cisplatin treatment was analyzed and bar charts (I) show the percentage of apoptotic and surviving cells in untreated and cisplatin-treated cells, respectively, with mean ± SEM, n = 3 biologically independent samples. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. The data are representative of 3 experiments with similar results. Source data are provided as a Source data file.

    Article Snippet: Knockdown of DUSP16 in C666-1 cells was performed by transfection with DUSP16 CRISPR/Cas9 KO Plasmid (sc-405727, Santa Cruz) and DUSP16 HDR plasmid (sc-405727-HDR, Santa Cruz) with UltraCruz® Transfection Reagent (sc395739) according to the manufacturer’s instructions.

    Techniques: Over Expression, Transfection, Plasmid Preparation, Western Blot, Expressing, Clone Assay, Comparison, Staining, Cytometry, Two Tailed Test

    Fig. 3 Levels of DUSP16 in various types of cancer cells are associated with sensitivity to carboplatin and oxaliplatin. A Comparison of apoptosis induction between HK-1 and C666-1 cells in response to carboplatin treatment by flow cytometry analysis. Bar chart shows the percentage of apoptotic cells with mean values ± standard error of the mean (SEM), n = 3 biologically independent samples. The data are representative of three experiments with similar results. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. B Comparison of apoptosis induction between vector- and DUSP16-transfected HK-1 cells after oxaliplatin or carboplatin treatment by flow cytometry analysis. Bar chart shows the percentage of apoptotic cells (including both AnnexinV+7AAD+ and AnnexinV+7AAD−cells) with mean values ± SEM, n = 3 biologically independent samples. The data are representative of three experiments with similar results. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. C Comparison of apoptosis induction between HCT116 and DLD-1 cells in response to oxaliplatin treatment by flow cytometry analysis. Bar chart shows the percentage of apoptotic cells with mean values ± SEM, n = biologically independent samples. The data are representative of three experiments with similar results. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. D Comparison of apoptosis induction between vector- and DUSP16- transfected HCT116 cells after oxaliplatin or carboplatin treatment by flow cytometry analysis. Bar chart shows the percentage of apoptotic cells with mean values ± SEM, n = 3 biologically independent samples. The data are representative of three experiments with similar results. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. Source data are provided as a Source data file.

    Journal: Nature communications

    Article Title: DUSP16 promotes cancer chemoresistance through regulation of mitochondria-mediated cell death.

    doi: 10.1038/s41467-021-22638-7

    Figure Lengend Snippet: Fig. 3 Levels of DUSP16 in various types of cancer cells are associated with sensitivity to carboplatin and oxaliplatin. A Comparison of apoptosis induction between HK-1 and C666-1 cells in response to carboplatin treatment by flow cytometry analysis. Bar chart shows the percentage of apoptotic cells with mean values ± standard error of the mean (SEM), n = 3 biologically independent samples. The data are representative of three experiments with similar results. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. B Comparison of apoptosis induction between vector- and DUSP16-transfected HK-1 cells after oxaliplatin or carboplatin treatment by flow cytometry analysis. Bar chart shows the percentage of apoptotic cells (including both AnnexinV+7AAD+ and AnnexinV+7AAD−cells) with mean values ± SEM, n = 3 biologically independent samples. The data are representative of three experiments with similar results. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. C Comparison of apoptosis induction between HCT116 and DLD-1 cells in response to oxaliplatin treatment by flow cytometry analysis. Bar chart shows the percentage of apoptotic cells with mean values ± SEM, n = biologically independent samples. The data are representative of three experiments with similar results. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. D Comparison of apoptosis induction between vector- and DUSP16- transfected HCT116 cells after oxaliplatin or carboplatin treatment by flow cytometry analysis. Bar chart shows the percentage of apoptotic cells with mean values ± SEM, n = 3 biologically independent samples. The data are representative of three experiments with similar results. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. Source data are provided as a Source data file.

    Article Snippet: Knockdown of DUSP16 in C666-1 cells was performed by transfection with DUSP16 CRISPR/Cas9 KO Plasmid (sc-405727, Santa Cruz) and DUSP16 HDR plasmid (sc-405727-HDR, Santa Cruz) with UltraCruz® Transfection Reagent (sc395739) according to the manufacturer’s instructions.

    Techniques: Comparison, Cytometry, Two Tailed Test, Plasmid Preparation, Transfection

    Fig. 4 DUSP16 overexpression suppresses BAX-mediated intrinsic apoptotic pathway in various types of cancer cells in response to cisplatin. A–C Western blot analysis of p-MAPKs, total MAPKs, c-Myc, cleaved caspase 9 (C-C9), and cleaved caspase 3 (C-C3) was carried out on vector- and DUSP16- transfected HK-1 (A), DLD-1 (B), and Nugc3 (C) cells after cisplatin treatment. The data is representative of at least two experiments with similar results. D Western blot analysis of cisplatin-induced cytochrome c (Cyt c) release in cytosolic fractions of vector- and DUSP16-transfected HK-1 and DLD-1 cells. The data are representative of three experiments with similar results. E Scatterplots depicting changes in the mitochondrial membrane potential in vector- and DUSP16-transfected HK-1 cells upon cisplatin treatment. F Western blot analysis of BAX expression in mitochondrial and cytosolic fractions of vector- and DUSP16-transfected HK-1 and DLD-1 cells. The data are representative of three experiments with similar results. G Western blot analysis of BAX wild-type (WT) and knockout (KO) DLD-1 cell clones with or without DUSP16 overexpression. The data are representative of two experiments with similar results. H BAX WT and KO DLD-1 cells with or without DUSP16 overexpression were treated with cisplatin for 48 h to examine cell apoptosis by staining with AnnexinV+ and 7AAD+ followed by flow cytometry analysis. Bar chart shows the percentage of apoptotic cells with mean values ± SEM, n = 3 biologically independent samples. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. The data are representative of three experiments with similar results. Source data are provided as a Source data file.

    Journal: Nature communications

    Article Title: DUSP16 promotes cancer chemoresistance through regulation of mitochondria-mediated cell death.

    doi: 10.1038/s41467-021-22638-7

    Figure Lengend Snippet: Fig. 4 DUSP16 overexpression suppresses BAX-mediated intrinsic apoptotic pathway in various types of cancer cells in response to cisplatin. A–C Western blot analysis of p-MAPKs, total MAPKs, c-Myc, cleaved caspase 9 (C-C9), and cleaved caspase 3 (C-C3) was carried out on vector- and DUSP16- transfected HK-1 (A), DLD-1 (B), and Nugc3 (C) cells after cisplatin treatment. The data is representative of at least two experiments with similar results. D Western blot analysis of cisplatin-induced cytochrome c (Cyt c) release in cytosolic fractions of vector- and DUSP16-transfected HK-1 and DLD-1 cells. The data are representative of three experiments with similar results. E Scatterplots depicting changes in the mitochondrial membrane potential in vector- and DUSP16-transfected HK-1 cells upon cisplatin treatment. F Western blot analysis of BAX expression in mitochondrial and cytosolic fractions of vector- and DUSP16-transfected HK-1 and DLD-1 cells. The data are representative of three experiments with similar results. G Western blot analysis of BAX wild-type (WT) and knockout (KO) DLD-1 cell clones with or without DUSP16 overexpression. The data are representative of two experiments with similar results. H BAX WT and KO DLD-1 cells with or without DUSP16 overexpression were treated with cisplatin for 48 h to examine cell apoptosis by staining with AnnexinV+ and 7AAD+ followed by flow cytometry analysis. Bar chart shows the percentage of apoptotic cells with mean values ± SEM, n = 3 biologically independent samples. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. The data are representative of three experiments with similar results. Source data are provided as a Source data file.

    Article Snippet: Knockdown of DUSP16 in C666-1 cells was performed by transfection with DUSP16 CRISPR/Cas9 KO Plasmid (sc-405727, Santa Cruz) and DUSP16 HDR plasmid (sc-405727-HDR, Santa Cruz) with UltraCruz® Transfection Reagent (sc395739) according to the manufacturer’s instructions.

    Techniques: Over Expression, Western Blot, Plasmid Preparation, Transfection, Membrane, Expressing, Knock-Out, Clone Assay, Staining, Cytometry, Two Tailed Test

    Fig. 5 Overexpression of DUSP16 resulted in increased resistance of cancer cells to cisplatin treatment in vivo. A Vector- or DUSP16-transfected HK-1 cells were inoculated into NSG mice. Cisplatin was injected at 3 mg/kg body weight every 3 days. After 20 days, tumors were harvested to measure the sizes and weights. The data are expressed as dots representing the weight of each tumor; the scale bars are the mean ± standard error of the mean (SEM) of tumor weights from six mice in each treatment group of the representative experiment (mean ± SEM, n = 6). Statistical analysis was performed using two-tailed unpaired t-test. B Growth of untreated and cisplatin-treated xenografts of vector- and DUSP16-transfected DLD-1 cells. Box-and-whisker plots show means ± SEM of tumor weights from four mice from each treatment group per experiment (mean ± SEM, n = 4). Boxes correspond to the 25th, 50th/ median and 75th percentiles; whiskers denote maximum and minimum. Statistical analysis was performed using two-tailed unpaired t-test. C, D IHC analysis for cleaved caspase 3 of HK-1 tumor sections; representative images of cleaved caspase 3 staining (n = 6) were shown (C). Boxed regions were magnified and presented under the respective panels. Black arrows highlight the caspase 3 staining. Box-and-whisker plots show means ± SEM of the means of cleaved caspase 3 staining in each group of mice (D). Boxes correspond to the 25th, 50th/median and 75th percentiles; whiskers denote maximum and minimum. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001 (mean ± SEM, n = 3). E, F IHC analysis for Ki67 of tumor sections. Representative images of Ki67 staining were shown (E). Boxed regions were magnified and presented under the respective panels. Black arrows highlighted the Ki67 staining. Box-and-whisker plots show means ± SEM of Ki67 staining (F) from each group of mice ***P < 0.0001 (mean ± SEM, n = 3). The data are representative of three experiments with similar results. Source data are provided as a Source data file.

    Journal: Nature communications

    Article Title: DUSP16 promotes cancer chemoresistance through regulation of mitochondria-mediated cell death.

    doi: 10.1038/s41467-021-22638-7

    Figure Lengend Snippet: Fig. 5 Overexpression of DUSP16 resulted in increased resistance of cancer cells to cisplatin treatment in vivo. A Vector- or DUSP16-transfected HK-1 cells were inoculated into NSG mice. Cisplatin was injected at 3 mg/kg body weight every 3 days. After 20 days, tumors were harvested to measure the sizes and weights. The data are expressed as dots representing the weight of each tumor; the scale bars are the mean ± standard error of the mean (SEM) of tumor weights from six mice in each treatment group of the representative experiment (mean ± SEM, n = 6). Statistical analysis was performed using two-tailed unpaired t-test. B Growth of untreated and cisplatin-treated xenografts of vector- and DUSP16-transfected DLD-1 cells. Box-and-whisker plots show means ± SEM of tumor weights from four mice from each treatment group per experiment (mean ± SEM, n = 4). Boxes correspond to the 25th, 50th/ median and 75th percentiles; whiskers denote maximum and minimum. Statistical analysis was performed using two-tailed unpaired t-test. C, D IHC analysis for cleaved caspase 3 of HK-1 tumor sections; representative images of cleaved caspase 3 staining (n = 6) were shown (C). Boxed regions were magnified and presented under the respective panels. Black arrows highlight the caspase 3 staining. Box-and-whisker plots show means ± SEM of the means of cleaved caspase 3 staining in each group of mice (D). Boxes correspond to the 25th, 50th/median and 75th percentiles; whiskers denote maximum and minimum. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001 (mean ± SEM, n = 3). E, F IHC analysis for Ki67 of tumor sections. Representative images of Ki67 staining were shown (E). Boxed regions were magnified and presented under the respective panels. Black arrows highlighted the Ki67 staining. Box-and-whisker plots show means ± SEM of Ki67 staining (F) from each group of mice ***P < 0.0001 (mean ± SEM, n = 3). The data are representative of three experiments with similar results. Source data are provided as a Source data file.

    Article Snippet: Knockdown of DUSP16 in C666-1 cells was performed by transfection with DUSP16 CRISPR/Cas9 KO Plasmid (sc-405727, Santa Cruz) and DUSP16 HDR plasmid (sc-405727-HDR, Santa Cruz) with UltraCruz® Transfection Reagent (sc395739) according to the manufacturer’s instructions.

    Techniques: Over Expression, In Vivo, Plasmid Preparation, Transfection, Injection, Two Tailed Test, Whisker Assay, Staining

    Fig. 6 DUSP16 knockdown enhances apoptosis in C666-1 cells in response to cisplatin. C666-1 cells were transfected with DUSP16 CRISPR/Cas9 constructs to knockdown DUSP16 expression. A Bar chart shows the mRNA expression in vector and DUSP16 construct transfected cells with mean values ± SEM, n = 3 biologically independent samples. Statistical analysis was performed using two-tailed unpaired t-test. Protein levels of DUSP16 were quantified by immunoblotting. ***P < 0.0001. B Apoptosis of control and DUSP16 knockdown (KD) cells after cisplatin treatment was measured by AnnexinV/7AAD staining and flow cytometry. C Bar charts show the percentage of apoptotic and surviving (unstained) cells with mean values ± SEM, n = 3 biologically independent samples. Statistical analysis was performed using two-tailed unpaired t-test. The data are representative of three experiments with similar results. D Western blot analysis of the pJNK, pP38, pERK, their total protein levels, and c-Myc in control or DUSP16-KD C666-1 cells was carried out after cisplatin treatment. The data are representative of three experiments with similar results. Source data are provided as a Source data file.

    Journal: Nature communications

    Article Title: DUSP16 promotes cancer chemoresistance through regulation of mitochondria-mediated cell death.

    doi: 10.1038/s41467-021-22638-7

    Figure Lengend Snippet: Fig. 6 DUSP16 knockdown enhances apoptosis in C666-1 cells in response to cisplatin. C666-1 cells were transfected with DUSP16 CRISPR/Cas9 constructs to knockdown DUSP16 expression. A Bar chart shows the mRNA expression in vector and DUSP16 construct transfected cells with mean values ± SEM, n = 3 biologically independent samples. Statistical analysis was performed using two-tailed unpaired t-test. Protein levels of DUSP16 were quantified by immunoblotting. ***P < 0.0001. B Apoptosis of control and DUSP16 knockdown (KD) cells after cisplatin treatment was measured by AnnexinV/7AAD staining and flow cytometry. C Bar charts show the percentage of apoptotic and surviving (unstained) cells with mean values ± SEM, n = 3 biologically independent samples. Statistical analysis was performed using two-tailed unpaired t-test. The data are representative of three experiments with similar results. D Western blot analysis of the pJNK, pP38, pERK, their total protein levels, and c-Myc in control or DUSP16-KD C666-1 cells was carried out after cisplatin treatment. The data are representative of three experiments with similar results. Source data are provided as a Source data file.

    Article Snippet: Knockdown of DUSP16 in C666-1 cells was performed by transfection with DUSP16 CRISPR/Cas9 KO Plasmid (sc-405727, Santa Cruz) and DUSP16 HDR plasmid (sc-405727-HDR, Santa Cruz) with UltraCruz® Transfection Reagent (sc395739) according to the manufacturer’s instructions.

    Techniques: Knockdown, Transfection, CRISPR, Construct, Expressing, Plasmid Preparation, Two Tailed Test, Western Blot, Control, Staining, Cytometry

    Fig. 7 DUSP16 knockdown in C666-1 cells resulted in increased sensitivity to cisplatin in vivo and DUSP16 levels were inversely associated with head and neck squamous cell carcinoma (HNSCC) patient and breast cancer patient survival. A Mice were inoculated with control or DUSP16-KD cells. Cisplatin was injected at 3 mg/kg body weight every 3 days. After 20 days, tumors were harvested, and the sizes and weights were measured. The data are expressed as dots representing the weight of each tumor; the scale bars are the mean ± SEM of tumor weights from 4 (the vector control group) or 5 mice (the other groups) of the representative experiment. Statistical analysis was performed using two-tailed unpaired t-test. B Representative images of immunohistochemistry analysis for cleaved caspase 3 and Ki67 staining of tumor sections were shown. Boxed regions were magnified and presented under the respective panels. Black arrows highlight the caspase 3 and Ki67 staining, respectively. Box-and-whisker plots show mean values ± SEM of cleaved caspase 3 and Ki67 staining from each group of mice (n = 4). Boxes correspond to the 25th, 50th/median and 75th percentiles; whiskers denote maximum and minimum. Black scale bars = 200 μm, white scale bars = 50 μm. Statistical analysis was performed using two-tailed unpaired t-test. *P < 0.05. The data are representative of three experiments with similar results. C Representative images of HNSCC specimens (n = 50) showing negative (0 +), low (1 +), intermediate (2+), and high (3+) staining of DUSP16 in tumor cells. Black scale bars = 200 μm. D Patients with higher DUSP16 expression showed lower disease-free survival (DFS) compared to patients with low DUSP16 expression (log-rank test, two-sided, P = 0.042). E Representative images of breast cancer specimens (n = 113) showing negative (0 +), low (1 +), and high (3 +) staining of DUSP16 in tumor cells. Black scale bars = 200 μm. F Among the 113 breast cancer patients (age 28–64) treated with cisplatin, carboplatin, or lobaplatin after surgery, high DUSP16 protein expression in their tumors was associated with lower disease-free survival compared to patients with low DUSP16 expression (log-rank test, two-sided, P ˂ 0.0001). Source data are provided as a Source data file.

    Journal: Nature communications

    Article Title: DUSP16 promotes cancer chemoresistance through regulation of mitochondria-mediated cell death.

    doi: 10.1038/s41467-021-22638-7

    Figure Lengend Snippet: Fig. 7 DUSP16 knockdown in C666-1 cells resulted in increased sensitivity to cisplatin in vivo and DUSP16 levels were inversely associated with head and neck squamous cell carcinoma (HNSCC) patient and breast cancer patient survival. A Mice were inoculated with control or DUSP16-KD cells. Cisplatin was injected at 3 mg/kg body weight every 3 days. After 20 days, tumors were harvested, and the sizes and weights were measured. The data are expressed as dots representing the weight of each tumor; the scale bars are the mean ± SEM of tumor weights from 4 (the vector control group) or 5 mice (the other groups) of the representative experiment. Statistical analysis was performed using two-tailed unpaired t-test. B Representative images of immunohistochemistry analysis for cleaved caspase 3 and Ki67 staining of tumor sections were shown. Boxed regions were magnified and presented under the respective panels. Black arrows highlight the caspase 3 and Ki67 staining, respectively. Box-and-whisker plots show mean values ± SEM of cleaved caspase 3 and Ki67 staining from each group of mice (n = 4). Boxes correspond to the 25th, 50th/median and 75th percentiles; whiskers denote maximum and minimum. Black scale bars = 200 μm, white scale bars = 50 μm. Statistical analysis was performed using two-tailed unpaired t-test. *P < 0.05. The data are representative of three experiments with similar results. C Representative images of HNSCC specimens (n = 50) showing negative (0 +), low (1 +), intermediate (2+), and high (3+) staining of DUSP16 in tumor cells. Black scale bars = 200 μm. D Patients with higher DUSP16 expression showed lower disease-free survival (DFS) compared to patients with low DUSP16 expression (log-rank test, two-sided, P = 0.042). E Representative images of breast cancer specimens (n = 113) showing negative (0 +), low (1 +), and high (3 +) staining of DUSP16 in tumor cells. Black scale bars = 200 μm. F Among the 113 breast cancer patients (age 28–64) treated with cisplatin, carboplatin, or lobaplatin after surgery, high DUSP16 protein expression in their tumors was associated with lower disease-free survival compared to patients with low DUSP16 expression (log-rank test, two-sided, P ˂ 0.0001). Source data are provided as a Source data file.

    Article Snippet: Knockdown of DUSP16 in C666-1 cells was performed by transfection with DUSP16 CRISPR/Cas9 KO Plasmid (sc-405727, Santa Cruz) and DUSP16 HDR plasmid (sc-405727-HDR, Santa Cruz) with UltraCruz® Transfection Reagent (sc395739) according to the manufacturer’s instructions.

    Techniques: Knockdown, In Vivo, Control, Injection, Plasmid Preparation, Two Tailed Test, Immunohistochemistry, Staining, Whisker Assay, Expressing

    Fig. 1 DUSP16 protein expression level is associated with cancer cell sensitivity to cisplatin. A, B Basal expression levels of DUSP16 in NPC cell lines were determined by quantitative real-time PCR (qPCR). Data were expressed as means ± standard error of the mean (mean ± SEM, n = 3 biologically independent samples). Two-tail unpaired t-test showed significantly higher DUSP16 expression in C666-1 and HK-1 cells compared to that in HONE-1 cells. *P < 0.05, **P < 0.001 (A). DUSP16 protein expression in these cells was determined by western blot analysis. The data are representative of two experiments with similar results (B). C Expression of DUSP16 in HK-1 and C666-1 in response to cisplatin treatment was determined by qPCR and western blot analysis. Induction of DUSP16 mRNA expression at each time point was expressed as means ± SEM (n = 3 biologically independent samples). Statistical analysis was performed using two-tailed unpaired t-test. *P < 0.05, **P < 0.001. D Flow cytometric analysis measuring apoptosis in HK-1 and C666-1 cell lines at 48 h after cisplatin treatment. Bar charts show the percentage of apoptotic (AnnexinV+7AAD+) and surviving (AnnexinV−7AAD−) cells, respectively, in both untreated and cisplatin-treated groups with mean ± SEM (n = 3 biologically independent samples). Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. The data are representative of three experiments with similar results. E, F DUSP16 protein expression in colorectal cancer cell DLD-1 and HCT116 (E) and in gastric cancer cell Ags and Nugc3 was evaluated by western blot analysis. The data are representative of 3 experiments with similar results. G, H Phospho-JNK (pJNK), phospho-P38 (pP38), phospho-ERK (pERK) and their total protein expression (tJNK, tP38, and tERK) in HK-1 (G), and C666-1 (H) cells upon cisplatin treatment was examined by western blot analysis. The data are representative of 3 experiments with similar results. Source data are provided as a Source data file.

    Journal: Nature communications

    Article Title: DUSP16 promotes cancer chemoresistance through regulation of mitochondria-mediated cell death.

    doi: 10.1038/s41467-021-22638-7

    Figure Lengend Snippet: Fig. 1 DUSP16 protein expression level is associated with cancer cell sensitivity to cisplatin. A, B Basal expression levels of DUSP16 in NPC cell lines were determined by quantitative real-time PCR (qPCR). Data were expressed as means ± standard error of the mean (mean ± SEM, n = 3 biologically independent samples). Two-tail unpaired t-test showed significantly higher DUSP16 expression in C666-1 and HK-1 cells compared to that in HONE-1 cells. *P < 0.05, **P < 0.001 (A). DUSP16 protein expression in these cells was determined by western blot analysis. The data are representative of two experiments with similar results (B). C Expression of DUSP16 in HK-1 and C666-1 in response to cisplatin treatment was determined by qPCR and western blot analysis. Induction of DUSP16 mRNA expression at each time point was expressed as means ± SEM (n = 3 biologically independent samples). Statistical analysis was performed using two-tailed unpaired t-test. *P < 0.05, **P < 0.001. D Flow cytometric analysis measuring apoptosis in HK-1 and C666-1 cell lines at 48 h after cisplatin treatment. Bar charts show the percentage of apoptotic (AnnexinV+7AAD+) and surviving (AnnexinV−7AAD−) cells, respectively, in both untreated and cisplatin-treated groups with mean ± SEM (n = 3 biologically independent samples). Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. The data are representative of three experiments with similar results. E, F DUSP16 protein expression in colorectal cancer cell DLD-1 and HCT116 (E) and in gastric cancer cell Ags and Nugc3 was evaluated by western blot analysis. The data are representative of 3 experiments with similar results. G, H Phospho-JNK (pJNK), phospho-P38 (pP38), phospho-ERK (pERK) and their total protein expression (tJNK, tP38, and tERK) in HK-1 (G), and C666-1 (H) cells upon cisplatin treatment was examined by western blot analysis. The data are representative of 3 experiments with similar results. Source data are provided as a Source data file.

    Article Snippet: Knockdown of DUSP16 in C666-1 cells was performed by transfection with DUSP16 CRISPR/Cas9 KO Plasmid (sc-405727, Santa Cruz) and DUSP16 HDR plasmid (sc-405727-HDR, Santa Cruz) with UltraCruz® Transfection Reagent (sc395739) according to the manufacturer’s instructions.

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Western Blot, Two Tailed Test

    Fig. 2 Overexpression of DUSP16 in various types of cancer cells results in increased resistance to cisplatin. A mRNA and protein levels of DUSP16 in HK-1 cells transfected with vector or human DUSP16 cDNA were quantified by qPCR and western blot analysis, respectively. Bar chart shows mRNA expression of vector (n = 2) and DUSP16 (n = 4) expressing clones. B, C Comparison of apoptosis induction between vector- and DUSP16-transfected cells after cisplatin treatment was carried out by staining the cells with AnnexinV and 7AAD followed by flow cytometry analysis (B). Bar charts show the percentage of apoptotic (both AnnexinV+7AAD+ and AnnexinV+7AAD−cells) and surviving cells, respectively, in both untreated and cisplatin-treated groups with mean ± SEM, n = 3 biologically independent samples (C). Statistical analysis was performed using two-tailed unpaired t-test. The data are representative of 3 experiments with similar results. D DUSP16 mRNA expression in DLD-1 cells transfected with vector (n = 6) or human DUSP16 cDNA (n = 6) quantified by qPCR. Statistical analysis was performed using two-tailed unpaired t-test. DUSP16 protein expression in these clones was assessed by Western blot. E, F Apoptosis induction between the vector- and DUSP16-transfected DLD-1 cells after cisplatin treatment was analyzed (E) and bar charts show the percentage of apoptotic and surviving cells in both untreated and cisplatin-treated groups with mean ± SEM, n = 3 biologically independent samples (F). Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. G DUSP16 mRNA and protein expression in Nugc3 cells transfected with vector or human DUSP16 cDNA was determined by qPCR and immunoblotting, respectively. Dot plot shows DUSP16 mRNA expression in vector (n = 3) and DUSP16 (n = 5) expressing clones. Statistical analysis was performed using two-tailed unpaired t-test. H, I Apoptosis induction between vector- and DUSP16-transfected Nugc3 cells after cisplatin treatment was analyzed and bar charts (I) show the percentage of apoptotic and surviving cells in untreated and cisplatin-treated cells, respectively, with mean ± SEM, n = 3 biologically independent samples. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. The data are representative of 3 experiments with similar results. Source data are provided as a Source data file.

    Journal: Nature communications

    Article Title: DUSP16 promotes cancer chemoresistance through regulation of mitochondria-mediated cell death.

    doi: 10.1038/s41467-021-22638-7

    Figure Lengend Snippet: Fig. 2 Overexpression of DUSP16 in various types of cancer cells results in increased resistance to cisplatin. A mRNA and protein levels of DUSP16 in HK-1 cells transfected with vector or human DUSP16 cDNA were quantified by qPCR and western blot analysis, respectively. Bar chart shows mRNA expression of vector (n = 2) and DUSP16 (n = 4) expressing clones. B, C Comparison of apoptosis induction between vector- and DUSP16-transfected cells after cisplatin treatment was carried out by staining the cells with AnnexinV and 7AAD followed by flow cytometry analysis (B). Bar charts show the percentage of apoptotic (both AnnexinV+7AAD+ and AnnexinV+7AAD−cells) and surviving cells, respectively, in both untreated and cisplatin-treated groups with mean ± SEM, n = 3 biologically independent samples (C). Statistical analysis was performed using two-tailed unpaired t-test. The data are representative of 3 experiments with similar results. D DUSP16 mRNA expression in DLD-1 cells transfected with vector (n = 6) or human DUSP16 cDNA (n = 6) quantified by qPCR. Statistical analysis was performed using two-tailed unpaired t-test. DUSP16 protein expression in these clones was assessed by Western blot. E, F Apoptosis induction between the vector- and DUSP16-transfected DLD-1 cells after cisplatin treatment was analyzed (E) and bar charts show the percentage of apoptotic and surviving cells in both untreated and cisplatin-treated groups with mean ± SEM, n = 3 biologically independent samples (F). Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. G DUSP16 mRNA and protein expression in Nugc3 cells transfected with vector or human DUSP16 cDNA was determined by qPCR and immunoblotting, respectively. Dot plot shows DUSP16 mRNA expression in vector (n = 3) and DUSP16 (n = 5) expressing clones. Statistical analysis was performed using two-tailed unpaired t-test. H, I Apoptosis induction between vector- and DUSP16-transfected Nugc3 cells after cisplatin treatment was analyzed and bar charts (I) show the percentage of apoptotic and surviving cells in untreated and cisplatin-treated cells, respectively, with mean ± SEM, n = 3 biologically independent samples. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. The data are representative of 3 experiments with similar results. Source data are provided as a Source data file.

    Article Snippet: Knockdown of DUSP16 in C666-1 cells was performed by transfection with DUSP16 CRISPR/Cas9 KO Plasmid (sc-405727, Santa Cruz) and DUSP16 HDR plasmid (sc-405727-HDR, Santa Cruz) with UltraCruz® Transfection Reagent (sc395739) according to the manufacturer’s instructions.

    Techniques: Over Expression, Transfection, Plasmid Preparation, Western Blot, Expressing, Clone Assay, Comparison, Staining, Cytometry, Two Tailed Test

    Fig. 3 Levels of DUSP16 in various types of cancer cells are associated with sensitivity to carboplatin and oxaliplatin. A Comparison of apoptosis induction between HK-1 and C666-1 cells in response to carboplatin treatment by flow cytometry analysis. Bar chart shows the percentage of apoptotic cells with mean values ± standard error of the mean (SEM), n = 3 biologically independent samples. The data are representative of three experiments with similar results. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. B Comparison of apoptosis induction between vector- and DUSP16-transfected HK-1 cells after oxaliplatin or carboplatin treatment by flow cytometry analysis. Bar chart shows the percentage of apoptotic cells (including both AnnexinV+7AAD+ and AnnexinV+7AAD−cells) with mean values ± SEM, n = 3 biologically independent samples. The data are representative of three experiments with similar results. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. C Comparison of apoptosis induction between HCT116 and DLD-1 cells in response to oxaliplatin treatment by flow cytometry analysis. Bar chart shows the percentage of apoptotic cells with mean values ± SEM, n = biologically independent samples. The data are representative of three experiments with similar results. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. D Comparison of apoptosis induction between vector- and DUSP16- transfected HCT116 cells after oxaliplatin or carboplatin treatment by flow cytometry analysis. Bar chart shows the percentage of apoptotic cells with mean values ± SEM, n = 3 biologically independent samples. The data are representative of three experiments with similar results. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. Source data are provided as a Source data file.

    Journal: Nature communications

    Article Title: DUSP16 promotes cancer chemoresistance through regulation of mitochondria-mediated cell death.

    doi: 10.1038/s41467-021-22638-7

    Figure Lengend Snippet: Fig. 3 Levels of DUSP16 in various types of cancer cells are associated with sensitivity to carboplatin and oxaliplatin. A Comparison of apoptosis induction between HK-1 and C666-1 cells in response to carboplatin treatment by flow cytometry analysis. Bar chart shows the percentage of apoptotic cells with mean values ± standard error of the mean (SEM), n = 3 biologically independent samples. The data are representative of three experiments with similar results. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. B Comparison of apoptosis induction between vector- and DUSP16-transfected HK-1 cells after oxaliplatin or carboplatin treatment by flow cytometry analysis. Bar chart shows the percentage of apoptotic cells (including both AnnexinV+7AAD+ and AnnexinV+7AAD−cells) with mean values ± SEM, n = 3 biologically independent samples. The data are representative of three experiments with similar results. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. C Comparison of apoptosis induction between HCT116 and DLD-1 cells in response to oxaliplatin treatment by flow cytometry analysis. Bar chart shows the percentage of apoptotic cells with mean values ± SEM, n = biologically independent samples. The data are representative of three experiments with similar results. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. D Comparison of apoptosis induction between vector- and DUSP16- transfected HCT116 cells after oxaliplatin or carboplatin treatment by flow cytometry analysis. Bar chart shows the percentage of apoptotic cells with mean values ± SEM, n = 3 biologically independent samples. The data are representative of three experiments with similar results. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. Source data are provided as a Source data file.

    Article Snippet: Knockdown of DUSP16 in C666-1 cells was performed by transfection with DUSP16 CRISPR/Cas9 KO Plasmid (sc-405727, Santa Cruz) and DUSP16 HDR plasmid (sc-405727-HDR, Santa Cruz) with UltraCruz® Transfection Reagent (sc395739) according to the manufacturer’s instructions.

    Techniques: Comparison, Cytometry, Two Tailed Test, Plasmid Preparation, Transfection

    Fig. 4 DUSP16 overexpression suppresses BAX-mediated intrinsic apoptotic pathway in various types of cancer cells in response to cisplatin. A–C Western blot analysis of p-MAPKs, total MAPKs, c-Myc, cleaved caspase 9 (C-C9), and cleaved caspase 3 (C-C3) was carried out on vector- and DUSP16- transfected HK-1 (A), DLD-1 (B), and Nugc3 (C) cells after cisplatin treatment. The data is representative of at least two experiments with similar results. D Western blot analysis of cisplatin-induced cytochrome c (Cyt c) release in cytosolic fractions of vector- and DUSP16-transfected HK-1 and DLD-1 cells. The data are representative of three experiments with similar results. E Scatterplots depicting changes in the mitochondrial membrane potential in vector- and DUSP16-transfected HK-1 cells upon cisplatin treatment. F Western blot analysis of BAX expression in mitochondrial and cytosolic fractions of vector- and DUSP16-transfected HK-1 and DLD-1 cells. The data are representative of three experiments with similar results. G Western blot analysis of BAX wild-type (WT) and knockout (KO) DLD-1 cell clones with or without DUSP16 overexpression. The data are representative of two experiments with similar results. H BAX WT and KO DLD-1 cells with or without DUSP16 overexpression were treated with cisplatin for 48 h to examine cell apoptosis by staining with AnnexinV+ and 7AAD+ followed by flow cytometry analysis. Bar chart shows the percentage of apoptotic cells with mean values ± SEM, n = 3 biologically independent samples. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. The data are representative of three experiments with similar results. Source data are provided as a Source data file.

    Journal: Nature communications

    Article Title: DUSP16 promotes cancer chemoresistance through regulation of mitochondria-mediated cell death.

    doi: 10.1038/s41467-021-22638-7

    Figure Lengend Snippet: Fig. 4 DUSP16 overexpression suppresses BAX-mediated intrinsic apoptotic pathway in various types of cancer cells in response to cisplatin. A–C Western blot analysis of p-MAPKs, total MAPKs, c-Myc, cleaved caspase 9 (C-C9), and cleaved caspase 3 (C-C3) was carried out on vector- and DUSP16- transfected HK-1 (A), DLD-1 (B), and Nugc3 (C) cells after cisplatin treatment. The data is representative of at least two experiments with similar results. D Western blot analysis of cisplatin-induced cytochrome c (Cyt c) release in cytosolic fractions of vector- and DUSP16-transfected HK-1 and DLD-1 cells. The data are representative of three experiments with similar results. E Scatterplots depicting changes in the mitochondrial membrane potential in vector- and DUSP16-transfected HK-1 cells upon cisplatin treatment. F Western blot analysis of BAX expression in mitochondrial and cytosolic fractions of vector- and DUSP16-transfected HK-1 and DLD-1 cells. The data are representative of three experiments with similar results. G Western blot analysis of BAX wild-type (WT) and knockout (KO) DLD-1 cell clones with or without DUSP16 overexpression. The data are representative of two experiments with similar results. H BAX WT and KO DLD-1 cells with or without DUSP16 overexpression were treated with cisplatin for 48 h to examine cell apoptosis by staining with AnnexinV+ and 7AAD+ followed by flow cytometry analysis. Bar chart shows the percentage of apoptotic cells with mean values ± SEM, n = 3 biologically independent samples. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001. The data are representative of three experiments with similar results. Source data are provided as a Source data file.

    Article Snippet: Knockdown of DUSP16 in C666-1 cells was performed by transfection with DUSP16 CRISPR/Cas9 KO Plasmid (sc-405727, Santa Cruz) and DUSP16 HDR plasmid (sc-405727-HDR, Santa Cruz) with UltraCruz® Transfection Reagent (sc395739) according to the manufacturer’s instructions.

    Techniques: Over Expression, Western Blot, Plasmid Preparation, Transfection, Membrane, Expressing, Knock-Out, Clone Assay, Staining, Cytometry, Two Tailed Test

    Fig. 5 Overexpression of DUSP16 resulted in increased resistance of cancer cells to cisplatin treatment in vivo. A Vector- or DUSP16-transfected HK-1 cells were inoculated into NSG mice. Cisplatin was injected at 3 mg/kg body weight every 3 days. After 20 days, tumors were harvested to measure the sizes and weights. The data are expressed as dots representing the weight of each tumor; the scale bars are the mean ± standard error of the mean (SEM) of tumor weights from six mice in each treatment group of the representative experiment (mean ± SEM, n = 6). Statistical analysis was performed using two-tailed unpaired t-test. B Growth of untreated and cisplatin-treated xenografts of vector- and DUSP16-transfected DLD-1 cells. Box-and-whisker plots show means ± SEM of tumor weights from four mice from each treatment group per experiment (mean ± SEM, n = 4). Boxes correspond to the 25th, 50th/ median and 75th percentiles; whiskers denote maximum and minimum. Statistical analysis was performed using two-tailed unpaired t-test. C, D IHC analysis for cleaved caspase 3 of HK-1 tumor sections; representative images of cleaved caspase 3 staining (n = 6) were shown (C). Boxed regions were magnified and presented under the respective panels. Black arrows highlight the caspase 3 staining. Box-and-whisker plots show means ± SEM of the means of cleaved caspase 3 staining in each group of mice (D). Boxes correspond to the 25th, 50th/median and 75th percentiles; whiskers denote maximum and minimum. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001 (mean ± SEM, n = 3). E, F IHC analysis for Ki67 of tumor sections. Representative images of Ki67 staining were shown (E). Boxed regions were magnified and presented under the respective panels. Black arrows highlighted the Ki67 staining. Box-and-whisker plots show means ± SEM of Ki67 staining (F) from each group of mice ***P < 0.0001 (mean ± SEM, n = 3). The data are representative of three experiments with similar results. Source data are provided as a Source data file.

    Journal: Nature communications

    Article Title: DUSP16 promotes cancer chemoresistance through regulation of mitochondria-mediated cell death.

    doi: 10.1038/s41467-021-22638-7

    Figure Lengend Snippet: Fig. 5 Overexpression of DUSP16 resulted in increased resistance of cancer cells to cisplatin treatment in vivo. A Vector- or DUSP16-transfected HK-1 cells were inoculated into NSG mice. Cisplatin was injected at 3 mg/kg body weight every 3 days. After 20 days, tumors were harvested to measure the sizes and weights. The data are expressed as dots representing the weight of each tumor; the scale bars are the mean ± standard error of the mean (SEM) of tumor weights from six mice in each treatment group of the representative experiment (mean ± SEM, n = 6). Statistical analysis was performed using two-tailed unpaired t-test. B Growth of untreated and cisplatin-treated xenografts of vector- and DUSP16-transfected DLD-1 cells. Box-and-whisker plots show means ± SEM of tumor weights from four mice from each treatment group per experiment (mean ± SEM, n = 4). Boxes correspond to the 25th, 50th/ median and 75th percentiles; whiskers denote maximum and minimum. Statistical analysis was performed using two-tailed unpaired t-test. C, D IHC analysis for cleaved caspase 3 of HK-1 tumor sections; representative images of cleaved caspase 3 staining (n = 6) were shown (C). Boxed regions were magnified and presented under the respective panels. Black arrows highlight the caspase 3 staining. Box-and-whisker plots show means ± SEM of the means of cleaved caspase 3 staining in each group of mice (D). Boxes correspond to the 25th, 50th/median and 75th percentiles; whiskers denote maximum and minimum. Statistical analysis was performed using two-tailed unpaired t-test. ***P < 0.0001 (mean ± SEM, n = 3). E, F IHC analysis for Ki67 of tumor sections. Representative images of Ki67 staining were shown (E). Boxed regions were magnified and presented under the respective panels. Black arrows highlighted the Ki67 staining. Box-and-whisker plots show means ± SEM of Ki67 staining (F) from each group of mice ***P < 0.0001 (mean ± SEM, n = 3). The data are representative of three experiments with similar results. Source data are provided as a Source data file.

    Article Snippet: Knockdown of DUSP16 in C666-1 cells was performed by transfection with DUSP16 CRISPR/Cas9 KO Plasmid (sc-405727, Santa Cruz) and DUSP16 HDR plasmid (sc-405727-HDR, Santa Cruz) with UltraCruz® Transfection Reagent (sc395739) according to the manufacturer’s instructions.

    Techniques: Over Expression, In Vivo, Plasmid Preparation, Transfection, Injection, Two Tailed Test, Whisker Assay, Staining

    Fig. 6 DUSP16 knockdown enhances apoptosis in C666-1 cells in response to cisplatin. C666-1 cells were transfected with DUSP16 CRISPR/Cas9 constructs to knockdown DUSP16 expression. A Bar chart shows the mRNA expression in vector and DUSP16 construct transfected cells with mean values ± SEM, n = 3 biologically independent samples. Statistical analysis was performed using two-tailed unpaired t-test. Protein levels of DUSP16 were quantified by immunoblotting. ***P < 0.0001. B Apoptosis of control and DUSP16 knockdown (KD) cells after cisplatin treatment was measured by AnnexinV/7AAD staining and flow cytometry. C Bar charts show the percentage of apoptotic and surviving (unstained) cells with mean values ± SEM, n = 3 biologically independent samples. Statistical analysis was performed using two-tailed unpaired t-test. The data are representative of three experiments with similar results. D Western blot analysis of the pJNK, pP38, pERK, their total protein levels, and c-Myc in control or DUSP16-KD C666-1 cells was carried out after cisplatin treatment. The data are representative of three experiments with similar results. Source data are provided as a Source data file.

    Journal: Nature communications

    Article Title: DUSP16 promotes cancer chemoresistance through regulation of mitochondria-mediated cell death.

    doi: 10.1038/s41467-021-22638-7

    Figure Lengend Snippet: Fig. 6 DUSP16 knockdown enhances apoptosis in C666-1 cells in response to cisplatin. C666-1 cells were transfected with DUSP16 CRISPR/Cas9 constructs to knockdown DUSP16 expression. A Bar chart shows the mRNA expression in vector and DUSP16 construct transfected cells with mean values ± SEM, n = 3 biologically independent samples. Statistical analysis was performed using two-tailed unpaired t-test. Protein levels of DUSP16 were quantified by immunoblotting. ***P < 0.0001. B Apoptosis of control and DUSP16 knockdown (KD) cells after cisplatin treatment was measured by AnnexinV/7AAD staining and flow cytometry. C Bar charts show the percentage of apoptotic and surviving (unstained) cells with mean values ± SEM, n = 3 biologically independent samples. Statistical analysis was performed using two-tailed unpaired t-test. The data are representative of three experiments with similar results. D Western blot analysis of the pJNK, pP38, pERK, their total protein levels, and c-Myc in control or DUSP16-KD C666-1 cells was carried out after cisplatin treatment. The data are representative of three experiments with similar results. Source data are provided as a Source data file.

    Article Snippet: Knockdown of DUSP16 in C666-1 cells was performed by transfection with DUSP16 CRISPR/Cas9 KO Plasmid (sc-405727, Santa Cruz) and DUSP16 HDR plasmid (sc-405727-HDR, Santa Cruz) with UltraCruz® Transfection Reagent (sc395739) according to the manufacturer’s instructions.

    Techniques: Knockdown, Transfection, CRISPR, Construct, Expressing, Plasmid Preparation, Two Tailed Test, Western Blot, Control, Staining, Cytometry

    Fig. 7 DUSP16 knockdown in C666-1 cells resulted in increased sensitivity to cisplatin in vivo and DUSP16 levels were inversely associated with head and neck squamous cell carcinoma (HNSCC) patient and breast cancer patient survival. A Mice were inoculated with control or DUSP16-KD cells. Cisplatin was injected at 3 mg/kg body weight every 3 days. After 20 days, tumors were harvested, and the sizes and weights were measured. The data are expressed as dots representing the weight of each tumor; the scale bars are the mean ± SEM of tumor weights from 4 (the vector control group) or 5 mice (the other groups) of the representative experiment. Statistical analysis was performed using two-tailed unpaired t-test. B Representative images of immunohistochemistry analysis for cleaved caspase 3 and Ki67 staining of tumor sections were shown. Boxed regions were magnified and presented under the respective panels. Black arrows highlight the caspase 3 and Ki67 staining, respectively. Box-and-whisker plots show mean values ± SEM of cleaved caspase 3 and Ki67 staining from each group of mice (n = 4). Boxes correspond to the 25th, 50th/median and 75th percentiles; whiskers denote maximum and minimum. Black scale bars = 200 μm, white scale bars = 50 μm. Statistical analysis was performed using two-tailed unpaired t-test. *P < 0.05. The data are representative of three experiments with similar results. C Representative images of HNSCC specimens (n = 50) showing negative (0 +), low (1 +), intermediate (2+), and high (3+) staining of DUSP16 in tumor cells. Black scale bars = 200 μm. D Patients with higher DUSP16 expression showed lower disease-free survival (DFS) compared to patients with low DUSP16 expression (log-rank test, two-sided, P = 0.042). E Representative images of breast cancer specimens (n = 113) showing negative (0 +), low (1 +), and high (3 +) staining of DUSP16 in tumor cells. Black scale bars = 200 μm. F Among the 113 breast cancer patients (age 28–64) treated with cisplatin, carboplatin, or lobaplatin after surgery, high DUSP16 protein expression in their tumors was associated with lower disease-free survival compared to patients with low DUSP16 expression (log-rank test, two-sided, P ˂ 0.0001). Source data are provided as a Source data file.

    Journal: Nature communications

    Article Title: DUSP16 promotes cancer chemoresistance through regulation of mitochondria-mediated cell death.

    doi: 10.1038/s41467-021-22638-7

    Figure Lengend Snippet: Fig. 7 DUSP16 knockdown in C666-1 cells resulted in increased sensitivity to cisplatin in vivo and DUSP16 levels were inversely associated with head and neck squamous cell carcinoma (HNSCC) patient and breast cancer patient survival. A Mice were inoculated with control or DUSP16-KD cells. Cisplatin was injected at 3 mg/kg body weight every 3 days. After 20 days, tumors were harvested, and the sizes and weights were measured. The data are expressed as dots representing the weight of each tumor; the scale bars are the mean ± SEM of tumor weights from 4 (the vector control group) or 5 mice (the other groups) of the representative experiment. Statistical analysis was performed using two-tailed unpaired t-test. B Representative images of immunohistochemistry analysis for cleaved caspase 3 and Ki67 staining of tumor sections were shown. Boxed regions were magnified and presented under the respective panels. Black arrows highlight the caspase 3 and Ki67 staining, respectively. Box-and-whisker plots show mean values ± SEM of cleaved caspase 3 and Ki67 staining from each group of mice (n = 4). Boxes correspond to the 25th, 50th/median and 75th percentiles; whiskers denote maximum and minimum. Black scale bars = 200 μm, white scale bars = 50 μm. Statistical analysis was performed using two-tailed unpaired t-test. *P < 0.05. The data are representative of three experiments with similar results. C Representative images of HNSCC specimens (n = 50) showing negative (0 +), low (1 +), intermediate (2+), and high (3+) staining of DUSP16 in tumor cells. Black scale bars = 200 μm. D Patients with higher DUSP16 expression showed lower disease-free survival (DFS) compared to patients with low DUSP16 expression (log-rank test, two-sided, P = 0.042). E Representative images of breast cancer specimens (n = 113) showing negative (0 +), low (1 +), and high (3 +) staining of DUSP16 in tumor cells. Black scale bars = 200 μm. F Among the 113 breast cancer patients (age 28–64) treated with cisplatin, carboplatin, or lobaplatin after surgery, high DUSP16 protein expression in their tumors was associated with lower disease-free survival compared to patients with low DUSP16 expression (log-rank test, two-sided, P ˂ 0.0001). Source data are provided as a Source data file.

    Article Snippet: Knockdown of DUSP16 in C666-1 cells was performed by transfection with DUSP16 CRISPR/Cas9 KO Plasmid (sc-405727, Santa Cruz) and DUSP16 HDR plasmid (sc-405727-HDR, Santa Cruz) with UltraCruz® Transfection Reagent (sc395739) according to the manufacturer’s instructions.

    Techniques: Knockdown, In Vivo, Control, Injection, Plasmid Preparation, Two Tailed Test, Immunohistochemistry, Staining, Whisker Assay, Expressing