cytof data normalizer (fluidigm)
fluidigm is a verified supplier 
fluidigm manufactures this product 
90
Structured Review
fluidigm
cytof data normalizer
Cytof Data Normalizer, supplied by fluidigm, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cytof+data+normalizer/cytof+data+normalizer/pmc06994188-125-0-4
Average 90 stars, based on 1 article reviews
Cytof Data Normalizer, supplied by fluidigm, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cytof+data+normalizer/cytof+data+normalizer/pmc06994188-125-0-4
Average 90 stars, based on 1 article reviews
cytof data normalizer - by Bioz Stars,
2026-09
90/100 stars
Images
1) Product Images from "T-bet+ Memory B Cells Link to Local Cross-Reactive IgG upon Human Rhinovirus Infection"
Article Title: T-bet+ Memory B Cells Link to Local Cross-Reactive IgG upon Human Rhinovirus Infection
Journal: Cell reports
doi: 10.1016/j.celrep.2019.12.027
Figure Legend Snippet:
Techniques Used: In Vitro, Blocking Assay, Multiplex Assay, Virus, Infection, Recombinant, Next-Generation Sequencing, RNA Sequencing, Software, Microscopy, Imaging, Conjugation Assay, Staining
Related Articles
Next-Generation Sequencing:Article Title: T-bet+ Memory B Cells Link to Local Cross-Reactive IgG upon Human Rhinovirus Infection Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Human IL-2 (Stimulation) Miltenyi Biotec Cat#130-097-742 Human IL-21 (Stimulation) Miltenyi Biotec Cat#130-094-563 IMDM ThermoFisher Cat#12-440-053 Insulin/transferrin/selenium ThermoFisher Cat#41400045 Liberase TM SigmaAldrich Cat#5401119001 MEM ThermoFisher Cat#11-090-073 Non-Essential Amino Acids ThermoFisher Cat# 11-140-050 Pluronic ThermoFisher Cat#24-040-032 RPMI-1640 ThermoFisher Cat#11875093 RV-A16 VP1 MedUni Wien Gift of R. Valenta S-MEM ThermoFisher Cat#11-380-037 Tetanus Toxin c-Terminal Fragment TechLab Gift of J. Herbein Critical Commercial Assays BCA Protein Quantification ThermoFisher Cat#23227 BCR Next-Generation Sequencing Illumina MiSeq Human BCR Single Cell mRNA Barcoding 10x Genomics Chromium Controller Deposited Data RNA seq data This paper NCBI SRA: PRJNA580187 Experimental Models: Cell Lines HeLa H1 Cells ATCC Cat#CRL-1958 Oligonucleotides Primer Pan RV FW: CCTCCGGCCCCTGAA Turner et al., 2017 N/A Primer Pan RV RV: AAACACGGACACCCAAAGTAG Turner et al., 2017 N/A Primer RV-A16 FW: CATGAATCAGTGTTGGATATT GTGGAC This paper N/A Primer RV-A16 RV: AATGTGACCATCTTTGGCTGCTAC This paper N/A Primer RV-A39 FW: CACATTTCCACAATTACTATGAAG AAGGAG This paper N/A Primer RV-A39 RV: ATCTTCACCTCTTCCAGCTATGCA This paper N/A Software and Algorithms Cell Ranger 10x Genomics https://support.10xgenomics.com ConsensusClusterPlus Wilkerson and Hayes, 2010 http://bioconductor.org/packages/release/ bioc/html/ConsensusClusterPlus.html Single Cell:Article Title: T-bet+ Memory B Cells Link to Local Cross-Reactive IgG upon Human Rhinovirus Infection Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Human IL-2 (Stimulation) Miltenyi Biotec Cat#130-097-742 Human IL-21 (Stimulation) Miltenyi Biotec Cat#130-094-563 IMDM ThermoFisher Cat#12-440-053 Insulin/transferrin/selenium ThermoFisher Cat#41400045 Liberase TM SigmaAldrich Cat#5401119001 MEM ThermoFisher Cat#11-090-073 Non-Essential Amino Acids ThermoFisher Cat# 11-140-050 Pluronic ThermoFisher Cat#24-040-032 RPMI-1640 ThermoFisher Cat#11875093 RV-A16 VP1 MedUni Wien Gift of R. Valenta S-MEM ThermoFisher Cat#11-380-037 Tetanus Toxin c-Terminal Fragment TechLab Gift of J. Herbein Critical Commercial Assays BCA Protein Quantification ThermoFisher Cat#23227 BCR Next-Generation Sequencing Illumina MiSeq Human BCR Single Cell mRNA Barcoding 10x Genomics Chromium Controller Deposited Data RNA seq data This paper NCBI SRA: PRJNA580187 Experimental Models: Cell Lines HeLa H1 Cells ATCC Cat#CRL-1958 Oligonucleotides Primer Pan RV FW: CCTCCGGCCCCTGAA Turner et al., 2017 N/A Primer Pan RV RV: AAACACGGACACCCAAAGTAG Turner et al., 2017 N/A Primer RV-A16 FW: CATGAATCAGTGTTGGATATT GTGGAC This paper N/A Primer RV-A16 RV: AATGTGACCATCTTTGGCTGCTAC This paper N/A Primer RV-A39 FW: CACATTTCCACAATTACTATGAAG AAGGAG This paper N/A Primer RV-A39 RV: ATCTTCACCTCTTCCAGCTATGCA This paper N/A Software and Algorithms Cell Ranger 10x Genomics https://support.10xgenomics.com ConsensusClusterPlus Wilkerson and Hayes, 2010 http://bioconductor.org/packages/release/ bioc/html/ConsensusClusterPlus.html RNA Sequencing:Article Title: T-bet+ Memory B Cells Link to Local Cross-Reactive IgG upon Human Rhinovirus Infection Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Human IL-2 (Stimulation) Miltenyi Biotec Cat#130-097-742 Human IL-21 (Stimulation) Miltenyi Biotec Cat#130-094-563 IMDM ThermoFisher Cat#12-440-053 Insulin/transferrin/selenium ThermoFisher Cat#41400045 Liberase TM SigmaAldrich Cat#5401119001 MEM ThermoFisher Cat#11-090-073 Non-Essential Amino Acids ThermoFisher Cat# 11-140-050 Pluronic ThermoFisher Cat#24-040-032 RPMI-1640 ThermoFisher Cat#11875093 RV-A16 VP1 MedUni Wien Gift of R. Valenta S-MEM ThermoFisher Cat#11-380-037 Tetanus Toxin c-Terminal Fragment TechLab Gift of J. Herbein Critical Commercial Assays BCA Protein Quantification ThermoFisher Cat#23227 BCR Next-Generation Sequencing Illumina MiSeq Human BCR Single Cell mRNA Barcoding 10x Genomics Chromium Controller Deposited Data RNA seq data This paper NCBI SRA: PRJNA580187 Experimental Models: Cell Lines HeLa H1 Cells ATCC Cat#CRL-1958 Oligonucleotides Primer Pan RV FW: CCTCCGGCCCCTGAA Turner et al., 2017 N/A Primer Pan RV RV: AAACACGGACACCCAAAGTAG Turner et al., 2017 N/A Primer RV-A16 FW: CATGAATCAGTGTTGGATATT GTGGAC This paper N/A Primer RV-A16 RV: AATGTGACCATCTTTGGCTGCTAC This paper N/A Primer RV-A39 FW: CACATTTCCACAATTACTATGAAG AAGGAG This paper N/A Primer RV-A39 RV: ATCTTCACCTCTTCCAGCTATGCA This paper N/A Software and Algorithms Cell Ranger 10x Genomics https://support.10xgenomics.com ConsensusClusterPlus Wilkerson and Hayes, 2010 http://bioconductor.org/packages/release/ bioc/html/ConsensusClusterPlus.html Software:Article Title: T-bet+ Memory B Cells Link to Local Cross-Reactive IgG upon Human Rhinovirus Infection Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Human IL-2 (Stimulation) Miltenyi Biotec Cat#130-097-742 Human IL-21 (Stimulation) Miltenyi Biotec Cat#130-094-563 IMDM ThermoFisher Cat#12-440-053 Insulin/transferrin/selenium ThermoFisher Cat#41400045 Liberase TM SigmaAldrich Cat#5401119001 MEM ThermoFisher Cat#11-090-073 Non-Essential Amino Acids ThermoFisher Cat# 11-140-050 Pluronic ThermoFisher Cat#24-040-032 RPMI-1640 ThermoFisher Cat#11875093 RV-A16 VP1 MedUni Wien Gift of R. Valenta S-MEM ThermoFisher Cat#11-380-037 Tetanus Toxin c-Terminal Fragment TechLab Gift of J. Herbein Critical Commercial Assays BCA Protein Quantification ThermoFisher Cat#23227 BCR Next-Generation Sequencing Illumina MiSeq Human BCR Single Cell mRNA Barcoding 10x Genomics Chromium Controller Deposited Data RNA seq data This paper NCBI SRA: PRJNA580187 Experimental Models: Cell Lines HeLa H1 Cells ATCC Cat#CRL-1958 Oligonucleotides Primer Pan RV FW: CCTCCGGCCCCTGAA Turner et al., 2017 N/A Primer Pan RV RV: AAACACGGACACCCAAAGTAG Turner et al., 2017 N/A Primer RV-A16 FW: CATGAATCAGTGTTGGATATT GTGGAC This paper N/A Primer RV-A16 RV: AATGTGACCATCTTTGGCTGCTAC This paper N/A Primer RV-A39 FW: CACATTTCCACAATTACTATGAAG AAGGAG This paper N/A Primer RV-A39 RV: ATCTTCACCTCTTCCAGCTATGCA This paper N/A Software and Algorithms Cell Ranger 10x Genomics https://support.10xgenomics.com ConsensusClusterPlus Wilkerson and Hayes, 2010 http://bioconductor.org/packages/release/ bioc/html/ConsensusClusterPlus.html Microscopy:Article Title: T-bet+ Memory B Cells Link to Local Cross-Reactive IgG upon Human Rhinovirus Infection Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Human IL-2 (Stimulation) Miltenyi Biotec Cat#130-097-742 Human IL-21 (Stimulation) Miltenyi Biotec Cat#130-094-563 IMDM ThermoFisher Cat#12-440-053 Insulin/transferrin/selenium ThermoFisher Cat#41400045 Liberase TM SigmaAldrich Cat#5401119001 MEM ThermoFisher Cat#11-090-073 Non-Essential Amino Acids ThermoFisher Cat# 11-140-050 Pluronic ThermoFisher Cat#24-040-032 RPMI-1640 ThermoFisher Cat#11875093 RV-A16 VP1 MedUni Wien Gift of R. Valenta S-MEM ThermoFisher Cat#11-380-037 Tetanus Toxin c-Terminal Fragment TechLab Gift of J. Herbein Critical Commercial Assays BCA Protein Quantification ThermoFisher Cat#23227 BCR Next-Generation Sequencing Illumina MiSeq Human BCR Single Cell mRNA Barcoding 10x Genomics Chromium Controller Deposited Data RNA seq data This paper NCBI SRA: PRJNA580187 Experimental Models: Cell Lines HeLa H1 Cells ATCC Cat#CRL-1958 Oligonucleotides Primer Pan RV FW: CCTCCGGCCCCTGAA Turner et al., 2017 N/A Primer Pan RV RV: AAACACGGACACCCAAAGTAG Turner et al., 2017 N/A Primer RV-A16 FW: CATGAATCAGTGTTGGATATT GTGGAC This paper N/A Primer RV-A16 RV: AATGTGACCATCTTTGGCTGCTAC This paper N/A Primer RV-A39 FW: CACATTTCCACAATTACTATGAAG AAGGAG This paper N/A Primer RV-A39 RV: ATCTTCACCTCTTCCAGCTATGCA This paper N/A Software and Algorithms Cell Ranger 10x Genomics https://support.10xgenomics.com ConsensusClusterPlus Wilkerson and Hayes, 2010 http://bioconductor.org/packages/release/ bioc/html/ConsensusClusterPlus.html Imaging:Article Title: T-bet+ Memory B Cells Link to Local Cross-Reactive IgG upon Human Rhinovirus Infection Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Human IL-2 (Stimulation) Miltenyi Biotec Cat#130-097-742 Human IL-21 (Stimulation) Miltenyi Biotec Cat#130-094-563 IMDM ThermoFisher Cat#12-440-053 Insulin/transferrin/selenium ThermoFisher Cat#41400045 Liberase TM SigmaAldrich Cat#5401119001 MEM ThermoFisher Cat#11-090-073 Non-Essential Amino Acids ThermoFisher Cat# 11-140-050 Pluronic ThermoFisher Cat#24-040-032 RPMI-1640 ThermoFisher Cat#11875093 RV-A16 VP1 MedUni Wien Gift of R. Valenta S-MEM ThermoFisher Cat#11-380-037 Tetanus Toxin c-Terminal Fragment TechLab Gift of J. Herbein Critical Commercial Assays BCA Protein Quantification ThermoFisher Cat#23227 BCR Next-Generation Sequencing Illumina MiSeq Human BCR Single Cell mRNA Barcoding 10x Genomics Chromium Controller Deposited Data RNA seq data This paper NCBI SRA: PRJNA580187 Experimental Models: Cell Lines HeLa H1 Cells ATCC Cat#CRL-1958 Oligonucleotides Primer Pan RV FW: CCTCCGGCCCCTGAA Turner et al., 2017 N/A Primer Pan RV RV: AAACACGGACACCCAAAGTAG Turner et al., 2017 N/A Primer RV-A16 FW: CATGAATCAGTGTTGGATATT GTGGAC This paper N/A Primer RV-A16 RV: AATGTGACCATCTTTGGCTGCTAC This paper N/A Primer RV-A39 FW: CACATTTCCACAATTACTATGAAG AAGGAG This paper N/A Primer RV-A39 RV: ATCTTCACCTCTTCCAGCTATGCA This paper N/A Software and Algorithms Cell Ranger 10x Genomics https://support.10xgenomics.com ConsensusClusterPlus Wilkerson and Hayes, 2010 http://bioconductor.org/packages/release/ bioc/html/ConsensusClusterPlus.html Conjugation Assay:Article Title: T-bet+ Memory B Cells Link to Local Cross-Reactive IgG upon Human Rhinovirus Infection Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Human IL-2 (Stimulation) Miltenyi Biotec Cat#130-097-742 Human IL-21 (Stimulation) Miltenyi Biotec Cat#130-094-563 IMDM ThermoFisher Cat#12-440-053 Insulin/transferrin/selenium ThermoFisher Cat#41400045 Liberase TM SigmaAldrich Cat#5401119001 MEM ThermoFisher Cat#11-090-073 Non-Essential Amino Acids ThermoFisher Cat# 11-140-050 Pluronic ThermoFisher Cat#24-040-032 RPMI-1640 ThermoFisher Cat#11875093 RV-A16 VP1 MedUni Wien Gift of R. Valenta S-MEM ThermoFisher Cat#11-380-037 Tetanus Toxin c-Terminal Fragment TechLab Gift of J. Herbein Critical Commercial Assays BCA Protein Quantification ThermoFisher Cat#23227 BCR Next-Generation Sequencing Illumina MiSeq Human BCR Single Cell mRNA Barcoding 10x Genomics Chromium Controller Deposited Data RNA seq data This paper NCBI SRA: PRJNA580187 Experimental Models: Cell Lines HeLa H1 Cells ATCC Cat#CRL-1958 Oligonucleotides Primer Pan RV FW: CCTCCGGCCCCTGAA Turner et al., 2017 N/A Primer Pan RV RV: AAACACGGACACCCAAAGTAG Turner et al., 2017 N/A Primer RV-A16 FW: CATGAATCAGTGTTGGATATT GTGGAC This paper N/A Primer RV-A16 RV: AATGTGACCATCTTTGGCTGCTAC This paper N/A Primer RV-A39 FW: CACATTTCCACAATTACTATGAAG AAGGAG This paper N/A Primer RV-A39 RV: ATCTTCACCTCTTCCAGCTATGCA This paper N/A Software and Algorithms Cell Ranger 10x Genomics https://support.10xgenomics.com ConsensusClusterPlus Wilkerson and Hayes, 2010 http://bioconductor.org/packages/release/ bioc/html/ConsensusClusterPlus.html Multiplex Assay:Article Title: T-bet+ Memory B Cells Link to Local Cross-Reactive IgG upon Human Rhinovirus Infection Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Human IL-2 (Stimulation) Miltenyi Biotec Cat#130-097-742 Human IL-21 (Stimulation) Miltenyi Biotec Cat#130-094-563 IMDM ThermoFisher Cat#12-440-053 Insulin/transferrin/selenium ThermoFisher Cat#41400045 Liberase TM SigmaAldrich Cat#5401119001 MEM ThermoFisher Cat#11-090-073 Non-Essential Amino Acids ThermoFisher Cat# 11-140-050 Pluronic ThermoFisher Cat#24-040-032 RPMI-1640 ThermoFisher Cat#11875093 RV-A16 VP1 MedUni Wien Gift of R. Valenta S-MEM ThermoFisher Cat#11-380-037 Tetanus Toxin c-Terminal Fragment TechLab Gift of J. Herbein Critical Commercial Assays BCA Protein Quantification ThermoFisher Cat#23227 BCR Next-Generation Sequencing Illumina MiSeq Human BCR Single Cell mRNA Barcoding 10x Genomics Chromium Controller Deposited Data RNA seq data This paper NCBI SRA: PRJNA580187 Experimental Models: Cell Lines HeLa H1 Cells ATCC Cat#CRL-1958 Oligonucleotides Primer Pan RV FW: CCTCCGGCCCCTGAA Turner et al., 2017 N/A Primer Pan RV RV: AAACACGGACACCCAAAGTAG Turner et al., 2017 N/A Primer RV-A16 FW: CATGAATCAGTGTTGGATATT GTGGAC This paper N/A Primer RV-A16 RV: AATGTGACCATCTTTGGCTGCTAC This paper N/A Primer RV-A39 FW: CACATTTCCACAATTACTATGAAG AAGGAG This paper N/A Primer RV-A39 RV: ATCTTCACCTCTTCCAGCTATGCA This paper N/A Software and Algorithms Cell Ranger 10x Genomics https://support.10xgenomics.com ConsensusClusterPlus Wilkerson and Hayes, 2010 http://bioconductor.org/packages/release/ bioc/html/ConsensusClusterPlus.html other:Article Title: T-bet+ Memory B Cells Link to Local Cross-Reactive IgG upon Human Rhinovirus Infection Article Snippet: |