Review




Structured Review

GenScript corporation csy4 dr
Csy4 Dr, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/csy4+dr/csy4+expression+cassette/pm40558493-52-28-76
Average 90 stars, based on 1 article reviews
csy4 dr - by Bioz Stars, 2026-09
90/100 stars

Images

Related Articles

Synthesized:

Article Title: 5' DREDGE: Direct Repeat-Enabled Downregulation of Gene Expression via the 5' UTR of Target Genes.
Article Snippet: .. The Csy4 DR was introduced into the 5′ UTR of the cathepsin D (CatD) gene (CTSD) in MEFs using a de novo synthesized targeting construct containing: (1) the Csy4 DR within exon 1 of CTSD; (2) a cassette expressing puromycin resistance (Puror) under the control of the PGK promoter within the first intron, flanked by FRT sites to permit its removal with Flp-recombinase; and (3) ~600 bp 5′ and 3′ homology arms (see Supplementary Figure S1B; GenScript USA, Piscataway, NJ, USA). .. For CRISPR-Cas, cells were transfected as above with a mixture comprising (1) recombinant Alt-R A.s. Cas12a (Cpf1) Ultra Nuclease; (2) two synthetic gRNAs (GGGAGUCUUCAUGGUCGCGG and ACCUGGAGUGCCGCGUGCUC); and (3) 0.5 μg of a PCR product amplified from the targeting construct generated using two oligonucleotides (Fwd, C*A*TTGCTACATTATGGAATGTGCATG; Rev, C*A*CCAAGACCTCATCTAGCAC; asterisks indicate the placement of phosphorothioate bonds that were incorporated to inhibit degradation) (IDT, San Diego, CA, USA).

Construct:

Article Title: 5' DREDGE: Direct Repeat-Enabled Downregulation of Gene Expression via the 5' UTR of Target Genes.
Article Snippet: .. The Csy4 DR was introduced into the 5′ UTR of the cathepsin D (CatD) gene (CTSD) in MEFs using a de novo synthesized targeting construct containing: (1) the Csy4 DR within exon 1 of CTSD; (2) a cassette expressing puromycin resistance (Puror) under the control of the PGK promoter within the first intron, flanked by FRT sites to permit its removal with Flp-recombinase; and (3) ~600 bp 5′ and 3′ homology arms (see Supplementary Figure S1B; GenScript USA, Piscataway, NJ, USA). .. For CRISPR-Cas, cells were transfected as above with a mixture comprising (1) recombinant Alt-R A.s. Cas12a (Cpf1) Ultra Nuclease; (2) two synthetic gRNAs (GGGAGUCUUCAUGGUCGCGG and ACCUGGAGUGCCGCGUGCUC); and (3) 0.5 μg of a PCR product amplified from the targeting construct generated using two oligonucleotides (Fwd, C*A*TTGCTACATTATGGAATGTGCATG; Rev, C*A*CCAAGACCTCATCTAGCAC; asterisks indicate the placement of phosphorothioate bonds that were incorporated to inhibit degradation) (IDT, San Diego, CA, USA).

Expressing:

Article Title: 5' DREDGE: Direct Repeat-Enabled Downregulation of Gene Expression via the 5' UTR of Target Genes.
Article Snippet: .. The Csy4 DR was introduced into the 5′ UTR of the cathepsin D (CatD) gene (CTSD) in MEFs using a de novo synthesized targeting construct containing: (1) the Csy4 DR within exon 1 of CTSD; (2) a cassette expressing puromycin resistance (Puror) under the control of the PGK promoter within the first intron, flanked by FRT sites to permit its removal with Flp-recombinase; and (3) ~600 bp 5′ and 3′ homology arms (see Supplementary Figure S1B; GenScript USA, Piscataway, NJ, USA). .. For CRISPR-Cas, cells were transfected as above with a mixture comprising (1) recombinant Alt-R A.s. Cas12a (Cpf1) Ultra Nuclease; (2) two synthetic gRNAs (GGGAGUCUUCAUGGUCGCGG and ACCUGGAGUGCCGCGUGCUC); and (3) 0.5 μg of a PCR product amplified from the targeting construct generated using two oligonucleotides (Fwd, C*A*TTGCTACATTATGGAATGTGCATG; Rev, C*A*CCAAGACCTCATCTAGCAC; asterisks indicate the placement of phosphorothioate bonds that were incorporated to inhibit degradation) (IDT, San Diego, CA, USA).

Control:

Article Title: 5' DREDGE: Direct Repeat-Enabled Downregulation of Gene Expression via the 5' UTR of Target Genes.
Article Snippet: .. The Csy4 DR was introduced into the 5′ UTR of the cathepsin D (CatD) gene (CTSD) in MEFs using a de novo synthesized targeting construct containing: (1) the Csy4 DR within exon 1 of CTSD; (2) a cassette expressing puromycin resistance (Puror) under the control of the PGK promoter within the first intron, flanked by FRT sites to permit its removal with Flp-recombinase; and (3) ~600 bp 5′ and 3′ homology arms (see Supplementary Figure S1B; GenScript USA, Piscataway, NJ, USA). .. For CRISPR-Cas, cells were transfected as above with a mixture comprising (1) recombinant Alt-R A.s. Cas12a (Cpf1) Ultra Nuclease; (2) two synthetic gRNAs (GGGAGUCUUCAUGGUCGCGG and ACCUGGAGUGCCGCGUGCUC); and (3) 0.5 μg of a PCR product amplified from the targeting construct generated using two oligonucleotides (Fwd, C*A*TTGCTACATTATGGAATGTGCATG; Rev, C*A*CCAAGACCTCATCTAGCAC; asterisks indicate the placement of phosphorothioate bonds that were incorporated to inhibit degradation) (IDT, San Diego, CA, USA).



Similar Products

90
GenScript corporation csy4 dr
Csy4 Dr, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/csy4+dr/csy4+expression+cassette/pm40558493-52-28-76
Average 90 stars, based on 1 article reviews
csy4 dr - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

96
Addgene inc csy4 direct repeats dr
a Quantitative PCR analysis of HBB transcription level in HEK293T cells transfected with type I–F PaeCascade 2-vector systems and crRNA targeting HBB . Left: schematic illustration of different type I–F PaeCascade VPR activators generated from 2-vector systems in Fig. . Gray: Csy1; red: Csy2; blue: Csy3; yellow: <t>Csy4;</t> orange flag: VPR. Different fusions of PaeCascade subunits resulted in different locations and copy numbers of VPR. HEK293T cells were transfected with PaeCascade 2-vector systems and crRNA vector. 48 h post-transfection, cells were lysed for RNA extraction and quantitative PCR assay. b Quantitative PCR analysis of gene transcription levels in HEK293T cells transfected with type I–F PaeCascade VPR (Csy3-VPR 2-vector system) targeting different regions upstream the transcriptional start site (TSS) of six genes ( HBB , HBG , SOX2, OCT4 , IL1B , and IL1R2 ). n.d.: not determined. c Histogram showing the normalized mean transcription activating levels of HBB , HBG , SOX2, OCT4 , IL1B , and IL1R2 induced by type I–F PaeCascade VPR (Csy3-VPR 2-vector system) transcription activator targeting different regions upstream of TSS. For normalization of data from different TSS among different genes, data in the same gene were processed by percentage normalization with 100% defined by the sum of all values in data set. The normalized values of all six genes were pooled and plotted as box & whiskers plot with min to max option. The median value is displayed as the center of the data set, and is derived using the lower and upper quartile values. The maximum and minimum values are displayed as whiskers. d The efficiency of target gene activation as a function of basal transcript levels. Data from ( b ) were plotted by fold changes comparing to negative control and relative basal transcript level of HBB, HBG, SOX2, OCT4, IL1B, and IL1R2 . Each dot represented the mean relative activation level of each crRNA from the three replications in ( b ). Ctrl: non-targeting crRNA control. Data in ( a , b ) represented three biological repeats and displayed as mean ± S.E.M. Statistical significance was calculated using one-way ANOVA (* P < 0.05; ** P < 0.01; *** P < 0.001). Source data are provided as a file.
Csy4 Direct Repeats Dr, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/csy4+dr/lentiGuide-Puro+(Plasmid+%2352963)/pmc07305327-298-8-20
Average 96 stars, based on 1 article reviews
csy4 direct repeats dr - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

Image Search Results


a Quantitative PCR analysis of HBB transcription level in HEK293T cells transfected with type I–F PaeCascade 2-vector systems and crRNA targeting HBB . Left: schematic illustration of different type I–F PaeCascade VPR activators generated from 2-vector systems in Fig. . Gray: Csy1; red: Csy2; blue: Csy3; yellow: Csy4; orange flag: VPR. Different fusions of PaeCascade subunits resulted in different locations and copy numbers of VPR. HEK293T cells were transfected with PaeCascade 2-vector systems and crRNA vector. 48 h post-transfection, cells were lysed for RNA extraction and quantitative PCR assay. b Quantitative PCR analysis of gene transcription levels in HEK293T cells transfected with type I–F PaeCascade VPR (Csy3-VPR 2-vector system) targeting different regions upstream the transcriptional start site (TSS) of six genes ( HBB , HBG , SOX2, OCT4 , IL1B , and IL1R2 ). n.d.: not determined. c Histogram showing the normalized mean transcription activating levels of HBB , HBG , SOX2, OCT4 , IL1B , and IL1R2 induced by type I–F PaeCascade VPR (Csy3-VPR 2-vector system) transcription activator targeting different regions upstream of TSS. For normalization of data from different TSS among different genes, data in the same gene were processed by percentage normalization with 100% defined by the sum of all values in data set. The normalized values of all six genes were pooled and plotted as box & whiskers plot with min to max option. The median value is displayed as the center of the data set, and is derived using the lower and upper quartile values. The maximum and minimum values are displayed as whiskers. d The efficiency of target gene activation as a function of basal transcript levels. Data from ( b ) were plotted by fold changes comparing to negative control and relative basal transcript level of HBB, HBG, SOX2, OCT4, IL1B, and IL1R2 . Each dot represented the mean relative activation level of each crRNA from the three replications in ( b ). Ctrl: non-targeting crRNA control. Data in ( a , b ) represented three biological repeats and displayed as mean ± S.E.M. Statistical significance was calculated using one-way ANOVA (* P < 0.05; ** P < 0.01; *** P < 0.001). Source data are provided as a file.

Journal: Nature Communications

Article Title: Repurposing type I–F CRISPR–Cas system as a transcriptional activation tool in human cells

doi: 10.1038/s41467-020-16880-8

Figure Lengend Snippet: a Quantitative PCR analysis of HBB transcription level in HEK293T cells transfected with type I–F PaeCascade 2-vector systems and crRNA targeting HBB . Left: schematic illustration of different type I–F PaeCascade VPR activators generated from 2-vector systems in Fig. . Gray: Csy1; red: Csy2; blue: Csy3; yellow: Csy4; orange flag: VPR. Different fusions of PaeCascade subunits resulted in different locations and copy numbers of VPR. HEK293T cells were transfected with PaeCascade 2-vector systems and crRNA vector. 48 h post-transfection, cells were lysed for RNA extraction and quantitative PCR assay. b Quantitative PCR analysis of gene transcription levels in HEK293T cells transfected with type I–F PaeCascade VPR (Csy3-VPR 2-vector system) targeting different regions upstream the transcriptional start site (TSS) of six genes ( HBB , HBG , SOX2, OCT4 , IL1B , and IL1R2 ). n.d.: not determined. c Histogram showing the normalized mean transcription activating levels of HBB , HBG , SOX2, OCT4 , IL1B , and IL1R2 induced by type I–F PaeCascade VPR (Csy3-VPR 2-vector system) transcription activator targeting different regions upstream of TSS. For normalization of data from different TSS among different genes, data in the same gene were processed by percentage normalization with 100% defined by the sum of all values in data set. The normalized values of all six genes were pooled and plotted as box & whiskers plot with min to max option. The median value is displayed as the center of the data set, and is derived using the lower and upper quartile values. The maximum and minimum values are displayed as whiskers. d The efficiency of target gene activation as a function of basal transcript levels. Data from ( b ) were plotted by fold changes comparing to negative control and relative basal transcript level of HBB, HBG, SOX2, OCT4, IL1B, and IL1R2 . Each dot represented the mean relative activation level of each crRNA from the three replications in ( b ). Ctrl: non-targeting crRNA control. Data in ( a , b ) represented three biological repeats and displayed as mean ± S.E.M. Statistical significance was calculated using one-way ANOVA (* P < 0.05; ** P < 0.01; *** P < 0.001). Source data are provided as a file.

Article Snippet: A site for spacer cloning flanked by two Csy4 direct repeats (DR) or Cas6f direct repeats was ligated into lentiGuide-Puro (addgene #52963) between BsmBI and EcoRI restriction sites to generate pLenti-crRNA-IF or pLenti-crRNA-IFv vectors.

Techniques: Real-time Polymerase Chain Reaction, Transfection, Plasmid Preparation, Generated, RNA Extraction, Derivative Assay, Activation Assay, Negative Control, Control

a Quantitative PCR analysis of HBB, HBG , and SOX2 transcription levels in HEK293T cells transfected with type I–F PaeCascade VPR (Csy3-VPR 2-vector system) with spacers in different lengths. Upper: schematic illustration of differences in Csy3 copy numbers in type I–F PaeCascade VPR (Csy3-VPR) with spacers in different lengths. Gray: Csy1; red: Csy2; blue: Csy3; yellow: Csy4; orange flag: VPR. The longer the spacer was, the more Csy3-VPR in type I–F PaeCascade. Lower: quantitative PCR analysis of HBB, HBG , and SOX2 transcription level in HEK293T cells cotransfected with type I–F PaeCascade VPR and crRNA targeting HBB, HBG , and SOX2 . 48 h post-transfection, cells were lysed for RNA extraction and quantitative PCR assay. b Quantitative PCR analysis of HBB , HBG , SOX2, OCT4 , IL1B , and IL1R2 transcription levels in HEK293T cells transfected with type I–F PaeCascade VPR (Csy3-VPR 2-vector system) and crRNAs targeting −100 bp (crRNA1) and −200 bp (crRNA2) upstream of TSS in Fig. . Upper: schematic illustration of enhancing transcription level by two crRNAs targeting the same gene. Lower: quantitative PCR analysis of HBB , HBG , SOX2, OCT4 , IL1B , and IL1R2 transcription levels in HEK293T cells. 2 crRNAs indicates two independent crRNA expression vectors. c Quantitative PCR analysis of HBG transcription level in HEK293T cells cotransfected with type I–F PaeCascade VPR (Csy3-VPR) and crRNA with different distances to crRNA2 (−200 bp upstream TSS in Fig. ). 48 h post-transfection, cells were lysed for RNA extraction and quantitative PCR assay. Ctrl: non-targeting crRNA control. Data represented three biological repeats and displayed as mean ± S.E.M. Statistical significance was calculated using one-way ANOVA (* P < 0.05; ** P < 0.01; *** P < 0.001). Source data are provided as a file.

Journal: Nature Communications

Article Title: Repurposing type I–F CRISPR–Cas system as a transcriptional activation tool in human cells

doi: 10.1038/s41467-020-16880-8

Figure Lengend Snippet: a Quantitative PCR analysis of HBB, HBG , and SOX2 transcription levels in HEK293T cells transfected with type I–F PaeCascade VPR (Csy3-VPR 2-vector system) with spacers in different lengths. Upper: schematic illustration of differences in Csy3 copy numbers in type I–F PaeCascade VPR (Csy3-VPR) with spacers in different lengths. Gray: Csy1; red: Csy2; blue: Csy3; yellow: Csy4; orange flag: VPR. The longer the spacer was, the more Csy3-VPR in type I–F PaeCascade. Lower: quantitative PCR analysis of HBB, HBG , and SOX2 transcription level in HEK293T cells cotransfected with type I–F PaeCascade VPR and crRNA targeting HBB, HBG , and SOX2 . 48 h post-transfection, cells were lysed for RNA extraction and quantitative PCR assay. b Quantitative PCR analysis of HBB , HBG , SOX2, OCT4 , IL1B , and IL1R2 transcription levels in HEK293T cells transfected with type I–F PaeCascade VPR (Csy3-VPR 2-vector system) and crRNAs targeting −100 bp (crRNA1) and −200 bp (crRNA2) upstream of TSS in Fig. . Upper: schematic illustration of enhancing transcription level by two crRNAs targeting the same gene. Lower: quantitative PCR analysis of HBB , HBG , SOX2, OCT4 , IL1B , and IL1R2 transcription levels in HEK293T cells. 2 crRNAs indicates two independent crRNA expression vectors. c Quantitative PCR analysis of HBG transcription level in HEK293T cells cotransfected with type I–F PaeCascade VPR (Csy3-VPR) and crRNA with different distances to crRNA2 (−200 bp upstream TSS in Fig. ). 48 h post-transfection, cells were lysed for RNA extraction and quantitative PCR assay. Ctrl: non-targeting crRNA control. Data represented three biological repeats and displayed as mean ± S.E.M. Statistical significance was calculated using one-way ANOVA (* P < 0.05; ** P < 0.01; *** P < 0.001). Source data are provided as a file.

Article Snippet: A site for spacer cloning flanked by two Csy4 direct repeats (DR) or Cas6f direct repeats was ligated into lentiGuide-Puro (addgene #52963) between BsmBI and EcoRI restriction sites to generate pLenti-crRNA-IF or pLenti-crRNA-IFv vectors.

Techniques: Real-time Polymerase Chain Reaction, Transfection, Plasmid Preparation, RNA Extraction, Expressing, Control

a Schematic illustrating pre-crRNA processed by Csy4 in human cells. Tandem spacer containing premature crRNA (DR-spacer1-DR-spacer2-DR) was transcribed and processed by Csy4 into two mature crRNAs. White box: human U6 promoter (hU6); Gray box: direct repeats (DR); Red box: spacer 1; Blue box: spacer 2. b Quantitative PCR analysis of HBB , HBG and SOX2 transcription levels in HEK293T cells transfected with type I–F PaeCascade VPR (Csy3-VPR) with two crRNA expression vectors (crRNA1 + crRNA2) or customized CRISPR arrays (CRISPR arrays 1/2) targeting −100 bp (crRNA1) and −200 bp (crRNA2) upstream of TSS in Fig. . Upper: schematic illustration of Csy4 processing customized CRISPR arrays targeting two sites on the same gene. Lower: quantitative PCR analysis of HBB , HBG , and SOX2 transcription level in HEK293T cells. HEK293T cells were transfected with PaeCascade 2-vector systems (Csy3-VPR) and crRNA expression vectors as indicated. 48 h post-transfection, cells were lysed for RNA extraction and quantitative PCR assay. c Quantitative PCR analysis of multiplex gene activation in HEK293T cells transfected with type I–F PaeCascade VPR (Csy3-VPR) with 2 or 3 independent crRNA vectors or customized CRISPR arrays (CRISPR array) targeting different genes. Upper: Schematic illustration of Csy4 processing customized CRISPR arrays targeting two sites on different genes. Lower: quantitative PCR analysis of multiplex activating level in HEK293T cells. HEK293T cells were transfected with PaeCascade 2-vector systems (Csy3-VPR) and crRNA expression vectors as indicated. 2 crRNAs indicates two independent crRNA expression vectors. 3 crRNAs indicates three independent crRNA expression vectors. CRISPR array, customized CRISPR array in one vector. 48 h post-transfection, cells were lysed for RNA extraction and quantitative PCR assay. Ctrl: non-targeting crRNA control. Data represented three biological repeats and displayed as mean ± S.E.M. Statistical significance was calculated using one-way ANOVA (* P < 0.05; ** P < 0.01; *** P < 0.001). Source data are provided as a file.

Journal: Nature Communications

Article Title: Repurposing type I–F CRISPR–Cas system as a transcriptional activation tool in human cells

doi: 10.1038/s41467-020-16880-8

Figure Lengend Snippet: a Schematic illustrating pre-crRNA processed by Csy4 in human cells. Tandem spacer containing premature crRNA (DR-spacer1-DR-spacer2-DR) was transcribed and processed by Csy4 into two mature crRNAs. White box: human U6 promoter (hU6); Gray box: direct repeats (DR); Red box: spacer 1; Blue box: spacer 2. b Quantitative PCR analysis of HBB , HBG and SOX2 transcription levels in HEK293T cells transfected with type I–F PaeCascade VPR (Csy3-VPR) with two crRNA expression vectors (crRNA1 + crRNA2) or customized CRISPR arrays (CRISPR arrays 1/2) targeting −100 bp (crRNA1) and −200 bp (crRNA2) upstream of TSS in Fig. . Upper: schematic illustration of Csy4 processing customized CRISPR arrays targeting two sites on the same gene. Lower: quantitative PCR analysis of HBB , HBG , and SOX2 transcription level in HEK293T cells. HEK293T cells were transfected with PaeCascade 2-vector systems (Csy3-VPR) and crRNA expression vectors as indicated. 48 h post-transfection, cells were lysed for RNA extraction and quantitative PCR assay. c Quantitative PCR analysis of multiplex gene activation in HEK293T cells transfected with type I–F PaeCascade VPR (Csy3-VPR) with 2 or 3 independent crRNA vectors or customized CRISPR arrays (CRISPR array) targeting different genes. Upper: Schematic illustration of Csy4 processing customized CRISPR arrays targeting two sites on different genes. Lower: quantitative PCR analysis of multiplex activating level in HEK293T cells. HEK293T cells were transfected with PaeCascade 2-vector systems (Csy3-VPR) and crRNA expression vectors as indicated. 2 crRNAs indicates two independent crRNA expression vectors. 3 crRNAs indicates three independent crRNA expression vectors. CRISPR array, customized CRISPR array in one vector. 48 h post-transfection, cells were lysed for RNA extraction and quantitative PCR assay. Ctrl: non-targeting crRNA control. Data represented three biological repeats and displayed as mean ± S.E.M. Statistical significance was calculated using one-way ANOVA (* P < 0.05; ** P < 0.01; *** P < 0.001). Source data are provided as a file.

Article Snippet: A site for spacer cloning flanked by two Csy4 direct repeats (DR) or Cas6f direct repeats was ligated into lentiGuide-Puro (addgene #52963) between BsmBI and EcoRI restriction sites to generate pLenti-crRNA-IF or pLenti-crRNA-IFv vectors.

Techniques: Real-time Polymerase Chain Reaction, Transfection, Expressing, CRISPR, Plasmid Preparation, RNA Extraction, Multiplex Assay, Activation Assay, Control

a Schematic illustration of crRNA variants containing 6-nt mismatches to the targeted site. There were five crRNA variants carrying 6-nt mismatches to the targeted DNA. Mismatched bases are highlighted in red and PAM is highlighted in green. Gray: Csy1; red: Csy2; blue: Csy3; yellow: Csy4. b Quantitative PCR analysis of HBB and HBG transcription levels in HEK293T cells transfected with type I–F PaeCascade VPR (Csy3-VPR) with full-length crRNA or 6-nt mismatched crRNA variants in ( a ). HEK293T cells were transfected with PaeCascade 2-vector systems (Csy3-VPR) and crRNA expression vectors. 48 h post-transfection, cells were lysed for RNA extraction and quantitative PCR assay. Ctrl: non-targeting crRNA control. c Schematic illustration of crRNA variants with single mismatches to the targeted site. There were 32 crRNA variants each carrying one single mismatch to the targeted DNA. Mismatched bases are highlighted in red and PAM is highlighted in green. d Quantitative PCR analysis of HBB and HBG transcription levels in HEK293T cells transfected with type I–F PaeCascade VPR (Csy3-VPR) with full-length crRNA or single nucleotide mismatched crRNA variants in ( c ). HEK293T cells were transfected with PaeCascade 2-vector systems (Csy3-VPR) and crRNA expression vectors. 48 h post-transfection, cells were lysed for RNA extraction and quantitative PCR assay. Ctrl: non-targeting crRNA control. Error bars represented three biological repeats and displayed as mean ± S.E.M. Statistical significance was calculated using one-way ANOVA (* P < 0.05; ** P < 0.01; *** P < 0.001). Source data are provided as a file.

Journal: Nature Communications

Article Title: Repurposing type I–F CRISPR–Cas system as a transcriptional activation tool in human cells

doi: 10.1038/s41467-020-16880-8

Figure Lengend Snippet: a Schematic illustration of crRNA variants containing 6-nt mismatches to the targeted site. There were five crRNA variants carrying 6-nt mismatches to the targeted DNA. Mismatched bases are highlighted in red and PAM is highlighted in green. Gray: Csy1; red: Csy2; blue: Csy3; yellow: Csy4. b Quantitative PCR analysis of HBB and HBG transcription levels in HEK293T cells transfected with type I–F PaeCascade VPR (Csy3-VPR) with full-length crRNA or 6-nt mismatched crRNA variants in ( a ). HEK293T cells were transfected with PaeCascade 2-vector systems (Csy3-VPR) and crRNA expression vectors. 48 h post-transfection, cells were lysed for RNA extraction and quantitative PCR assay. Ctrl: non-targeting crRNA control. c Schematic illustration of crRNA variants with single mismatches to the targeted site. There were 32 crRNA variants each carrying one single mismatch to the targeted DNA. Mismatched bases are highlighted in red and PAM is highlighted in green. d Quantitative PCR analysis of HBB and HBG transcription levels in HEK293T cells transfected with type I–F PaeCascade VPR (Csy3-VPR) with full-length crRNA or single nucleotide mismatched crRNA variants in ( c ). HEK293T cells were transfected with PaeCascade 2-vector systems (Csy3-VPR) and crRNA expression vectors. 48 h post-transfection, cells were lysed for RNA extraction and quantitative PCR assay. Ctrl: non-targeting crRNA control. Error bars represented three biological repeats and displayed as mean ± S.E.M. Statistical significance was calculated using one-way ANOVA (* P < 0.05; ** P < 0.01; *** P < 0.001). Source data are provided as a file.

Article Snippet: A site for spacer cloning flanked by two Csy4 direct repeats (DR) or Cas6f direct repeats was ligated into lentiGuide-Puro (addgene #52963) between BsmBI and EcoRI restriction sites to generate pLenti-crRNA-IF or pLenti-crRNA-IFv vectors.

Techniques: Real-time Polymerase Chain Reaction, Transfection, Plasmid Preparation, Expressing, RNA Extraction, Control