control shrna shctrl (Shanghai Genechem Ltd)
86
Structured Review
Shanghai Genechem Ltd
control shrna shctrl
Control Shrna Shctrl, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+shctrl/control+shctrl+shrna/pm42237319-151-13-22
Average 86 stars, based on 1 article reviews
Control Shrna Shctrl, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+shctrl/control+shctrl+shrna/pm42237319-151-13-22
Average 86 stars, based on 1 article reviews
control shrna shctrl - by Bioz Stars,
2026-09
86/100 stars
Images
Related Articles
shRNA:Article Title: Overexpression of CENPU promotes cancer growth and metastasis and is associated with poor survival in patients with nasopharyngeal carcinoma. Article Snippet: .. ShRNA targeting CENPU (shCENPU-1 and shCENPU-2) and a scrambled Article Title: RPF2 mediates the CARM1‑MYCN axis to promote chemotherapy resistance in colorectal cancer cells. Article Snippet: .. The sequences for RPF2 overexpression RNA (RPF2), knockdown RPF2 short hairpin (sh)RNA (shRPF2i) and Article Title: NAT10 inhibits the pyroptosis of laryngeal squamous cell carcinoma through ac4C modification of ELANE mRNA. Article Snippet: Non-carcinogenic normal human bronchial epithelial cell HNBEC (ATCC, Manassas, VA, USA) and human LSCC cell lines AMC-HN-8, TU686, and TU-177 (ATCC) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; ATCC) supplemented with 10% fetal bovine serum (FBS; ATCC), 100 U/mL penicillin and 100 mg/mL streptomycin at 37 °C and 5% CO2. .. Short hairpin (sh) RNA targeting NAT10 (shNAT10), Article Title: Integrated isothermal shift assay and multi-omics identify melittin as a novel EGFR-targeting peptide to suppress NSCLC. Article Snippet: .. EGFR-knockdown cell lines PC-9 cells were infected with lentiviral particles encoding either a Control:Article Title: Overexpression of CENPU promotes cancer growth and metastasis and is associated with poor survival in patients with nasopharyngeal carcinoma. Article Snippet: .. ShRNA targeting CENPU (shCENPU-1 and shCENPU-2) and a scrambled Article Title: Integrated isothermal shift assay and multi-omics identify melittin as a novel EGFR-targeting peptide to suppress NSCLC. Article Snippet: .. EGFR-knockdown cell lines PC-9 cells were infected with lentiviral particles encoding either a Article Title: Integrated single-cell and spatial transcriptomic profiling decodes lineage plasticity and immune microenvironment remodeling in prostate cancer progression Article Snippet: Specific siRNA sequences targeting the FOSL1 gene and control siRNA (siCtrl) were purchased from Sigma Aldrich. .. The FOSL1 siRNA sequences used were as follows: siFOSL1 - 1: 5ʹ - GCUCAUCGCAAGAGUAGCA - 3ʹ; siFOSL1 - 2: 5ʹ - ACTCATGGTGTTGATGCTTGG - 3ʹ; siFOSL1 - 3: 5ʹ - CTGTACCTTGTATCTCCCTT - 3ʹ; siCtrl: 5ʹ - CA TTCTCCGAACGTGTCACGT - 3ʹ (Human Non-Target 1). siRNA was transfected into PC-3 cell using jet-PRIME transfection reagent (Polyplus 101000046) according to the manufacturer's instructions.For lentivirus-mediated RNAi, lentivirus (shFOSL1) identical to the siFOSL1-3 sequence and Synthesized:Article Title: Overexpression of CENPU promotes cancer growth and metastasis and is associated with poor survival in patients with nasopharyngeal carcinoma. Article Snippet: .. ShRNA targeting CENPU (shCENPU-1 and shCENPU-2) and a scrambled Article Title: RPF2 mediates the CARM1‑MYCN axis to promote chemotherapy resistance in colorectal cancer cells. Article Snippet: .. The sequences for RPF2 overexpression RNA (RPF2), knockdown RPF2 short hairpin (sh)RNA (shRPF2i) and Over Expression:Article Title: RPF2 mediates the CARM1‑MYCN axis to promote chemotherapy resistance in colorectal cancer cells. Article Snippet: .. The sequences for RPF2 overexpression RNA (RPF2), knockdown RPF2 short hairpin (sh)RNA (shRPF2i) and Knockdown:Article Title: RPF2 mediates the CARM1‑MYCN axis to promote chemotherapy resistance in colorectal cancer cells. Article Snippet: .. The sequences for RPF2 overexpression RNA (RPF2), knockdown RPF2 short hairpin (sh)RNA (shRPF2i) and Negative Control:Article Title: RPF2 mediates the CARM1‑MYCN axis to promote chemotherapy resistance in colorectal cancer cells. Article Snippet: .. The sequences for RPF2 overexpression RNA (RPF2), knockdown RPF2 short hairpin (sh)RNA (shRPF2i) and Article Title: NAT10 inhibits the pyroptosis of laryngeal squamous cell carcinoma through ac4C modification of ELANE mRNA. Article Snippet: Non-carcinogenic normal human bronchial epithelial cell HNBEC (ATCC, Manassas, VA, USA) and human LSCC cell lines AMC-HN-8, TU686, and TU-177 (ATCC) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; ATCC) supplemented with 10% fetal bovine serum (FBS; ATCC), 100 U/mL penicillin and 100 mg/mL streptomycin at 37 °C and 5% CO2. .. Short hairpin (sh) RNA targeting NAT10 (shNAT10), other:Article Title: Atg7 senses ATP levels and regulates AKT 1 -PDCD4 phosphorylation-ubiquitination axis to promote survival during metabolic stress Article Snippet: For lentiviral production and infection, control shRNA (shCtrl) lentivirus, and Article Title: Overexpression of DDX49 in prostate cancer is associated with poor prognosis. Article Snippet: A Plasmid Preparation:Article Title: Inhibition of HIST1H2AB suppresses the proliferation of lung adenocarcinoma. Article Snippet: Department of Cardiothoracic Surgery, Shanghai East Hospital, Tongji University School of Medicine, Shanghai, China Research Center for Translational Medicine, Shanghai East Hospital, Tongji University School of Medicine, Shanghai, China Department of Dermatology, Shanghai East Hospital, Tongji University School of Medicine, Shanghai, China Department of Respiratory Medicine, Shanghai East Hospital, Tongji University School of Medicine, Shanghai, China Infection:Article Title: Integrated isothermal shift assay and multi-omics identify melittin as a novel EGFR-targeting peptide to suppress NSCLC. Article Snippet: .. EGFR-knockdown cell lines PC-9 cells were infected with lentiviral particles encoding either a Transfection:Article Title: Integrated single-cell and spatial transcriptomic profiling decodes lineage plasticity and immune microenvironment remodeling in prostate cancer progression Article Snippet: Specific siRNA sequences targeting the FOSL1 gene and control siRNA (siCtrl) were purchased from Sigma Aldrich. .. The FOSL1 siRNA sequences used were as follows: siFOSL1 - 1: 5ʹ - GCUCAUCGCAAGAGUAGCA - 3ʹ; siFOSL1 - 2: 5ʹ - ACTCATGGTGTTGATGCTTGG - 3ʹ; siFOSL1 - 3: 5ʹ - CTGTACCTTGTATCTCCCTT - 3ʹ; siCtrl: 5ʹ - CA TTCTCCGAACGTGTCACGT - 3ʹ (Human Non-Target 1). siRNA was transfected into PC-3 cell using jet-PRIME transfection reagent (Polyplus 101000046) according to the manufacturer's instructions.For lentivirus-mediated RNAi, lentivirus (shFOSL1) identical to the siFOSL1-3 sequence and Sequencing:Article Title: Integrated single-cell and spatial transcriptomic profiling decodes lineage plasticity and immune microenvironment remodeling in prostate cancer progression Article Snippet: Specific siRNA sequences targeting the FOSL1 gene and control siRNA (siCtrl) were purchased from Sigma Aldrich. .. The FOSL1 siRNA sequences used were as follows: siFOSL1 - 1: 5ʹ - GCUCAUCGCAAGAGUAGCA - 3ʹ; siFOSL1 - 2: 5ʹ - ACTCATGGTGTTGATGCTTGG - 3ʹ; siFOSL1 - 3: 5ʹ - CTGTACCTTGTATCTCCCTT - 3ʹ; siCtrl: 5ʹ - CA TTCTCCGAACGTGTCACGT - 3ʹ (Human Non-Target 1). siRNA was transfected into PC-3 cell using jet-PRIME transfection reagent (Polyplus 101000046) according to the manufacturer's instructions.For lentivirus-mediated RNAi, lentivirus (shFOSL1) identical to the siFOSL1-3 sequence and |
