Review




Structured Review

Shanghai Genechem Ltd control shrna shctrl
Control Shrna Shctrl, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+shctrl/control+shctrl+shrna/pm42237319-151-13-22
Average 86 stars, based on 1 article reviews
control shrna shctrl - by Bioz Stars, 2026-09
86/100 stars

Images

Related Articles

shRNA:

Article Title: Overexpression of CENPU promotes cancer growth and metastasis and is associated with poor survival in patients with nasopharyngeal carcinoma.
Article Snippet: .. ShRNA targeting CENPU (shCENPU-1 and shCENPU-2) and a scrambled control shRNA (shCtrl) were synthesized by Shanghai Genechem (Shanghai, China). ..

Article Title: RPF2 mediates the CARM1‑MYCN axis to promote chemotherapy resistance in colorectal cancer cells.
Article Snippet: .. The sequences for RPF2 overexpression RNA (RPF2), knockdown RPF2 short hairpin (sh)RNA (shRPF2i) and negative control shRNA (shCtrl) were synthesized by Shanghai GeneChem Co. ..

Article Title: NAT10 inhibits the pyroptosis of laryngeal squamous cell carcinoma through ac4C modification of ELANE mRNA.
Article Snippet: Non-carcinogenic normal human bronchial epithelial cell HNBEC (ATCC, Manassas, VA, USA) and human LSCC cell lines AMC-HN-8, TU686, and TU-177 (ATCC) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; ATCC) supplemented with 10% fetal bovine serum (FBS; ATCC), 100 U/mL penicillin and 100 mg/mL streptomycin at 37 °C and 5% CO2. .. Short hairpin (sh) RNA targeting NAT10 (shNAT10), shRNA negative control (shCtrl), shRNA targeting ELANE (shELANE), Lentivirus-mediated shNAT10, Lentivirus-mediated shELANE and Lentivirus-mediated shCtrl were purchased by Shanghai GeneChem. .. These plasmids were transfected into LSCC using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA).

Article Title: Integrated isothermal shift assay and multi-omics identify melittin as a novel EGFR-targeting peptide to suppress NSCLC.
Article Snippet: .. EGFR-knockdown cell lines PC-9 cells were infected with lentiviral particles encoding either a control shRNA (shCtrl) or one of three EGFR-targeting shRNAs (Shanghai Genechem Co., Ltd.). ..

Control:

Article Title: Overexpression of CENPU promotes cancer growth and metastasis and is associated with poor survival in patients with nasopharyngeal carcinoma.
Article Snippet: .. ShRNA targeting CENPU (shCENPU-1 and shCENPU-2) and a scrambled control shRNA (shCtrl) were synthesized by Shanghai Genechem (Shanghai, China). ..

Article Title: Integrated isothermal shift assay and multi-omics identify melittin as a novel EGFR-targeting peptide to suppress NSCLC.
Article Snippet: .. EGFR-knockdown cell lines PC-9 cells were infected with lentiviral particles encoding either a control shRNA (shCtrl) or one of three EGFR-targeting shRNAs (Shanghai Genechem Co., Ltd.). ..

Article Title: Integrated single-cell and spatial transcriptomic profiling decodes lineage plasticity and immune microenvironment remodeling in prostate cancer progression
Article Snippet: Specific siRNA sequences targeting the FOSL1 gene and control siRNA (siCtrl) were purchased from Sigma Aldrich. .. The FOSL1 siRNA sequences used were as follows: siFOSL1 - 1: 5ʹ - GCUCAUCGCAAGAGUAGCA - 3ʹ; siFOSL1 - 2: 5ʹ - ACTCATGGTGTTGATGCTTGG - 3ʹ; siFOSL1 - 3: 5ʹ - CTGTACCTTGTATCTCCCTT - 3ʹ; siCtrl: 5ʹ - CA TTCTCCGAACGTGTCACGT - 3ʹ (Human Non-Target 1). siRNA was transfected into PC-3 cell using jet-PRIME transfection reagent (Polyplus 101000046) according to the manufacturer's instructions.For lentivirus-mediated RNAi, lentivirus (shFOSL1) identical to the siFOSL1-3 sequence and control lentivirus (shCtrl) identical to the siCtrl sequence were custom-ordered from Shanghai GeneChem Co., Ltd. ..

Synthesized:

Article Title: Overexpression of CENPU promotes cancer growth and metastasis and is associated with poor survival in patients with nasopharyngeal carcinoma.
Article Snippet: .. ShRNA targeting CENPU (shCENPU-1 and shCENPU-2) and a scrambled control shRNA (shCtrl) were synthesized by Shanghai Genechem (Shanghai, China). ..

Article Title: RPF2 mediates the CARM1‑MYCN axis to promote chemotherapy resistance in colorectal cancer cells.
Article Snippet: .. The sequences for RPF2 overexpression RNA (RPF2), knockdown RPF2 short hairpin (sh)RNA (shRPF2i) and negative control shRNA (shCtrl) were synthesized by Shanghai GeneChem Co. ..

Over Expression:

Article Title: RPF2 mediates the CARM1‑MYCN axis to promote chemotherapy resistance in colorectal cancer cells.
Article Snippet: .. The sequences for RPF2 overexpression RNA (RPF2), knockdown RPF2 short hairpin (sh)RNA (shRPF2i) and negative control shRNA (shCtrl) were synthesized by Shanghai GeneChem Co. ..

Knockdown:

Article Title: RPF2 mediates the CARM1‑MYCN axis to promote chemotherapy resistance in colorectal cancer cells.
Article Snippet: .. The sequences for RPF2 overexpression RNA (RPF2), knockdown RPF2 short hairpin (sh)RNA (shRPF2i) and negative control shRNA (shCtrl) were synthesized by Shanghai GeneChem Co. ..

Negative Control:

Article Title: RPF2 mediates the CARM1‑MYCN axis to promote chemotherapy resistance in colorectal cancer cells.
Article Snippet: .. The sequences for RPF2 overexpression RNA (RPF2), knockdown RPF2 short hairpin (sh)RNA (shRPF2i) and negative control shRNA (shCtrl) were synthesized by Shanghai GeneChem Co. ..

Article Title: NAT10 inhibits the pyroptosis of laryngeal squamous cell carcinoma through ac4C modification of ELANE mRNA.
Article Snippet: Non-carcinogenic normal human bronchial epithelial cell HNBEC (ATCC, Manassas, VA, USA) and human LSCC cell lines AMC-HN-8, TU686, and TU-177 (ATCC) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; ATCC) supplemented with 10% fetal bovine serum (FBS; ATCC), 100 U/mL penicillin and 100 mg/mL streptomycin at 37 °C and 5% CO2. .. Short hairpin (sh) RNA targeting NAT10 (shNAT10), shRNA negative control (shCtrl), shRNA targeting ELANE (shELANE), Lentivirus-mediated shNAT10, Lentivirus-mediated shELANE and Lentivirus-mediated shCtrl were purchased by Shanghai GeneChem. .. These plasmids were transfected into LSCC using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA).

other:

Article Title: Atg7 senses ATP levels and regulates AKT 1 -PDCD4 phosphorylation-ubiquitination axis to promote survival during metabolic stress
Article Snippet: For lentiviral production and infection, control shRNA (shCtrl) lentivirus, and shRNA against PDCD4 (shPDCD4) were purchased from Shanghai GeneChem Company.

Article Title: Overexpression of DDX49 in prostate cancer is associated with poor prognosis.
Article Snippet: A nontargeting sequence was used for the lentivirus-negative control (shCtrl) (Shanghai Genechem Co. Ltd, Shanghai, China).

Plasmid Preparation:

Article Title: Inhibition of HIST1H2AB suppresses the proliferation of lung adenocarcinoma.
Article Snippet: Department of Cardiothoracic Surgery, Shanghai East Hospital, Tongji University School of Medicine, Shanghai, China Research Center for Translational Medicine, Shanghai East Hospital, Tongji University School of Medicine, Shanghai, China Department of Dermatology, Shanghai East Hospital, Tongji University School of Medicine, Shanghai, China Department of Respiratory Medicine, Shanghai East Hospital, Tongji University School of Medicine, Shanghai, China

Infection:

Article Title: Integrated isothermal shift assay and multi-omics identify melittin as a novel EGFR-targeting peptide to suppress NSCLC.
Article Snippet: .. EGFR-knockdown cell lines PC-9 cells were infected with lentiviral particles encoding either a control shRNA (shCtrl) or one of three EGFR-targeting shRNAs (Shanghai Genechem Co., Ltd.). ..

Transfection:

Article Title: Integrated single-cell and spatial transcriptomic profiling decodes lineage plasticity and immune microenvironment remodeling in prostate cancer progression
Article Snippet: Specific siRNA sequences targeting the FOSL1 gene and control siRNA (siCtrl) were purchased from Sigma Aldrich. .. The FOSL1 siRNA sequences used were as follows: siFOSL1 - 1: 5ʹ - GCUCAUCGCAAGAGUAGCA - 3ʹ; siFOSL1 - 2: 5ʹ - ACTCATGGTGTTGATGCTTGG - 3ʹ; siFOSL1 - 3: 5ʹ - CTGTACCTTGTATCTCCCTT - 3ʹ; siCtrl: 5ʹ - CA TTCTCCGAACGTGTCACGT - 3ʹ (Human Non-Target 1). siRNA was transfected into PC-3 cell using jet-PRIME transfection reagent (Polyplus 101000046) according to the manufacturer's instructions.For lentivirus-mediated RNAi, lentivirus (shFOSL1) identical to the siFOSL1-3 sequence and control lentivirus (shCtrl) identical to the siCtrl sequence were custom-ordered from Shanghai GeneChem Co., Ltd. ..

Sequencing:

Article Title: Integrated single-cell and spatial transcriptomic profiling decodes lineage plasticity and immune microenvironment remodeling in prostate cancer progression
Article Snippet: Specific siRNA sequences targeting the FOSL1 gene and control siRNA (siCtrl) were purchased from Sigma Aldrich. .. The FOSL1 siRNA sequences used were as follows: siFOSL1 - 1: 5ʹ - GCUCAUCGCAAGAGUAGCA - 3ʹ; siFOSL1 - 2: 5ʹ - ACTCATGGTGTTGATGCTTGG - 3ʹ; siFOSL1 - 3: 5ʹ - CTGTACCTTGTATCTCCCTT - 3ʹ; siCtrl: 5ʹ - CA TTCTCCGAACGTGTCACGT - 3ʹ (Human Non-Target 1). siRNA was transfected into PC-3 cell using jet-PRIME transfection reagent (Polyplus 101000046) according to the manufacturer's instructions.For lentivirus-mediated RNAi, lentivirus (shFOSL1) identical to the siFOSL1-3 sequence and control lentivirus (shCtrl) identical to the siCtrl sequence were custom-ordered from Shanghai GeneChem Co., Ltd. ..



Similar Products

86
Shanghai Genechem Ltd control shrna shctrl
Control Shrna Shctrl, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+shctrl/control+shctrl+shrna/pm42237319-151-13-22
Average 86 stars, based on 1 article reviews
control shrna shctrl - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Shanghai Genechem Ltd control lentivirus shctrl
Control Lentivirus Shctrl, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+shctrl/lentiviruses/pmc13049746-660-69-80
Average 86 stars, based on 1 article reviews
control lentivirus shctrl - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology nontargeted shctrl
Nontargeted Shctrl, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+shctrl/Control+shRNA+Plasmid-A/pm41671087-431-72-75
Average 96 stars, based on 1 article reviews
nontargeted shctrl - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
Addgene inc lentiviral vector plko 1 shrna control shctrl
Lentiviral Vector Plko 1 Shrna Control Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+shctrl/pLKO%2E1+-+TRC+control+(Plasmid+%2310879)/pm41596422-229-0-6
Average 96 stars, based on 1 article reviews
lentiviral vector plko 1 shrna control shctrl - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

86
Genechem control shctrl
<t>ASNS</t> enhanced H 2 O 2 ‐induced retinal cell proliferation and attenuated senescence. ARPE‐19 cells were transfected with shASNS or ASNS‐OE. (A) The mRNA expression of ASNS was detected by RT‐qPCR. (B) The protein expression of ASNS was detected by WB. ARPE‐19 cells were divided into H 2 O 2 + <t>shCtrl,</t> H 2 O 2 + shASNS or H 2 O 2 + NC, H 2 O 2 + ASNS‐OE groups. (C) CCK8 assay was utilized to assess cell viability in H 2 O 2 ‐treated ARPE‐19 cells. (D) SA‐β‐gal staining experiments were conducted in the above groups. (E) Measurement of intracellular ROS in the above groups. (F) The protein expression of P53, P21, P16 was detected by WB. (G) The level of GSH and MDA detected by ELISA. Data are presented as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.
Control Shctrl, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+shctrl/control+lentivirus+shctrl+shrna/pmc12648640-83-14-19
Average 86 stars, based on 1 article reviews
control shctrl - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Sangon Biotech control shctrl
<t>ASNS</t> enhanced H 2 O 2 ‐induced retinal cell proliferation and attenuated senescence. ARPE‐19 cells were transfected with shASNS or ASNS‐OE. (A) The mRNA expression of ASNS was detected by RT‐qPCR. (B) The protein expression of ASNS was detected by WB. ARPE‐19 cells were divided into H 2 O 2 + <t>shCtrl,</t> H 2 O 2 + shASNS or H 2 O 2 + NC, H 2 O 2 + ASNS‐OE groups. (C) CCK8 assay was utilized to assess cell viability in H 2 O 2 ‐treated ARPE‐19 cells. (D) SA‐β‐gal staining experiments were conducted in the above groups. (E) Measurement of intracellular ROS in the above groups. (F) The protein expression of P53, P21, P16 was detected by WB. (G) The level of GSH and MDA detected by ELISA. Data are presented as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.
Control Shctrl, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+shctrl/itga10+shrna/10__1016_slash_j__nantod__2025__102912-249-20-22
Average 86 stars, based on 1 article reviews
control shctrl - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

96
Addgene inc non targeting control shrna shctrl
<t>ASNS</t> enhanced H 2 O 2 ‐induced retinal cell proliferation and attenuated senescence. ARPE‐19 cells were transfected with shASNS or ASNS‐OE. (A) The mRNA expression of ASNS was detected by RT‐qPCR. (B) The protein expression of ASNS was detected by WB. ARPE‐19 cells were divided into H 2 O 2 + <t>shCtrl,</t> H 2 O 2 + shASNS or H 2 O 2 + NC, H 2 O 2 + ASNS‐OE groups. (C) CCK8 assay was utilized to assess cell viability in H 2 O 2 ‐treated ARPE‐19 cells. (D) SA‐β‐gal staining experiments were conducted in the above groups. (E) Measurement of intracellular ROS in the above groups. (F) The protein expression of P53, P21, P16 was detected by WB. (G) The level of GSH and MDA detected by ELISA. Data are presented as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.
Non Targeting Control Shrna Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+shctrl/shRNA+(Plasmid+%2355783)/pmc12518352-130-13-24
Average 96 stars, based on 1 article reviews
non targeting control shrna shctrl - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

86
Genechem control lentiviral particles shctrl
Exploration of potential downstream mechanism and upstream regulators of CCDC137. A Heatmap shows DEGs identified by RNA sequencing in <t>T24-shCtrl</t> and T24-shCCDC137-1 cells. B Bar plot displays GO and KEGG functional enrichment results of downregulated DEGs from RNA sequencing. C GSVA-Hallmark pathway enrichment analysis displayed differences between CCDC137 positive (CCDC137 +) and CCDC137 negative (CCDC137 −) cells based on single-cell sequencing data. D mRNA and protein expression of stearoyl-CoA desaturase (SCD) were detected by qRT-PCR and Western blot. E DecoupleR was used to analyze differences in transcription factor activity between CCDC137 + and CCDC137 − epithelial cells in single-cell sequencing data. F TF-Target Finder was employed to identify potential upstream transcription factors of CCDC137. * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, no statistical significance
Control Lentiviral Particles Shctrl, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+shctrl/lentiviral+particles/pmc12462137-114-6-13
Average 86 stars, based on 1 article reviews
control lentiviral particles shctrl - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology control shrna shctrl lentiviral particles
Exploration of potential downstream mechanism and upstream regulators of CCDC137. A Heatmap shows DEGs identified by RNA sequencing in <t>T24-shCtrl</t> and T24-shCCDC137-1 cells. B Bar plot displays GO and KEGG functional enrichment results of downregulated DEGs from RNA sequencing. C GSVA-Hallmark pathway enrichment analysis displayed differences between CCDC137 positive (CCDC137 +) and CCDC137 negative (CCDC137 −) cells based on single-cell sequencing data. D mRNA and protein expression of stearoyl-CoA desaturase (SCD) were detected by qRT-PCR and Western blot. E DecoupleR was used to analyze differences in transcription factor activity between CCDC137 + and CCDC137 − epithelial cells in single-cell sequencing data. F TF-Target Finder was employed to identify potential upstream transcription factors of CCDC137. * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, no statistical significance
Control Shrna Shctrl Lentiviral Particles, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+shctrl/Control+shRNA+Lentiviral+Particles-A/pm40339980-253-8-16
Average 96 stars, based on 1 article reviews
control shrna shctrl lentiviral particles - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

Image Search Results


ASNS enhanced H 2 O 2 ‐induced retinal cell proliferation and attenuated senescence. ARPE‐19 cells were transfected with shASNS or ASNS‐OE. (A) The mRNA expression of ASNS was detected by RT‐qPCR. (B) The protein expression of ASNS was detected by WB. ARPE‐19 cells were divided into H 2 O 2 + shCtrl, H 2 O 2 + shASNS or H 2 O 2 + NC, H 2 O 2 + ASNS‐OE groups. (C) CCK8 assay was utilized to assess cell viability in H 2 O 2 ‐treated ARPE‐19 cells. (D) SA‐β‐gal staining experiments were conducted in the above groups. (E) Measurement of intracellular ROS in the above groups. (F) The protein expression of P53, P21, P16 was detected by WB. (G) The level of GSH and MDA detected by ELISA. Data are presented as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Biofactors (Oxford, England)

Article Title: ASNS Regulates H 2 O 2 ‐Induced Senescence, Oxidative Stress, and Glucose Metabolism in ARPE ‐19 Cells by Modulating USP13 Expression

doi: 10.1002/biof.70057

Figure Lengend Snippet: ASNS enhanced H 2 O 2 ‐induced retinal cell proliferation and attenuated senescence. ARPE‐19 cells were transfected with shASNS or ASNS‐OE. (A) The mRNA expression of ASNS was detected by RT‐qPCR. (B) The protein expression of ASNS was detected by WB. ARPE‐19 cells were divided into H 2 O 2 + shCtrl, H 2 O 2 + shASNS or H 2 O 2 + NC, H 2 O 2 + ASNS‐OE groups. (C) CCK8 assay was utilized to assess cell viability in H 2 O 2 ‐treated ARPE‐19 cells. (D) SA‐β‐gal staining experiments were conducted in the above groups. (E) Measurement of intracellular ROS in the above groups. (F) The protein expression of P53, P21, P16 was detected by WB. (G) The level of GSH and MDA detected by ELISA. Data are presented as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: Lentiviral vectors interfering with ASNS and USP13 expression (shASNS and shUSP13) and the negative control shCtrl were synthesized by GeneChem (Shanghai, China).

Techniques: Transfection, Expressing, Quantitative RT-PCR, CCK-8 Assay, Staining, Enzyme-linked Immunosorbent Assay

ASNS regulated glucose metabolism pathways in H 2 O 2 ‐induced retinal cells. ARPE‐19 cells were divided into H 2 O 2 + shCtrl, H 2 O 2 + shASNS or H 2 O 2 + NC, H 2 O 2 + ASNS‐OE groups. (A) Detection of glucose uptake using a kit in H 2 O 2 ‐treated ARPE‐19 cells. (B) Detection of lactate production using a kit in H 2 O 2 ‐treated ARPE‐19 cells. (C) Measuring ECAR in H 2 O 2 ‐treated ARPE‐19 cells using the XF‐96 extracellular flux analyzer. (D) Measuring OCR in H 2 O 2 ‐treated ARPE‐19 cells using the XF‐96 extracellular flux analyzer. (E) The mRNA expression of Glut1, Glut4, HK2, and PGK1was detected by RT‐qPCR. (F) The protein expression of Glut1, Glut4, HK2, and PGK1was detected by WB. (G) The protein expression of HIF‐1α was detected by WB. Data are presented as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Biofactors (Oxford, England)

Article Title: ASNS Regulates H 2 O 2 ‐Induced Senescence, Oxidative Stress, and Glucose Metabolism in ARPE ‐19 Cells by Modulating USP13 Expression

doi: 10.1002/biof.70057

Figure Lengend Snippet: ASNS regulated glucose metabolism pathways in H 2 O 2 ‐induced retinal cells. ARPE‐19 cells were divided into H 2 O 2 + shCtrl, H 2 O 2 + shASNS or H 2 O 2 + NC, H 2 O 2 + ASNS‐OE groups. (A) Detection of glucose uptake using a kit in H 2 O 2 ‐treated ARPE‐19 cells. (B) Detection of lactate production using a kit in H 2 O 2 ‐treated ARPE‐19 cells. (C) Measuring ECAR in H 2 O 2 ‐treated ARPE‐19 cells using the XF‐96 extracellular flux analyzer. (D) Measuring OCR in H 2 O 2 ‐treated ARPE‐19 cells using the XF‐96 extracellular flux analyzer. (E) The mRNA expression of Glut1, Glut4, HK2, and PGK1was detected by RT‐qPCR. (F) The protein expression of Glut1, Glut4, HK2, and PGK1was detected by WB. (G) The protein expression of HIF‐1α was detected by WB. Data are presented as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: Lentiviral vectors interfering with ASNS and USP13 expression (shASNS and shUSP13) and the negative control shCtrl were synthesized by GeneChem (Shanghai, China).

Techniques: Expressing, Quantitative RT-PCR

Validation of ASNS's impact on the AMD disease process in vivo. Sprague–Dawley rats injected with sodium iodate (30 mg/kg body weight) and divided into MOCK group (No lentivirus injections, n = 10), shCtrl group (Injection of shCtrl lentivirus, n = 10), and shASNS (Injection of shASNS lentivirus, n = 10) group. (A) H&E staining analysis of rat retinal tissues in each group. (B) SA‐β‐gal staining of rat retinal tissues were conducted in the above groups. (C) Measuring ECAR and OCR in retinal tissues using the XF‐96 extracellular flux analyzer. (D) The mRNA expression of Glut1, Glut4, HK2, and PGK1 in retinal tissues was detected by RT‐qPCR. (E) The protein expression of Glut1, Glut4, HK2, and PGK1 in retinal tissues was detected by WB. (F) The protein expression of ASNS and USP13 in retinal tissues was detected by WB. (G) IF was used to analyze the expression of ASNS and USP1 in retinal tissues. (H) The protein expression of HIF‐1α in retinal tissues was detected by WB. Data are presented as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Biofactors (Oxford, England)

Article Title: ASNS Regulates H 2 O 2 ‐Induced Senescence, Oxidative Stress, and Glucose Metabolism in ARPE ‐19 Cells by Modulating USP13 Expression

doi: 10.1002/biof.70057

Figure Lengend Snippet: Validation of ASNS's impact on the AMD disease process in vivo. Sprague–Dawley rats injected with sodium iodate (30 mg/kg body weight) and divided into MOCK group (No lentivirus injections, n = 10), shCtrl group (Injection of shCtrl lentivirus, n = 10), and shASNS (Injection of shASNS lentivirus, n = 10) group. (A) H&E staining analysis of rat retinal tissues in each group. (B) SA‐β‐gal staining of rat retinal tissues were conducted in the above groups. (C) Measuring ECAR and OCR in retinal tissues using the XF‐96 extracellular flux analyzer. (D) The mRNA expression of Glut1, Glut4, HK2, and PGK1 in retinal tissues was detected by RT‐qPCR. (E) The protein expression of Glut1, Glut4, HK2, and PGK1 in retinal tissues was detected by WB. (F) The protein expression of ASNS and USP13 in retinal tissues was detected by WB. (G) IF was used to analyze the expression of ASNS and USP1 in retinal tissues. (H) The protein expression of HIF‐1α in retinal tissues was detected by WB. Data are presented as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: Lentiviral vectors interfering with ASNS and USP13 expression (shASNS and shUSP13) and the negative control shCtrl were synthesized by GeneChem (Shanghai, China).

Techniques: Biomarker Discovery, In Vivo, Injection, Staining, Expressing, Quantitative RT-PCR

Validation of USP13's impact on the AMD disease process in vivo. Sprague–Dawley rats injected with sodium iodate (30 mg/kg body weigh) and divided into MOCK group (No lentivirus injections, n = 10), shCtrl group (Injection of shCtrl lentivirus, n = 10), and shUSP13 (Injection of shUSP13 lentivirus, n = 10) group. (A) H&E staining analysis of rat retinal tissues in each group. (B) SA‐β‐gal staining of rat retinal tissues were conducted in the above groups. (C) Measuring ECAR and OCR in retinal tissues using the XF‐96 extracellular flux analyzer. (D) The mRNA expression of Glut1, Glut4, HK2, and PGK1 in retinal tissues was detected by RT‐qPCR. (E) The protein expression of Glut1, Glut4, HK2, and PGK1 in retinal tissues was detected by WB. (F) The protein expression of USP13 in retinal tissues was detected by WB. (G) The protein expression of HIF‐1α in retinal tissues was detected by WB. Data are presented as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Biofactors (Oxford, England)

Article Title: ASNS Regulates H 2 O 2 ‐Induced Senescence, Oxidative Stress, and Glucose Metabolism in ARPE ‐19 Cells by Modulating USP13 Expression

doi: 10.1002/biof.70057

Figure Lengend Snippet: Validation of USP13's impact on the AMD disease process in vivo. Sprague–Dawley rats injected with sodium iodate (30 mg/kg body weigh) and divided into MOCK group (No lentivirus injections, n = 10), shCtrl group (Injection of shCtrl lentivirus, n = 10), and shUSP13 (Injection of shUSP13 lentivirus, n = 10) group. (A) H&E staining analysis of rat retinal tissues in each group. (B) SA‐β‐gal staining of rat retinal tissues were conducted in the above groups. (C) Measuring ECAR and OCR in retinal tissues using the XF‐96 extracellular flux analyzer. (D) The mRNA expression of Glut1, Glut4, HK2, and PGK1 in retinal tissues was detected by RT‐qPCR. (E) The protein expression of Glut1, Glut4, HK2, and PGK1 in retinal tissues was detected by WB. (F) The protein expression of USP13 in retinal tissues was detected by WB. (G) The protein expression of HIF‐1α in retinal tissues was detected by WB. Data are presented as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: Lentiviral vectors interfering with ASNS and USP13 expression (shASNS and shUSP13) and the negative control shCtrl were synthesized by GeneChem (Shanghai, China).

Techniques: Biomarker Discovery, In Vivo, Injection, Staining, Expressing, Quantitative RT-PCR

Exploration of potential downstream mechanism and upstream regulators of CCDC137. A Heatmap shows DEGs identified by RNA sequencing in T24-shCtrl and T24-shCCDC137-1 cells. B Bar plot displays GO and KEGG functional enrichment results of downregulated DEGs from RNA sequencing. C GSVA-Hallmark pathway enrichment analysis displayed differences between CCDC137 positive (CCDC137 +) and CCDC137 negative (CCDC137 −) cells based on single-cell sequencing data. D mRNA and protein expression of stearoyl-CoA desaturase (SCD) were detected by qRT-PCR and Western blot. E DecoupleR was used to analyze differences in transcription factor activity between CCDC137 + and CCDC137 − epithelial cells in single-cell sequencing data. F TF-Target Finder was employed to identify potential upstream transcription factors of CCDC137. * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, no statistical significance

Journal: Journal of Translational Medicine

Article Title: CCDC137 knockdown suppresses bladder cancer progression by downregulating SCD

doi: 10.1186/s12967-025-07033-w

Figure Lengend Snippet: Exploration of potential downstream mechanism and upstream regulators of CCDC137. A Heatmap shows DEGs identified by RNA sequencing in T24-shCtrl and T24-shCCDC137-1 cells. B Bar plot displays GO and KEGG functional enrichment results of downregulated DEGs from RNA sequencing. C GSVA-Hallmark pathway enrichment analysis displayed differences between CCDC137 positive (CCDC137 +) and CCDC137 negative (CCDC137 −) cells based on single-cell sequencing data. D mRNA and protein expression of stearoyl-CoA desaturase (SCD) were detected by qRT-PCR and Western blot. E DecoupleR was used to analyze differences in transcription factor activity between CCDC137 + and CCDC137 − epithelial cells in single-cell sequencing data. F TF-Target Finder was employed to identify potential upstream transcription factors of CCDC137. * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, no statistical significance

Article Snippet: The shCCDC137 lentiviral particles and corresponding control lentiviral particles (shCtrl) were purchased from Genechem Co., Ltd (Shanghai, China).

Techniques: RNA Sequencing, Functional Assay, Sequencing, Expressing, Quantitative RT-PCR, Western Blot, Activity Assay

In vivo validation of CCDC137 regulating tumor growth. A Subcutaneous xenograft models were established in nude mice to validate the regulatory role of CCDC137 in tumor growth. B Tumor volume growth curves were plotted over 28 days after tumor cell inoculation. C Tumor weights of T24-shCtrl and T24-shCCDC137-1 groups were measured on day 28. D The Graphical Abstract described the key results in this study. * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, no statistical significance

Journal: Journal of Translational Medicine

Article Title: CCDC137 knockdown suppresses bladder cancer progression by downregulating SCD

doi: 10.1186/s12967-025-07033-w

Figure Lengend Snippet: In vivo validation of CCDC137 regulating tumor growth. A Subcutaneous xenograft models were established in nude mice to validate the regulatory role of CCDC137 in tumor growth. B Tumor volume growth curves were plotted over 28 days after tumor cell inoculation. C Tumor weights of T24-shCtrl and T24-shCCDC137-1 groups were measured on day 28. D The Graphical Abstract described the key results in this study. * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; ns, no statistical significance

Article Snippet: The shCCDC137 lentiviral particles and corresponding control lentiviral particles (shCtrl) were purchased from Genechem Co., Ltd (Shanghai, China).

Techniques: In Vivo, Biomarker Discovery