Review



iscript1tm cdna synthesis kit  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier
Bioz Manufacturer Symbol Bio-Rad manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Bio-Rad iscript1tm cdna synthesis kit
    Iscript1tm Cdna Synthesis Kit, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 49631 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cdna+synthesis+kit/iScript+cDNA+Synthesis+Kit/pmc12993172-136-9-13
    Average 99 stars, based on 49631 article reviews
    iscript1tm cdna synthesis kit - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    cDNA Synthesis:

    Article Title: Early-Life Iron Overload Disrupts Dopaminergic Neuron Function and Neurobehaviour in Zebrafish.
    Article Snippet: .. Total RNA from Jo ur na l P re -p ro of the head tissue was extracted using the Monarch Total RNA Miniprep Kit (New England BioLabs), according to the manufacturer’s protocol. iScriptTM cDNA Synthesis Kit (Bio-Rad) was used to prepare cDNA libraries from 1 μg of the larvae RNA samples. cDNA was diluted at a 1:20 ratio for ddPCR analysis (QX200TMddPCRTM EvaGreen® supermix, Bio-Rad) of DAergic related genes (th1, comta, comtb), iron storage/transport genes (fth1a, fth1b, slc40a1, tfr1a, slc11a2), and oxidative stress responsive genes (gpx4a, gstp1.2, sod1, sod2, cat, nrf2); and at a 1:2000 ratio for 2 house-keeping genes, rpl13a and rps18. ..

    Article Title: Cell penetrating peptides
    Article Snippet: PMO was purchased from Gene Tools Inc. (Philomath, USA). .. Fetal bovine serum, mouse serum and Superscript III Platinum One-Step qRT-PCR Kit and Platinum PCR SuperMix High Fidelity were obtained from Thermofisher Scientific (Waltham, US). iScript cDNA Synthesis Kit was obtained from Biorad (Hercules US). ..

    Article Title: Collagen hydrolysate comprising GPCR ligand peptide
    Article Snippet: .. To measure mRNA expression levels, Caco-2 cells were harvested, mRNA was extracted and purified using an RNA extraction kit (RNeasy mini kit, QIAGEN, U.S.A.), and cDNA was synthesized using a cDNA synthesis kit (iScriptTM cDNA Synthesis Kit, BIO-RAD, U.S.A.), and real-time PCR was performed using target primers for each gene. ..

    Article Title: PCSK9-mediated degradation of cell-surface LDL receptors impairs human CD8+ T cell effector functions
    Article Snippet: RNeasy mini kit , Qiagen , 74104. .. cDNA Synthesis Kit , Bio-rad , 1708890. .. eBioscienceTM Foxp3 / Transcription Factor Staining Buffer Set , eBioscience , 00-5523-00.

    Article Title: Deoxycholic acid (DCA) alleviates LPS-induced inflammatory bone loss via modulating the "Gut-Bone" homeostasis.
    Article Snippet: RT-PCR master mix was purchased from Promega (USA). .. The cDNA synthesis kit (1708890- Bio-Rad), gene-specific primers (CTSK-TATGACCACTGCCTTCCAATAC), c-Fos (GACCATCTCCGAAATCCTACAC), TGR5 (AAGAGCCAAGAGGGACAATC), FXR (GGGCAGAATCTGG ATTTGGA), NFATc1 (CCGTCCAAGTCAGTTTCTATGT), tartrateresistant acid phosphatase (TRAP) (CACTTTGCACTACAAGACGG), RANKL (GGAAGCGTACCTACAGACTATC), RUNX2 (GCTTCTCAGCTTTAGCGTC), Osteoprotegerin (OPG) (CTTGCCCTGACCACTCTTATAC), osteocalcin (CCAAGCAGGAGGGCAATAA) Alizarin Red S (A5533, Sigma, USA), and the ALP staining kit (NBT/BCIP, 34042, Thermo, USA). .. Antibodies were purchased from multiple suppliers: GAPDH (2118S), Cathepsin K (57056S), c-Fos (2250S), NFATc1 (4389S), Runx2 (12556S), and FXR (72105S), HRP-conjugated anti-mouse (58802S) and anti-rabbit (7074) secondary antibodies from Cell Signalling Technology (USA), and the TGR5 antibody (PA5–23182) from Thermo Fisher Scientific (Invitrogen, USA).

    Article Title: Integrating Network Pharmacology, Molecular Docking, Molecular Dynamics Simulation, and Experimental Validation to Elucidate the Efficacy and Mechanism of Wanbi Hantong Yin in Rheumatoid Arthritis.
    Article Snippet: Background: Wanbi Hantong Yin (WHY), a traditional Chinese medicine (TCM) formulation, has demonstrated therapeutic efficacy in rheumatoid arthritis (RA).. However, its underlying molecular mechanisms remain largely unclear.. This study combined bioinformatics analyses, including network pharmacology, molecular docking, and molecular dynamics (MD) simulation, with in vivo validation to elucidate the pharmacological mechanisms of WHY in the treatment of RA.

    Article Title: Metabolomic changes associated with behavioral and molecular findings: Triclocarban toxicity in the zebrafish model.
    Article Snippet: Background and aim: Triclocarban (TCC), an antimicrobial agent used in personal care products, has been widely detected in aquatic ecosystems and has raised significant concerns for aquatic organisms and human health.. This study aimed to investigate the neurotoxic effects of TCC exposure, a broad-spectrum bactericide, through behavioral, molecular, pathological, and metabolomic analyses.. Methods: For this purpose, adult zebrafish were exposed to TCC at doses of 3, 10, and 30 μg/L for 96 h, and their brain tissues were removed.

    Article Title: Strategic engineering of imidazopyridine-benzoxazole hybrids targeting microtubule dynamics: comprehensive inhibition of the metastatic cascade.
    Article Snippet: A series of twenty novel imidazopyridine–benzoxazole hybrid (Imp1–20) derivatives was designed and synthesized, and their antiproliferative activities were evaluated against MDA-MB-231 breast and DLD-1 colorectal cancer cell lines.. Among them, Imp-18 and Imp-20 emerged as the most potent candidates, with low micromolar to nanomolar IC50 values and significant reductions in cancer cell adhesion and colony formation.. Flow cytometry analyses demonstrated that both compounds induced apoptosis and promoted cell-cycle arrest, reflected by Sub-G1 accumulation and perturbations in G1/G0 and G2/M phases.

    Quantitative RT-PCR:

    Article Title: Cell penetrating peptides
    Article Snippet: PMO was purchased from Gene Tools Inc. (Philomath, USA). .. Fetal bovine serum, mouse serum and Superscript III Platinum One-Step qRT-PCR Kit and Platinum PCR SuperMix High Fidelity were obtained from Thermofisher Scientific (Waltham, US). iScript cDNA Synthesis Kit was obtained from Biorad (Hercules US). ..

    Polymerase Chain Reaction:

    Article Title: Cell penetrating peptides
    Article Snippet: PMO was purchased from Gene Tools Inc. (Philomath, USA). .. Fetal bovine serum, mouse serum and Superscript III Platinum One-Step qRT-PCR Kit and Platinum PCR SuperMix High Fidelity were obtained from Thermofisher Scientific (Waltham, US). iScript cDNA Synthesis Kit was obtained from Biorad (Hercules US). ..

    Expressing:

    Article Title: Collagen hydrolysate comprising GPCR ligand peptide
    Article Snippet: .. To measure mRNA expression levels, Caco-2 cells were harvested, mRNA was extracted and purified using an RNA extraction kit (RNeasy mini kit, QIAGEN, U.S.A.), and cDNA was synthesized using a cDNA synthesis kit (iScriptTM cDNA Synthesis Kit, BIO-RAD, U.S.A.), and real-time PCR was performed using target primers for each gene. ..

    Purification:

    Article Title: Collagen hydrolysate comprising GPCR ligand peptide
    Article Snippet: .. To measure mRNA expression levels, Caco-2 cells were harvested, mRNA was extracted and purified using an RNA extraction kit (RNeasy mini kit, QIAGEN, U.S.A.), and cDNA was synthesized using a cDNA synthesis kit (iScriptTM cDNA Synthesis Kit, BIO-RAD, U.S.A.), and real-time PCR was performed using target primers for each gene. ..

    RNA Extraction:

    Article Title: Collagen hydrolysate comprising GPCR ligand peptide
    Article Snippet: .. To measure mRNA expression levels, Caco-2 cells were harvested, mRNA was extracted and purified using an RNA extraction kit (RNeasy mini kit, QIAGEN, U.S.A.), and cDNA was synthesized using a cDNA synthesis kit (iScriptTM cDNA Synthesis Kit, BIO-RAD, U.S.A.), and real-time PCR was performed using target primers for each gene. ..

    Synthesized:

    Article Title: Collagen hydrolysate comprising GPCR ligand peptide
    Article Snippet: .. To measure mRNA expression levels, Caco-2 cells were harvested, mRNA was extracted and purified using an RNA extraction kit (RNeasy mini kit, QIAGEN, U.S.A.), and cDNA was synthesized using a cDNA synthesis kit (iScriptTM cDNA Synthesis Kit, BIO-RAD, U.S.A.), and real-time PCR was performed using target primers for each gene. ..

    Real-time Polymerase Chain Reaction:

    Article Title: Collagen hydrolysate comprising GPCR ligand peptide
    Article Snippet: .. To measure mRNA expression levels, Caco-2 cells were harvested, mRNA was extracted and purified using an RNA extraction kit (RNeasy mini kit, QIAGEN, U.S.A.), and cDNA was synthesized using a cDNA synthesis kit (iScriptTM cDNA Synthesis Kit, BIO-RAD, U.S.A.), and real-time PCR was performed using target primers for each gene. ..

    Staining:

    Article Title: Deoxycholic acid (DCA) alleviates LPS-induced inflammatory bone loss via modulating the "Gut-Bone" homeostasis.
    Article Snippet: RT-PCR master mix was purchased from Promega (USA). .. The cDNA synthesis kit (1708890- Bio-Rad), gene-specific primers (CTSK-TATGACCACTGCCTTCCAATAC), c-Fos (GACCATCTCCGAAATCCTACAC), TGR5 (AAGAGCCAAGAGGGACAATC), FXR (GGGCAGAATCTGG ATTTGGA), NFATc1 (CCGTCCAAGTCAGTTTCTATGT), tartrateresistant acid phosphatase (TRAP) (CACTTTGCACTACAAGACGG), RANKL (GGAAGCGTACCTACAGACTATC), RUNX2 (GCTTCTCAGCTTTAGCGTC), Osteoprotegerin (OPG) (CTTGCCCTGACCACTCTTATAC), osteocalcin (CCAAGCAGGAGGGCAATAA) Alizarin Red S (A5533, Sigma, USA), and the ALP staining kit (NBT/BCIP, 34042, Thermo, USA). .. Antibodies were purchased from multiple suppliers: GAPDH (2118S), Cathepsin K (57056S), c-Fos (2250S), NFATc1 (4389S), Runx2 (12556S), and FXR (72105S), HRP-conjugated anti-mouse (58802S) and anti-rabbit (7074) secondary antibodies from Cell Signalling Technology (USA), and the TGR5 antibody (PA5–23182) from Thermo Fisher Scientific (Invitrogen, USA).

    Bicinchoninic Acid Protein Assay:

    Article Title: Integrating Network Pharmacology, Molecular Docking, Molecular Dynamics Simulation, and Experimental Validation to Elucidate the Efficacy and Mechanism of Wanbi Hantong Yin in Rheumatoid Arthritis.
    Article Snippet: Background: Wanbi Hantong Yin (WHY), a traditional Chinese medicine (TCM) formulation, has demonstrated therapeutic efficacy in rheumatoid arthritis (RA).. However, its underlying molecular mechanisms remain largely unclear.. This study combined bioinformatics analyses, including network pharmacology, molecular docking, and molecular dynamics (MD) simulation, with in vivo validation to elucidate the pharmacological mechanisms of WHY in the treatment of RA.

    Produced:

    Article Title: Strategic engineering of imidazopyridine-benzoxazole hybrids targeting microtubule dynamics: comprehensive inhibition of the metastatic cascade.
    Article Snippet: A series of twenty novel imidazopyridine–benzoxazole hybrid (Imp1–20) derivatives was designed and synthesized, and their antiproliferative activities were evaluated against MDA-MB-231 breast and DLD-1 colorectal cancer cell lines.. Among them, Imp-18 and Imp-20 emerged as the most potent candidates, with low micromolar to nanomolar IC50 values and significant reductions in cancer cell adhesion and colony formation.. Flow cytometry analyses demonstrated that both compounds induced apoptosis and promoted cell-cycle arrest, reflected by Sub-G1 accumulation and perturbations in G1/G0 and G2/M phases.



    Similar Products

    99
    TaKaRa primescripttm ii 1st strand cdna synthesis kit
    Primescripttm Ii 1st Strand Cdna Synthesis Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cdna+synthesis+kit/PrimeScript+1st+strand+cDNA+Synthesis+Kit/pmc13123502-115-29-36
    Average 99 stars, based on 1 article reviews
    primescripttm ii 1st strand cdna synthesis kit - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    97
    Quanta Biosciences qscript cdna synthesis kit
    Qscript Cdna Synthesis Kit, supplied by Quanta Biosciences, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cdna+synthesis+kit/qScript+cDNA+Synthesis+Kit/custom%4095047-025%4042436854
    Average 97 stars, based on 1 article reviews
    qscript cdna synthesis kit - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    96
    Jena Bioscience script cdna synthesis kit
    Script Cdna Synthesis Kit, supplied by Jena Bioscience, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cdna+synthesis+kit/SCRIPT+cDNA+Synthesis+Kit/custom%40pcr-511%4042667340
    Average 96 stars, based on 1 article reviews
    script cdna synthesis kit - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    93
    Toyobo quantaccuracy, rt-ramda cdna synthesis kit
    Quantaccuracy, Rt Ramda Cdna Synthesis Kit, supplied by Toyobo, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cdna+synthesis+kit/QuantAccuracy%2C+RT-RamDA+cDNA+Synthesis+Kit/custom%40rmq-101%4010%2E64898%2F2026%2E08%2E25%2E746941
    Average 93 stars, based on 1 article reviews
    quantaccuracy, rt-ramda cdna synthesis kit - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    96
    TaKaRa cdna synthesis kit
    Cdna Synthesis Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cdna+synthesis+kit/SMARTer+PCR+cDNA+Synthesis+Kit/pmc13090977-105-6-9
    Average 96 stars, based on 1 article reviews
    cdna synthesis kit - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    95
    PCR Biosystems Ltd ultrascript reverse transcriptase
    Ultrascript Reverse Transcriptase, supplied by PCR Biosystems Ltd, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cdna+synthesis+kit/UltraScript+Reverse+Transcriptase/custom%40b30-11-02%4042650885
    Average 95 stars, based on 1 article reviews
    ultrascript reverse transcriptase - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    99
    Bio-Rad iscript1tm cdna synthesis kit
    Iscript1tm Cdna Synthesis Kit, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cdna+synthesis+kit/iScript+cDNA+Synthesis+Kit/pmc12993172-136-9-13
    Average 99 stars, based on 1 article reviews
    iscript1tm cdna synthesis kit - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results